Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
DNA repair protein XRCC4 wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA sequencing wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA replication wikipedia , lookup
DNA profiling wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
Helitron (biology) wikipedia , lookup
Thermo Scientific PCR and qPCR Product Guide 2012 TATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGAT CGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATA TCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCG ATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATC GCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATAT CGATCGCGATATCGATC GCGATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA TCGATCGAGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGAT CGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATA TCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCG ATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATC GCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATAT CGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGC TCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCG CGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATC GATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCG GCGATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATC GCGATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA GATCGGCGATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATTCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG C G A T C G A T C G A T C G A T C G A T C G A T C G A T C G A T C G A T C G A T C G A T C G A G A T C G C G A TA T C G A G A T C G C G A T A T C G A T C G A T C G C G A T A T C G A T C G A T C G C G A T ATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCG ATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGC ATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATC ATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGA ATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGTCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCG TCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGC ATCGCGATATCGTCGATCGATCGCGATATCGATCGATCGCGATATCG GATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGAATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATC TCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGC GATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGATA GATGCGATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGTCGATCGATCGCGATATCGATCGATCGCGATATCGATCGATCGCGAT ATCGATCGATCGGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGCGATATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGA GATCGATCGATCG TCGATCGATCGATCGATCGATCGAT PCR and qPCR product guide For more information visit: www.thermoscientific.com/pcr © 2011 Thermo Fisher Scientific Inc. All rights reserved. All other trademarks are the property of Thermo Fisher Scientific Inc. and its subsidiaries. Specifications, terms and pricing are subject to change. Not all products are available in all countries. Please consult your local sales representative for details. 0020111H01P / PB_2011_163 Thermo Scientific Molecular Biology Solutions 2012 supporting great science through innovation in molecular biology For years these names represented leading technology, ABgene reliable results and superior service. Our innovations PCR | qPCR produced novel restriction enzymes, the highest fidelity Dharmacon polymerases and most specific siRNAs. Today, the people RNAi | Synthetic RNA behind our expanding Thermo Scientific research portfolio Fermentas Enzymes | Molecular biology tools remain committed to supporting your research and making it even easier for you to do great science. Finnzymes PCR | qPCR Open Biosystems RNAi | Gene Expression Our Passion – Your Results Solutions for PCR and qPCR The Thermo Scientific PCR and qPCR portfolio has everything you need for a successful run: reagents, instruments and plastic consumables. Our innovative portfolio is assembled by combining the state-of-the-art product lines from ABgene, Finnzymes and Fermentas. The products within – born of scientific breakthroughs, themselves – are accelerating discovery in life science, and our aim is to continue to develop new tools to increase your efficiency and enhance your effectiveness. PCR • • • • • • • qPCR • Dye-based detection • Probe-based detection • Pre-designed assays • RT-qPCR Standard High fidelity Hot start Long range Fast Direct PCR RT-PCR Starting material Sample preparation • DNA isolation • RNA isolation • PCR and qPCR consumables • Storage plates cDNA synthesis Amplification • R everse transcriptases for PCR and qPCR • PCR and qPCR consumables • D NA polymerases and master mixes for PCR • qPCR master mixes • Pre-designed assays for gene expression studies • PCR and qPCR consumables • Thermal cyclers Data analysis • 1-Step RT-PCR kits • 1-Step RT-qPCR kits Know what you want? Turn to page 4 for ordering and contact details. Find the right products using the following selection guides Table of Contents Maxima First Strand cDNA Synthesis Kit RevertAid Premium Reverse Transcriptase RevertAid Premium First Strand cDNA Synthesis Kit RevertAid H Minus Reverse Transcriptase RevertAid H Minus First Strand cDNA Synthesis Kit RevertAid Reverse Transcriptase RevertAid First Strand cDNA Synthesis Kit Complete kits for RT-PCR and RT-qPCR Phusion RT-PCR Kit Verso 1-Step RT-PCR Kits Verso 1-Step RT-qPCR Kits for SYBR Green Chemistry Verso 1-Step RT-qPCR Kits for Probe Chemistry Additional Reverse Transcription Reagents Introduction Ordering Information Custom and OEM Manufacturing The Complete Solution - High Performance PCR 4 5 6 Thermo Scientific PCR Reagents Pioneering in PCR Technology PCR Reagents Selection Guide Direct PCR Introduction to Direct PCR Phire Plant Direct PCR Kit Phire Animal Tissue Direct PCR Kit Phusion Human Specimen Direct PCR Kit Phusion Blood Direct PCR Kit PCR Introduction to Phusion Technology Phusion High-Fidelity DNA Polymerases Phusion Hot Start II High-Fidelity DNA Polymerase Phusion Flash High-Fidelity PCR Master Mix Introduction to Phire Technology Phire Hot Start II DNA Polymerase Maxima Hot Start Taq DNA Polymerase Maxima Hot Start Green PCR Master Mix DreamTaq DNA Polymerase DreamTaq Green DNA Polymerase Taq DNA Polymerase Long PCR Enzyme Mix Phusion Site-Directed Mutagenesis Kit Additional PCR Reagents 10 12 14 16 17 18 19 PCR Buffers FastRuler DNA Ladders GeneRuler and O’GeneRuler DNA Ladders Deoxyribonucleotide Triphosphates (dNTPs) Uracil-DNA Glycosylase (UNG, UDG) RiboLock RNase Inhibitor Water, nuclease-free MgCl2, 25 mM Oligo(dT)18 Primer Random Hexamer Primer Harris Uni-Core and Cutting Mat for Direct PCR 20 22 23 23 24 25 26 27 28 29 30 31 32 33 42 44 45 46 47 48 49 50 Protocols and Recommendations Troubleshooting Quality Control Technical Data RT Enzyme Selection Guide Solutions for RT-PCR Solutions for RT-qPCR Reagents and Kits for Reverse Transcription Maxima Reverse Transcriptase 2 www.thermoscientific.com/pcr E KIT Stand-alone Enzyme Complete Kit Master Mix qPCR Ideal for qPCR Added color H1 SA Cut Plate Corner NEW New for 2011 51 52 53 54 Thermo Scientific RT, RT-PCR and RT-qPCR 56 57 57 58 66 67 68 69 70 71 72 73 74 75 75 76 76 76 76 77 Protocols and Technical Guidelines Key to Icons 36 38 40 PCR reagents selection guide p. 12 qPCR reagents selection guide p. 38 qPCR instrument compatibility table p. 40 RT enzyme selection guide p. 56 Plastics compatibility table p. 96 Thermo Scientific Accessory Products Thermo Scientific qPCR Reagents Adding some Color to the World of qPCR qPCR Reagents Selection Guide Instrument Compatibility Table Pre-Designed Probe Assays Introduction to Solaris Technology Solaris qPCR Gene Expression Assays – Gene-specific Primers and MGB-probe Solaris qPCR Gene Expression Master Mixes Solaris RNA Spike Control Kit Probe Master Mixes DyNAmo Flash Probe qPCR Kit DyNAmo ColorFlash Probe qPCR Kit Maxima Probe qPCR Master Mixes DyNAmo SNP Genotyping Master Mix SYBR Green Master Mixes DyNAmo Flash SYBR Green qPCR Kit DyNAmo ColorFlash SYBR Green qPCR Kit Maxima SYBR Green qPCR Master Mixes Additional qPCR Reagents 59 60 61 62 63 64 65 Useful webtools for PCR and qPCR www.thermoscientific.com/ pcrwebtools www.thermoscientific.com/ reviewer 78 81 88 89 Thermo Scientific PCR Consumables PCR Consumables Not all PCR Plastics are Created Equal Tubes and Strip Tubes Plastics Compatibility Table 96-Well Plates Piko PCR Plates, Frames and Support Racks 384-Well Plates Sealing Options Storage Plates 90 92 94 96 98 100 101 102 104 Thermo Scientific PCR Instruments The Evolution of PCR Thermal Cyclers Piko Thermal Cyclers Arktik Thermal Cycler PikoReal Real-Time PCR System Piko Plate Illuminator 108 110 112 114 116 Appendices Index by Product Number Index by Product Name Trademarks Licenses Contact Details 118 119 120 120 127 www.thermoscientific.com/pcr 3 Ordering Information Custom and OEM Manufacturing Thermo Scientific PCR and qPCR products are available through Thermo Scientific and Fisher Scientific offices and online ordering systems as well as authorized distributors. Please refer to www.thermoscientific.com/pcrordering. Note that all products may not be available through all ordering channels and/or countries. Check the product availability from your local sales office. Our certified cleanroom facilities, integrated quality management system, and extensive R&D experience enable us to produce the highest quality products for pharmaceutical, molecular diagnostic and life science research. At Thermo Fisher Scientific, we work closely with our clients’ R&D and production teams to provide value-added customized solutions backed by professional support and service. Product Use Limitation Technology Development and Custom Manufacturing All products in this catalog have been developed and are sold exclusively for research purposes and in vitro use only. These products have not been tested for use in diagnostics or drug development, nor are they suitable for administration to humans or animals. Our capabilities include: • ISO 9001 and ISO 13485 certification •Class 100,000 and 10,000 cleanroom manufacturing facilities •Custom formulations for research and diagnostic solutions •Vialling, labeling and packaging according to requirements •Pre-aliquoted PCR and qPCR reagents into plastic consumables Reliability of Information The information presented herein is accurate and reliable to the best of our knowledge and belief, but it is not guaranteed to be so. Nothing herein is to be construed as recommending any practice or any product in violation of any law or regulation. It is the user’s responsibility to determine for himself or herself the suitability of any product, material and/or procedure for a specific purpose and to adopt such safety precautions as may be necessary and prudent. A broad range of our molecular biology products are available for customization, including: • PCR and qPCR master mixes • DNA and RNA ladders and markers • dNTPs, NTPs and modified nucleotides • DNA and RNA polymerases • DNA/RNA modifying enzymes • Restriction enzymes • Plastic consumables Shipping Reagents are shipped on either gel ice or dry ice. The gel ice holds the product temperature below 0°C for 3 days at an ambient temperature of 25°C. The recommended storage temperatures for each product can be found in this product guide and in the product user guides. To avoid waste and to protect the environment, polystyrene boxes should be recycled. On-Site Stocking Program Thermo Scientific PCR, qPCR and reverse transcription reagents can be made available to all customers in an on-site freezer program, either in a laboratory or common area. Freezers can be stocked to meet your requirements and usage levels. Please contact your local sales office for further details. 4 www.thermoscientific.com/pcr HELP Technical support contacts For technical support of our products please contact the following email addresses: North America: [email protected] Europe and Asia/Pacific: [email protected] Contact us We welcome your requests by email: custompcr.genomics@ thermofisher.com Our core competencies include: •Amplification reagent development and optimization •Purification of native and recombinant proteins •Plasmid DNA preparation (pharmaceutical grade meeting FDA and EU guidelines, transfection grade and research grade) • RNA production and purification • Process development • DNA and RNA ladders • In vitro protein evolution (reverse transcriptases and DNA polymerases). •Pilot-scale fermentation and production of biomass • Processing of nucleic acids by enzymes •State-of-the-art manufacturing of plastics consumables Quality You Can Count On Reagent products are manufactured in Class 100,000 cleanroom facilities, qualified and certified according to EU directives and ISPE guidelines. Quality assurance is compliant with ISO 9001 and ISO 14001 environmental management systems, guaranteeing batch-to-batch reproducibility. Our PCR plastic consumables can be manufactured to ISO 13485 standards upon request. Complete Process and Product Documentation Products are supplied with a certificate of analysis detailing the conditions and results of quality assurance tests, and upon your request, with batch records allowing full traceability of all parameters. www.thermoscientific.com/pcr 5 The Complete Solution – High Performance PCR In recent years, PCR has progressed beyond its use as a general research tool to include many specialized applications in veterinary, forensics, food, and healthcare fields. These fields have demanding requirements for PCR, including reaction speed, consistency of results, robustness in difficult conditions, higher product yields, improvements in fidelity, and better specificity. To meet the demands of these advanced applications, we offer an integrated solution that substantially improves nearly every measurable aspect of PCR. This complete solution consists of advanced fusion polymerase enzymes, compact yet powerful PCR instruments, and PCR vessels made with industry leading ultra-thin molding technology. With this powerful combination, you can use 50% less reagents and plastics, run <15 minute PCR protocols, and get accurate and specific amplification with high yields. Applications • Fast PCR • High-fidelity PCR • Cloning • High throughput PCR • GC-rich and other difficult templates • PCR directly from impure starting material • PCR in inhibitory conditions Significant time and cost savings for a high throughput genotyping assay High Performance PCR Conventional PCR with Taq 20 min 63 min Conventional PCR with Pfu 99 min gDNA GUSB 0.7 kb A High Performance PCR combines bestin-class polymerases, instruments, and reaction vessels into a truly integrated solution for PCR. Compared to any other system, it brings savings in time, space, and costs allowing DNA amplification with the highest accuracy and significantly shorter protocol times. Speed Significantly faster than any other combination. INRA Sophie-Antipolis, a public research center in France, tested Phusion Flash High-Fidelity PCR Master Mix, Piko Thermal Cycler and UTW vessels for genotyping aphids using multiplex PCR. They compared this High Performance PCR solution to the traditional PCR method of using Taq DNA polymerase, a conventional thermal cycler and standard reaction vessels. The objective was to significantly reduce the reaction time and cost of multiplex PCR without the loss of assay sensitivity or accuracy. In the assay, seven microsatellite loci were amplified from 5000 aphids by multiplex PCR. The results were compared with those previously obtained with the traditional method fully optimized for the assay. Using the High Performance PCR solution, one PCR run took only 15 minutes as compared to 2.5 hours with the traditional method. Total time saving for multiplexing all 5000 aphids was 86% (38 hours vs 273 hours). It was also confirmed that the High Performance PCR solution did not adversely affect the quality of the results. The High Performance PCR solution also decreased the costs remarkably, to 1/3 of the original cost. “The High Performance PCR solution also decreased the costs remarkably, to 1/3 of the original cost.” Fidelity Phusion DNA Polymerases offer superior accuracy over Taq- and Pfu- based systems. 4000 3500 200 3000 2500 150 Yield 2000 Higher amplification efficiency results in more product. Phusion High-Fidelity DNA Polymerases or Phire Hot Start II DNA Polymerase Piko Thermal Cycler 100 Specificity 1000 500 Reduced levels of primerdimers and false-primed products. 0 0 Conventional PCR High Performance PCR “Note d’application Ozyme. Génotypage en PCR multiplexe”Ozyme (2007). Carletto J. et al. “Screening the bacterial endosymbiotic community of sap-feeding insects by terminal-restriction fragment length polymorphism analysis.” Entomologia Experimentalis et Applicata 129:228-234 (2008). www.thermoscientific.com/pcr 1500 50 Ultra Thin Wall (UTW) reaction vessels 6 Cost (€) Time (hours) 250 Comparison of High Performance PCR and conventional PCR With High Performance PCR, the results for genotyping 5000 aphids were obtained seven times faster and at one third the cost. The High Performance PCR solution significantly reduced both the PCR reaction time and cost of the assay. www.thermoscientific.com/pcr 7 Thermo Scientific Reagents Push the limits of nucleic acid amplification with our broad portfolio of market leading enzyme technologies. We offer multiple polymerases that deliver top performance over a range of applications, from Hot Start PCR to High-Fidelity and Direct PCR. Our qPCR enzymes and master mixes have been engineered to work together to give maximum sensitivity and reproducibility, and all products are rigorously lot-tested to ensure consistent high performance from each and every kit. Thermo Scientific PCR, qPCR, and reverse transcription reagents are designed, manufactured, and tested to ensure optimal performance. 8 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 9 Pioneering in PCR Technology Extending the possibilities Since its invention, improvements in PCR have largely depended on advancements in enzymology. The first great breakthrough in PCR technology was the replacement of Escherichia coli (E. coli) DNA polymerase (or its derivative Klenow Fragment) with a thermostable polymerase from Thermus aquaticus (Taq)4. This polymerase could withstand the high temperatures required during the denaturation and extension steps of PCR, and thus fresh enzyme was not required during each cycle. Taq polymerase was commercialized in the late 1980s, spurring a boom in PCR and ultimately becoming Science magazine’s first “molecule of the year” in 19895. Although a vast improvement over using E. coli Pol I, Taq polymerase still had some serious drawbacks. Limited thermostability at temperatures above 94°C reduced the enzymes effectiveness when targeting regions with high GC-content or particularly strong secondary structure, plus a lack of proofreading ability rendered Taq rather error prone, thus complicating cloning and sequencing projects that utilized PCR. The race was now on to develop even better polymerases for PCR. The pursuit of the advanced polymerase The first thermophilic DNA polymerase exhibiting improved fidelity was characterized by the founders of Finnzymes Oy (now part of Thermo Fisher Scientific) in 19916. A 3’ to 5’ exonuclease activity allowed this polymerase to proofread as it extended the new DNA strand, and correct errors as it progressed. This resulted in an overall increase in fidelity several fold, and as a bonus also greatly improved the ability of this enzyme to successfully amplify long PCR products (Taq polymerase, typically being stalled by its own misincorporations, is quite poor at amplifying targets larger than a few kilobases). The specificity of PCR can be adversely affected by non-specific binding of the primers to themselves or to non-target DNA, which can occur during the time between reaction set up and the first denaturation step. To avoid this, “hot start” techniques were developed by several groups independently in the late 1980s. The first manual hot start methods involved simply heating up the PCR reaction to 95°C and then cooling to 60-70°C before adding the polymerase; this method was effective but tedious and carried the risk of cross-contamination of samples when the hot tubes were opened. By 1991, new products were developed such as waxes that could be used to physically separate the enzyme from the PCR mix until initial denaturation. As so often in the history of PCR, however, the enduring technological advancement involved the polymerase. By adding a specific antibody (or similar molecule such as an aptamer or an Affibody®) that inactivates the polymerase, the enzyme itself can be bestowed with hot start functionality, as demonstrated by two groups independently in 19947,8. By 1997, Mimicking nature – Phusion proteins Further improving on naturally occurring DNA polymerases required a technological leap. The breakthrough innovation was to introduce fusion protein technology into DNA polymerases9. The first of these next generation polymerases was Phusion High Fidelity DNA polymerase. Phusion is an engineered enzyme combining an Archaebacterial polymerase possessing strong proofreading ability with a thermostable doublestranded DNA binding protein. This binding protein increases affinity of the polymerase for double-stranded DNA, functionally mimicking the processivity factors that are normally found in the complex DNA replisomes of live cells. The high processivity and robustness of Phusion make the enzyme extremely resistant to PCR inhibitors and enable additional applications not feasible with other more standard polymerases. These properties were exploited with the introduction of Direct PCR kits that allow PCR to be performed directly from a wide range of starting material, without the need for sample preparation or DNA isolation. Kits have been developed allowing PCR to be performed directly from blood as well as a variety of plant, animal and human tissues. Evolution of enzymes in vitro The idea of using rational design criteria to improve enzyme performance is limited by our knowledge of polymerase fine structure and function. However, Fermentas’ patented technology for in vitro protein evolution (2009), enabled the introduction and selection of favorable mutations into polymerases and transcriptases. The Maxima and RevertAid Premium Reverse Transcriptases are examples of enzymes that were derived by in vitro evolution of M-MuLV RT. The resulting enzymes show a 50x increase in processivity compared to their wild-type counterparts, and are highly thermostable at temperatures up to 65ºC. Additionally, similar to Phusion DNA polymerases, Maxima and RevertAid Premium RTs demonstrate increased resistance to reaction inhibitors such as guanidine or formamide. REVIEW PCR is a biochemical process for amplifying large quantities of particular DNA sequences from relatively small amounts of starting material. The basic concepts involved in PCR were described as early as 19711, but it was not until 1985 that they were reduced to practice by Kary Mullis and patented at Cetus Corporation2,3. PCR revolutionized molecular biology almost overnight, and Kary Mullis was awarded the Nobel Prize in 1993 – within a decade of inventing the method. a chemical modification of DNA polymerase was demonstrated to produce similar results, although the enzyme reactivated over the course of the PCR, and thus behaved differently to the antibody-based versions. A fusion of synergistic technologies The recent acquisitions of Finnzymes and Fermentas by Thermo Fisher Scientific have brought together a wide variety of technologies, and these synergies will allow for exciting new product development in the field of PCR and RT-PCR. Finnzymes’ advanced PCR enzymes together with the trusted Fermentas PCR and reverse transcriptase enzymes derived from in vitro evolution make a powerful combination that will help scientists in molecular biology continue to make new discoveries and drive innovation. 1.Kleppe K, Ohtsuka E, Kleppe R, Molineux I and Khorana HG “Studies on polynucleotides. XCVI. Repair replications of short synthetic DNA’s as catalyzed by DNA polymerases.” J. Mol. Biol. 56: 341-361 (1971). 2.Saiki RK et al. “Enzymatic amplification of ß-globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia.” Science 230: 1350-54 (1985). 3.Mullis KB “Process for amplifying nucleic acid sequences” U.S. Patent 4,683,202. 4.Saiki RK, Gelfand DH, Stoffel S, Scharf SJ, Higuchi R, Horn GT, Mullis KB. and Erlich HA “Primerdirected enzymatic amplification of DNA with a thermostable DNA polymerase.” Science, 239:48791 (1988). 5. Guyer RL, and Koshland DE “The Molecule of the Year.” Science 246:1543-1546 (1989). 6. Mattila P, Korpela J, Tenkanen T and Pitkänen K “Fidelity of DNA synthesis by the Thermococcus litoralis DNA polymerase - an extremely heat stable enzyme with proofreading activity” Nucleic Acids Res. 19: 4967-4973 (1991). 7. Sharkey DJ, Scalice ER, Christy Jr KG, Atwood SM and Daiss JL. “Antibodies as thermolabile switches: high temperature triggering for the Polymerase Chain Reaction.” Nature Biotechnology 12: 506 - 509 (1994). 8.Kellogg DE, Rybalkin I, Chen S, Mukhamedova N, Vlasik T, Siebert PD, Chenchik A. “TaqStart antibody: hot start PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase.” BioTechniques 16 (6):1134-1137 (1994). 9.Wang Y, Prosen DE, Mei L. Sullivan JC, Finney M, and Vander Horn PB “A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro.” Nucleic Acids Res. 32:1197-1207 (2004). 10 www.thermoscientific.com/pcr 1995 Patent for Taq DNA polymerase is filed by Mullis et al. The first automated PCR cycler is introduced to the market by Perkin Elmer and Cetus (joint venture) The first highfidelity DNA polymerase is characterized by Mattila et al. Hot start PCR by wax 2000 Antibody based hot start technology described Phusion HighFidelity DNA Polymerase, the first PCR enzyme based on fusion protein technology, is launched by Finnzymes Oy 2010 2007 2005 Genome of the first eukaryotic organism, Saccharomyces cerevisiae, is sequenced Two commercial real-time PCR instruments are launched to market The first complete human genome is sequenced by Levy et. al. Gibson et al. create the first bacterial cell controlled by a chemically synthesized genome (using Phusion High Fidelity DNA Polymerase) 2010 2009 1990 Lynx Therapeutics publishes and markets “MPSS” - a parallelized, adapter/ligation-mediated, bead-based sequencing technology, launching “nextgeneration” sequencing 2003 The first real-time PCR instrument is described The first complete genome of a freeliving organism is sequenced by Venter and colleagues (Haemophilus influenzae) 2000 1995 1993 1989 1985 Working for Cetus, Kary Mullis discovers that using two oligonucleotides instead of one – on opposite strands- enables DNA to be synthesized from a single, specific, location in the genome. Technique for PCR was created Kary Mullis received the Nobel Prize 1996 Frederik Sanger and colleagues introduce the “dideoxy” chain-termination method for sequencing DNA (also known as ‘Sanger sequencing’). It utilizes DNA polymerase, nucleotide precursors and one oligonucleotide primer 1985 Science Magazine names Taq polymerase its first “Molecule of the Year” 1994 1980 PCR technique is described in an article published in Science (Saiki et al.) 1991 Kleppe and co-workers first describe a method using an enzymatic assay to replicate a short DNA template with primers in vitro 1982 1976 1975 The first cited use of microarray technology (Augenlicht LH, Kobrin D. “Cloning and screening of sequences expressed in a mouse colon tumor.”. Cancer Research 42 (3): 1088–1093. PMID 7059971, 1982. http:// cancerres.aacrjournals.org/ content/42/3/1088.long 1988 1971 1950 1955 1960 1965 1970 Taq polymerase is isolated (a thermostable DNA polymerase named after the thermophilic bacterium Thermus aquaticus) 1983 The discovery of the DNA double helix structure Thomas Brock reports on the isolation of a extremophilic bacterium Thermophilis aquaticus 1977 1953 1967 PCR through the ages The MIQE guidelines (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) are published by Bustin et. al. www.thermoscientific.com/pcr 11 Thermo Scientific PCR Reagents Selection Guide Standard PCR Hot Start PCR High-Fidelity PCR Fast PCR General PCR applications requiring consistent and reliable polymerase performance. To detect presence/ absence of target sequence. Challenging PCR applications requiring maximum specificity and sensitivity, to detect rare or complex targets. PCR applications requiring highly accurate amplification, to produce PCR product with minimal sequence errors. PCR applications for maximum time savings. Routine performance Taq DNA Polymerase Enhanced performance Long targets DreamTaq DNA Long PCR Enzyme Polymerase Mix1 Non-high fidelity High-fidelity Non-hot start Hot start Fast Non-high fidelity High-fidelity Maxima Hot Start Taq Phire Hot Start II DNA Polymerase DNA Polymerase Phusion Hot Start II DNA Polymerase Phusion High-Fidelity DNA Polymerase Phusion Hot Start II HighFidelity DNA Polymerase Phusion Flash HighFidelity PCR Master Mix Phire Hot Start II DNA Polymerase Phusion Flash HighFidelity PCR Master Mix Applications Applications Routine PCR ● ● ● ● High throughput ● ● ● ● Difficult (GC-rich) templates ● Template generation for sequencing Multiplex PCR Routine PCR ● ● High throughput ● ● Difficult (GC-rich) templates ● ● ● Template generation for sequencing ● ● ● ● Multiplex PCR ● ● Genotyping ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Long-range PCR Cloning ● ● ● ● ● Cloning Mutagenesis2 ● ● ● ● ● ● ● ● Genotyping ● ● Long-range PCR ● Microarray ● Characteristics 5'-3' exonuclease activity Yes Yes Moderate Yes No No No No No No No 5'-3' exonuclease activity Proofreading activity (3'-5' exonuclease activity) No No Moderate No Moderate Yes Yes Yes Yes Moderate Yes Proofreading activity (3'-5' exonuclease activity) dUTP incorporation Yes No No Yes No No No No No No No dUTP incorporation Blunt or 3'A ends 3'A 3'A 3’A/Blunt 3’A Blunt Blunt Blunt Blunt Blunt Blunt Blunt Fidelity vs. Taq 1x 1x 3x 1x 2x 52x 52x 52x 25x 2x 25x ≤5/10 kb ≤6/20 kb ≤20/47 kb ≤3/5 kb ≤7.5/20 kb ≤16/20 kb ≤16/20 kb ≤16/20 kb ≤16/20 kb ≤7.5/20 kb ≤16/20 kb No No No No No No No 3 4 Blunt or 3'A ends Fidelity vs. Taq Amplicon length, genomic/phage DNA No Yes * ** * ** *** *** *** *** ** *** Accuracy/Fidelity * * * *** *** *** * *** ** *** ** Specificity Sensitivity * ** ** *** *** *** ** *** *** *** *** Sensitivity Yield * ** ** * *** *** *** *** *** *** *** Yield Enzyme Yes Yes Yes Yes Yes Yes Yes Yes No Yes No Enzyme Master Mix Yes Yes No Yes No No Yes No Yes No Yes Master Mix Complete kit No No No No No No Yes No No No No Complete kit See p. 30 See p. 28 See p. 31 See p. 26 See p. 25 See p. 23 See p. 22 See p. 23 See p. 23 See p. 25 See p. 23 Color for direct loading No Yes Accuracy/Fidelity * Specificity Performance Available as 1 Not available in US 2 Phusion Site-Directed Mutagenesis Kit also available. See p. 32. www.thermoscientific.com/pcr Color for direct loading Performance Available as 12 Mutagenesis2 Microarray ● Characteristics Amplicon length, genomic/phage DNA PCR The Thermo Scientific PCR reagent product line is a concise portfolio of powerful enzymes built to satisfy a broad range of demanding PCR applications. Whether you are performing routine detection or site-directed mutagenesis, our line provides a clear solution for success with your application. And to deliver the ultimate in assay flexibility, our enzymes are supported by a range of convenient formats to suit any workflow. 3 See DreamTaq Green DNA Polymerases on p. 29. 4 See Maxima Hot Start Green PCR Master Mix on p. 27. ● Recommended www.thermoscientific.com/pcr 1313 DIRECT PCR Dilution Protocol DIRECT PCR Dilution buffer A few minutes in incubation buffer A few minutes in incubation buffer Amplify without prior DNA purification PCR reaction with Thermo Scientific Direct PCR PCR reaction The Direct PCR approach delivers unprecedented convenience for DNA amplification by allowing PCR directly from unpurified samples. A tiny amount of source material is used directly in the PCR reaction without any purification steps, allowing significant savings in both time and cost. Based on advanced Thermo Scientific Phusion and Phire DNA Polymerases Our Direct PCR approach is based on the unique Phusion and Phire DNA Polymerases. These specially engineered DNA polymerases have superior features over any other PCR enzyme. Phusion and Phire DNA Polymerases are extremely fast, robust and highly tolerant of many PCR inhibitors present in unpurified sample materials. Due to their unique characteristics, these DNA polymerases are capable of reliably amplifying DNA in extremely challenging conditions – such as directly from a sample. DIRECT PCR ion Dilution Protocol Dilution buffer ion l Direct Protocol Benefits • No need for timePCR reaction consuming and expensive DNA purification steps •Very little sample material required •Simple protocols with minimal hands-on time •Extremely short PCR protocol times •Tested with a wide variety of sample types •Robust hot start DNA polymerases guarantee high yields of specific product •Two short protocols for various needs Direct PCR in plant research Direct Protocol DIRECT PCR Dilution Protocol Dilution buffer A few minutes in incubation buffer PCR reaction PCR reaction Direct PCR from 0.5 mm leaf discs Direct Protocol • Minimal hands-on time •DNA fragments up to 5 kb from liquid samples •DNA fragments up to 1 kb from solid samples •Samples dried on storage cards Dilution Protocol •Allows tens of PCR reactions from one tiny sample •For long and difficult amplicons •Allows archiving of precious samples www.thermoscientific.com/pcr Convenient sampling tools included in Plant and Animal Tissue Direct PCR kits - Arabidopsis Tomato Maize + PCR reaction 14 A Harris Uni-Core tool was used to punch 0.5 mm discs from leaves of maize, tomato and Arabidopsis plants. The punches were then placed directly into 20 μl PCR reactions. Mitochondrial (maize) or genomic (tomato and Arabidopsis) targets of 1.8 to 3.5 kb were amplified using the Phire Plant Direct PCR Kit (3-step protocol, 40 cycles, as recommended) using a 24-well Piko Thermal Cycler and UTW 8-tube strips. Overall protocol time varied from 50 min to 1 h 23 min depending on the amplicon length. Control reactions were also performed: negative control with no template and positive control with purified DNA. M The superior performance of Phusion DNA Polymerase is due to the fusion technology. A proofreading DNA Direct Dilution Protocol Protocol polymerase is fused to a small dsDNA binding protein DIRECT PCR creating a unique polymerase that generates PCR products with accuracy and speed unattainable with any other DNA polymerase. Similar technology is utilized in low-fidelity Phire Hot Start II DNA Polymerase to give this Dilution buffer PCR enzyme speed, robustness and tolerance against various PCR inhibitors. PCR reaction DNA extraction and purification from various plant sources can require large amounts of sample material and add time and cost to the PCR workflow. Multiple steps also increase the risk of cross-contamination and human error. Direct PCR completely eliminates the need for DNA extraction, thus simplifying the PCR process and cutting costs. Phire Plant Direct PCR Kit is specifically designed to be used with plant material: leaf tissue, seeds and flowers, or punchouts of samples stored on FTA® cards. Only a tiny amount of sample (such as a 0.5 mm leaf disc) is needed, and it can be added directly to the PCR reaction. For consistency, using a Harris Uni-CoreTM puncher, included in the kit, is recommended for cutting out samples. In experiments, where multiple reactions need to be run on a single sample, or where a larger amount of sample material is used, a dilution protocol offers a convenient option. It employs a brief pre-incubation step in a buffer optimized to release DNA from a variety of materials. After the short incubation the buffer containing the DNA can be aliquoted and used directly for PCR reactions. The Phire Plant Direct PCR Kit also includes a pair of universal control primers that work with a wide variety of plant species. PCR l Would You Like to Run PCR Protocols without Purifying the DNA First? Now You Can! + - + M - High and specific PCR yields from plant samples with Phire Plant Direct PCR Kit DNA amplification from plant samples using Phire Plant Direct PCR Kit results in equally specific and high yields compared to the results obtained with conventional PCR from purified plant DNA. M size marker + purified DNA control − negative control with no template DNA. www.thermoscientific.com/pcr 15 Description KIT www.thermoscientific.com/directpcr Description Thermo Scientific Phire Plant Direct PCR Kit is designed to amplify DNA directly from plant samples. It has been tested with leaves and seeds from a wide variety of plant species. The kit includes a complete set of optimized reagents, sampling tools and detailed protocols making it an ideal choice for amplification of plant DNA. Benefits • • • • • No need for time-consuming and expensive DNA purification steps Very little sample material required Two simple protocols for various applications Convenient sampling tools included in the kit Phire Hot Start II DNA Polymerase provides high yields of specific product F-130 200 x 50 µl rxns • • • • • Store at -20°C. Examples of materials tested Leaves • Arabidopsis thaliana • Maize, rice, cotton • Tobacco, grapevine Seeds • Apple, carrot, pumpkin • • • • • • • Product contents M Direct Protocol Related products Direct Protocol Dilution buffer A few minutes in incubation buffer A few minutes in incubation buffer Detection of RNAi vector in gerbera plants Punches (0.50 mm) from plant leaves or petal tissues were placed PCR reaction directly in 20 μl PCR reactions. 210 bp products were amplified using transgene specific primers. The results indicate that plant individuals corresponding to samples 2, 4, 7, 9, and 11 contain the RNAi transgene. The obtained results were confirmed by conventional analysis of CTAB DNA extraction followed by PCR. Direct Direct Protocol Protocol DIRECT PCR Dilution Protocol A few minutes in incubation buffer PCR reaction PCR reaction PCR reaction M Dilution Protocol DIRECTPCR PCR DIRECT 1 2 3 4 5 6 7 8 Direct Protocol Dilution Protocol 9 10 11 DIRECT PCR - Genotyping F2 transgenic mice 0.50 mm punches of mouse ear tissue were placed directly into 50 μl PCR reactions. Two sets of primers were used in each reaction to genotype the 11 individual mice. The larger fragment was 490 bp (transgenic) and the smaller fragment 250 bp (wild type). M Dilution Protocol Direct PCR Kits See p. 16-19 Phire Hot Start II DNA Polymerase See p. 25 Dilution buffer PCR reaction Harris Uni-Core and Cutting Mat See p. 77 Dilution buffer Dilution buffer A few minutes in incubation buffer A few minutes in incubation buffer PCR reaction PCR reaction Molecular Weight Markers See p. 72-73 PCR reaction PCR reaction Product reference Zhou LW, Wei YL. “Changbai wood-rotting fungi 16. A new species of Fomitopsis (Fomitopsidaceae).” Mycol Progress. 10:1007/ s11557-011-0758-x (2011). 16 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color Direct Related products Protocol DIRECT Direct PCR Kits PCR See p. 16-19 Dilution Protocol Phire Hot Start II DNA Polymerase See p. 25 Dilution buffer A few minutes in Molecular Weight Markers incubation See p.buffer 72-73 PCR reaction PCR reaction PCR reaction 200 x 50 µl rxns Phire Hot Start II DNA Polymerase, 2x Phire Animal Tissue PCR Buffer (includes dNTPs and MgCl2), Universal control primer Dilution buffermm, and Harris Cutting Mat. mix, Dilution Buffer, DNARelease Additive, Gel loading dye, Harris Uni-Core 0.50 PCR reaction DIRECT PCR Phire Animal Tissue Direct PCR Kit Store at -20°C. Product contents 1-9 – Leaves 10-12 – Petal Direct Protocol Ordering Information Mouse tissues (e.g., ear, tail, liver, spleen, brain) Cultured mouse cells (fibroblasts) Drosophila (wing, whole insect) Zebrafish (fin) Caenorhabditis elegans (whole worm) Dog (hair) Siberian Jay (feather) Dilution Protocol DIRECT PCR Dilution buffer PCR reaction C(+) www.thermoscientific.com/directpcr Examples of materials tested Phire Hot Start II DNA Polymerase, 2x PhireDirect Plant PCR Buffer (includes dNTPs and MgCl2), Control Primer Mix, Dilution Dilution Protocol Buffer, Harris Uni-Core 0.50 mm and HarrisProtocol Cutting Mat. DIRECT PCR M 1 2 3 4 5 6 7 8 9 10 1112 C(-) No need for time-consuming and expensive DNA purification steps Very little sample material required Two simple protocols for various applications Convenient sampling tools included in the kit Phire Hot Start II DNA Polymerase provides high yields of specific product F-140 Fungi and moss • Magnaporthe sp • Mycorrhiza (various species from spruce roots) • Physcomitrella patens Tissue on storage cards • Maize, tomato, pea KIT Benefits Ordering Information Phire Plant Direct PCR Kit Bar Heading Phire Animal Tissue ctrl shift alt 4 Direct PCR Kit heading Thermo Scientific Phire Animal Tissue Direct PCR Kit has been developed for amplification of DNA directly from a wide variety of animal tissues including mice, fish, birds and insects. The kit contains all the necessary components for amplification of DNA directly from animal tissues: optimized reagents, sampling tools and DNARelease Additive, which can be used to improve the release of DNA from animal tissues. In addition, the kit includes detailed instructions and control primers that can be used with numerous animal species. PCR PCR B Bar Heading Phire Plant ctrl shift alt 4 Direct PCR Kit heading Product reference PCR reaction Yoshida H, Nozawa A, Kanda N, Kishiro T and Miyashita T. Results of onboard genetic analysis of common minke whale biopsy samples collected in the Okhotsk Sea, summer 2010. Document SC/D10/NPM9 submitted to the first intersessional workshop for North Pacific Minke Whale Implementation Review, (2010). www.thermoscientific.com/pcr 17 Description Description Thermo Scientific Phusion Blood Direct PCR Kit is designed for amplification of DNA from whole blood. The modified Phusion Hot Start II High-Fidelity DNA Polymerase is resistant to PCR inhibitors present in blood and retains its activity even with samples containing 40% whole blood. This extremely accurate proofreading DNA polymerase makes the Phusion Blood Direct PCR Kit an ideal choice even for demanding applications such as cloning. Thermo Scientific Phusion Human Specimen Direct PCR Kit delivers unprecedented convenience for DNA amplification by allowing PCR directly from unpurified human samples. The kit is compatible with fresh, frozen, and even Formalin-Fixed, Paraffin Embedded (FFPE) human tissue samples. It includes optimized reagents and detailed protocols for several sample materials. The modified Phusion Hot Start II High-Fidelity DNA Polymerase utilized in the kit is a highly accurate proofreading DNA polymerase; PCR products obtained are perfectly suitable even for cloning purposes. Benefits KIT Benefits www.thermoscientific.com/directpcr Ordering Information • • • • • • • • No need for time-consuming and expensive DNA purification steps Two simple protocols for various applications Extremely short PCR protocol times Modified Phusion Hot Start II High-Fidelity DNA Polymerase delivers abundant yields of specific product Phusion Human Specimen Direct PCR Kit F-150 200 x 20 µl rxns Store at -20°C. KIT No need for time-consuming and expensive DNA purification steps Simple protocol requires minimal hands-on time Extremely short PCR protocol times Modified Phusion Hot Start II High-Fidelity DNA Polymerase delivers abundant yields of specific product • • • • • • • • • • • • • • • • • Buccal swabs Fingernails Saliva Teeth Amniotic fluid Skin biopsies Hair FFPE tissue samples* Direct Protocol *We recommend the dilution protocol and a longer incubation. Amplicon sizes less than 300 bp are recommended due to fragmentation of DNA in FFPE samples. DIRECT PCR www.thermoscientific.com/directpcr Ordering Information Phusion Blood Direct PCR Kit Examples of materials tested Examples of materials tested Bar Heading Phusion Blood ctrl shift alt 4 Direct PCR Kit heading PCR PCR Phusion B Bar Heading Human ctrl shift altDirect Specimen 4 heading PCR Kit Mouse blood Pig blood Cat blood Dog blood Cow blood Bird blood Human blood Blood preserved with heparin, citrate, or EDTA Blood stored on Whatman 903™ and FTA™ cards Direct Protocol Dilution Protocol F-547S 100 x 20 µl rxns F-547L 500 x 20 µl rxns Store at -20°C except DMSO. Store DMSO at room temperature. DIRECT PCR Dilution Protocol Direct Protocol Product contents DIRECT PCR Phusion Blood II DNA Polymerase, 2x Phusion Blood PCR Buffer (includes dNTPs and MgCl2), 50 mM EDTA, 50 mM MgCl2, Dilution buffer A few minutes in DMSO, and Universal Control Primer Mix. incubation buffer Dilution buffer PCR reaction PCR reaction Phusion Human Specimen DNA Polymerase, 2x Phusion Human Specimen PCR Buffer (includes dNTPs and MgCl2), Universal control primer mix, Dilution Buffer, and DNARelease Additive. PCR reaction PCR reaction M Direct Protocol DIRECT PCR DIRECT PCR DIRECT PCR d Bir w Co g Do Ca t se Pig ou n ma Direct Direct Protocol Protocol Dilution Protocol M Consistent results from various human samples Different samples were placed directly into 20 μl PCR reactions. A 237 bp DNA fragment was successfully amplified using the control primers included in the kit. + and - denote control reactions with or without purified DNA. M Hu flu id tic Sa liv a Am nio cc al Ha sw ab ir To ot h Na il - Bu + - Direct Direct Protocol Protocol Dilution Dilution Protocol Protocol Dilution bufferbuffer Dilution Dilution buffer DIRECT PCR DIRECT PCR Dilution Protocol A few minutes in incubation buffer reaction PCRPCR reaction PCR reaction + PCR reaction Robust amplification from a wide variety of species Amplification of a 237 bp DNA fragment directly from whole blood of 7 different vertebrates (5% blood in the reaction). + and - denote control reactions. Dilution buffer A few minutes in incubation buffer A few minutes in incubation buffer A few minutes in incubation buffer PCR reaction M M Dilution buffer A few minutes in incubation buffer Product contents Dilution Protocol PCR reaction PCR reaction reaction PCRPCR reaction PCR reaction 18 PCR reaction Related products Related products Direct PCR Kits See p. 16-19 Direct PCR Kits See p. 16-19 Phusion High Fidelity DNA Polymerases See p. 22 Phusion High Fidelity DNA Polymerases See p. 22 Molecular Weight Markers See p. 72-73 Molecular Weight Markers See p. 72-73 Harris Uni-Core and Cutting Mat See p. 77 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 19 PCR Unique inactivation technology The hot start modification of Phusion Hot Start II High-Fidelity DNA Polymerase is based on a unique Affibody® inactivation technology3. This technology allows “zero-time reactivation” – immediate reactivation of the polymerase at standard cycling temperatures. At ambient temperatures a small thermostable Affibody protein (ligand) is non-covalently bound to the polymerase, inhibiting its activity. The ligand is released at elevated temperatures rendering a separate polymerase reactivation step unnecessary, thus further reducing overall reaction times. Unique Phusion technology allows for superior processivity* The processivity of proofreading DNA polymerases (such as Pfu) is usually much lower than that of DNA polymerases with no proofreading activity (such as Taq). Therefore, amplification of a DNA fragment using a proofreading DNA polymerase often requires a longer PCR protocol than when using enzymes with no proofreading properties. In contrast to conventional proofreading DNA polymerases, Phusion DNA Polymerases are extremely processive. These PCR enzymes are Pyrococcus-like proofreading DNA polymerases that have been uniquely engineered to contain a small, thermostable double-stranded DNA binding domain. The dsDNA-binding domain increases affinity of the polymerase for double-stranded DNA. This allows incorporation of more nucleotides per binding event and decreases the number of binding events required for elongation. Phusion DNA Polymerases are twice as processive than conventional Taq DNA polymerases and 10-fold more processive as Pfu. This results in shorter extension times and thus shorter overall PCR protocol times. In addition, Phusion DNA Polymerases are able to amplify long templates (up to 20 kb). M P A B 2.3 kb (GC-rich) 2.2 kb 1.7 kb Since their introduction in 2003, Thermo Scientific Phusion High-Fidelity DNA Polymerases have established a new standard for high-fidelity PCR. Phusion DNA Polymerases have proven to be first choice for several demanding PCR applications, including the creation of the first functional synthetic genome1,2. C D M P A B C D M P A B C D The most accurate DNA polymerase available In many applications such as cloning, site-directed mutagenesis or translating a DNA fragment into a protein, it is crucial to maintain the accurate DNA sequence during amplification. One incorrectly incorporated nucleotide may change the respective codon and result in the addition of an incorrect amino acid during translation. This, in turn, can affect folding and functional properties of the protein. On the other hand, deletion of a single nucleotide completely destroys the correct reading frame. PCR Phusion - PCR Performance No Other Enzyme Can Match M Phusion DNA Polymerases have extremely low error rates, thus setting a gold standard for high-fidelity PCR. The error rate, determined by a modified lacI-based method4, is approximately 50-fold lower than that of Taq DNA polymerase and 6-fold lower than that of Pfu DNA polymerase. After a 30-cycle PCR reaction of a 1 kb DNA fragment, only 32 of 100 fragments contain no errors when amplified with Taq. When amplified with Phusion, 99 out of 100 fragments are error free. P: Phusion Hot Start II High-Fidelity DNA Polymerase A-D: Proofreading hot start DNA polymerases from major suppliers Phusion Hot Start II provides extreme specificity and abundant yields Five proofreading hot start DNA polymerases from major suppliers were used to amplify 1.7-2.3 kb fragments from human genomic DNA. Phusion Hot Start II DNA Polymerase provided high yields of specific products whereas all other enzymes delivered zero or low yields, with some also amplifying non-specific products. 52 x Taq 32 x Taq 8 x Taq Phusion DNA Polymerases Robust amplification with less enzyme Pfu-based fusion DNA polymerase Pfu 7 x Taq KOD 1 x Taq Taq Relative fidelity values of different DNA polymerases Fidelity = 1 / error rate. Due to their unique structure, Phusion DNA Polymerases allow efficient amplification of DNA. High yields are obtained with fewer enzyme units as compared to other DNA polymerases. Also, these polymerases are highly robust which minimizes the need for reaction optimization. Recently, Phusion DNA Polymerases have been found to be highly tolerant of various PCR inhibitors allowing DNA amplification even from unpurified source material (See Direct PCR, p.14). Phusion DNA Polymerase •0.4 U / 20 µl rxn •3 min extension time •15 of 16 clones amplified The schematic structure of Phusion DNA Polymerase The double-strand DNA-binding domain (purple) is fused to a Pyrococcus-like proofreading enzyme (green), forming a unique high-performance polymerase. Pfu DNA polymerase Taq DNA polymerase •1.0 U / 20 µl rxn •10 min extension time •9 of 16 clones amplified •0.5 U / 20 µl rxn •3 min extension time •10 of 16 clones amplified 1.Gibson DG et al. “Complete chemical synthesis, assembly, and cloning of a Mycoplasma genitalium genome.” Science 319:1215-1220 (2008). 2.Gibson DG et al. “Creation of a bacterial cell controlled by a chemically synthesized genome.” Science 329:52-56 (2010). *Processivity measures the number of nucleotides the enzyme can incorporate to a growing DNA strand at one binding event during the extension step. 20 www.thermoscientific.com/pcr 3. Nord et. al. Binding proteins selected from combinatorial libraries of an alpha-helical bacterial receptor domain. Nat. Biotechnol. 15(8):772-7. (1997) 4. Frey BF, Suppmann B. “Demonstration of the Expand PCR System’s greater fidelity and higher yields with a lacI-based fidelity assay.”Biochemica 2: 34-35 (1995). www.thermoscientific.com/pcr 21 Description KIT E www.thermoscientific.com/phusion Ordering Information Phusion High-Fidelity DNA Polymerase F-530S F-530L 100 U (2 U/µl) 500 U (2 U/µl) Phusion High-Fidelity PCR Kit F-553S 50 x 50 µl rxns F-553L 200 x 50 µl rxns Phusion High-Fidelity PCR Master Mix with HF Buffer F-531S 100 x 50 µl rxns F-531L 500 x 50 µl rxns Thermo Scientific Phusion DNA Polymerases set a gold standard for PCR performance. They offer a combination of characteristics that no other enzyme can match. Featuring an error rate 50-fold lower than that of Taq, and 6-fold lower than that of Pfu, it is the most accurate thermostable polymerase available. This feature makes Phusion DNA Polymerase a superior choice for cloning and other applications requiring high fidelity. The unique structure of the enzyme enables short protocol times, abundant yields and robust performance, even in the presence of PCR inhibitors. For the researcher, that translates to ease-of-use and convenience. In addition, Phusion DNA Polymerases also produce higher yields with lower enzyme amounts than other DNA polymerases. Phusion High-Fidelity PCR Master Mixes are convenient 2x mixes designed to minimize the number of pipetting steps. Only template and primers need to be added by the user. Phusion High-Fidelity PCR Kit contains all the necessary reagents for PCR including control template and primers. Benefits • • • • Extreme fidelity (error rate 4.4 x 10-7 in Phusion HF Buffer) Polymerase speed allows short extension times (15-30 s/kb) Robust performance, minimal optimization needed Increased product yields with minimal enzyme amounts Benefits • • • • Applications Reaction set up can be done at room temperature Reduces non-specific amplification Prevents primer degradation during set up Zero-time reactivation due to unique hot start technology Extreme fidelity (52x Taq) Speed of the polymerase allows short extension times Robust reactions, minimal optimization needed Increased product yields with minimal enzyme amounts • • • • Applications • • • • • Thermo Scientific Phusion Hot Start II High-Fidelity DNA Polymerase is the most accurate hot start DNA polymerase on the market. It combines the Phusion DNA Polymerase and a reversibly bound, specific Affibody ligand. Affibody inhibits the DNA polymerase activity at ambient temperatures and thus prevents the amplification of nonspecific products. The Affibody ligand also inhibits the 3´→5´ exonuclease activity of the polymerase, preventing degradation of primers and template DNA during reaction set up. At polymerization temperatures, the ligand is released, rendering the polymerase fully active. Phusion Hot Start II DNA Polymerase does not require a separate activation step in the PCR protocol as it is immediately reactivated at high temperatures. • • • High-fidelity PCR High throughput See more applications on p. 12-13 Product contents Phusion Hot Start II High-Fidelity DNA Polymerase, 5x Phusion HF Buffer, 5x Phusion GC Buffer, DMSO and 50 mM MgCl2 solution. Both Phusion HF Buffer and Phusion GC Buffer provide 1.5 mM MgCl2 in the final 1x concentration. High performance PCR (See p. 6) High-fidelity PCR Cloning Sequencing (template generation) See more applications on p. 12-13 500 x 50 µl rxns Store at -20°C except DMSO. Store DMSO at room temperature. Phusion High-Fidelity PCR Master Mixes (F-531 and F-532): Phusion DNA Polymerase, 400 μM of each dNTP and either 2x Phusion HF Buffer (F-531) or 2x Phusion GC Buffer (F-532). The master mixes provide 1.5 mM MgCl2 and 200 μM dNTP in final reaction concentration. A separate tube of DMSO is provided with the products. Molecular Weight Markers See p. 72-73 dNTP Mixes See p. 74 Description Thermo Scientific Phusion Flash High-Fidelity PCR Master Mix is a 2x master mix enabling the use of extremely short PCR protocols without compromising either the fidelity or the yield in the reaction. The master mix utilizes Phusion Flash II DNA Polymerase, a proofreading DNA polymerase modified from Phusion Hot Start II High-Fidelity DNA Polymerase. • • 0s 3m in 5 0s 7m in 4 0s • 40 • Phusion Hot Start II High-Fidelity DNA Polymerase See p. 23 Less enzyme - superior yield A 3.8 kb fragment from the human beta globin gene was amplified with three different DNA polymerases. Phusion DNA Polymerase was able to amplify the 3.8 kb genomic fragment with a combined annealing and extension step of only 1 minute, thus being significantly faster than the two other polymerases tested. A single unit of Phusion DNA Polymerase produced higher yields than 2.5 or 5 units of the Pfu DNA polymerases. 2.Gilje B et al. “High-fidelity DNA polymerase enhances the sensitivity of a peptide nucleic acid clamp PCR assay for K-ras mutations.” J Mol Diagn 10(4): 325-331 (2008). 3.Wang Y et al. “A novel strategy to engineer DNA polymerases for enhanced processivity and improved performance in vitro.” Nucleic Acids Research 32(3):1197-1207 (2004). 0 Pfu-based fusion polymerase 1.Zhu JY et al. “Identification of novel Epstein-Barr virus microRNA genes from nasopharyngeal carcinomas.” J Virol 83 (7): 3333-3341 (2009). Fast Taq polymerase Related products Phusion Flash 10 Product references Fast cycler Phusion Flash High-Fidelity PCR Master Mix Benefits 50 1m in 3 in Phusion DNA Polymerase (1 U) 1m in 3 0s 3m in 5 0s 7m in 4 0s 1m 1m in in 3 0s 3m in 5 0s 7m in 4 0s 1m 1m in modified Pfu (2.5 U) Shorter PCR run times with Phusion Flash 20 dNTP Mixes See p. 74 Store at -20°C except DMSO. Store DMSO at room temperature. PCR Buffers See p. 71 Phusion High-Fidelity DNA Polymerase (F-530): Phusion DNA Polymerase 2 U/µl, 5x Phusion HF Buffer, 5x Phusion GC Buffer, DMSO and 50 mM MgCl2 solution. Both Phusion HF Buffer and Phusion GC Buffer provide 1.5 mM MgCl2 in the final 1x concentration. 30 PCR Buffers See p. 71 500 units (2 U/µl) Phusion RT-PCR Kit See p. 66 Product contents Pfu (5 U) Phusion RT-PCR Kit See p. 66 100 units (2 U/µl) F-549L Phusion Site-Directed Mutagenesis Kit See p. 32 min 60 Phusion Site-Directed Mutagenesis Kit See p. 32 F-549S Maxima Hot Start Taq DNA Polymerase See p. 26 Phusion High-Fidelity PCR Kit (F-553): Phusion DNA Polymerase 2 U/µl , 5x Phusion GC and HF Buffers, 1.3 kb and 10 kb primers (4 µM each), control template (λ DNA), dNTP mix (10 mM each), MgCl2 solution (50 mM), DNA size standard, DMSO. Phusion Flash High-Fidelity PCR Master Mix See p. 23 Phusion Hot Start II High-Fidelity DNA Polymerase Phire Hot Start II DNA Polymerase See p. 23 Pfu-based fusion polymerase F-532L Ordering Information Phusion High-Fidelity DNA Polymerases See p. 22 Fast Taq polymerase 100 x 50 µl rxns www.thermoscientific.com/phusion Direct PCR kits See p. 16-19 Phusion Flash F-532S E Related products Phusion High-Fidelity PCR Master Mix with GC Buffer Bar Heading Phusion Hot Start II ctrl shift alt 4 DNA High-Fidelity heading Polymerase PCR PCR B Bar Heading Phusion High-Fidelity ctrl shift alt 4 DNA Polymerases heading NEW Description Extreme speed: extension times of 15 s/kb or less Hot start modification allowing “zero-time reactivation” Accuracy: proofreading DNA polymerase with a fidelity of 25x Taq High yields in reduced time Applications • • • Fast PCR High-fidelity PCR See more applications on p. 12-13 www.thermoscientific.com/phusion Ordering Information Phusion Flash High-Fidelity PCR Master Mix F-548S 100 x 20 µl rxns F-548L 500 x 20 µl rxns Store at -20°C. Conventional cycler Phusion Flash allows extremely short PCR run times A 1.5 kb human cathepsin K gene was amplified with three different polymerases following manufacturer’s recommendations and either a fast (Piko Thermal Cycler) or a conventional (DNA Engine Tetrad ® from Bio-Rad) thermal cycler. Product contents Phusion Flash High-Fidelity PCR Master Mix contains Phusion Flash II DNA Polymerase, dNTPs and MgCl2 in an optimized buffer. Related products Phusion Hot Start II High-Fidelity DNA Polymerase See above Phusion RT-PCR Kit See p. 66 Molecular Weight Markers See p. 72-73 22 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 23 Description Thermo Scientific Phire Hot Start II DNA Polymerase is a novel PCR enzyme for routine and high throughput PCR applications. It incorporates a dsDNA binding domain which allows shorter extension times, improved yields, and 2-fold increased fidelity compared to Taq polymerases. Hot start modifications based on Affibody technology allows complete reactivation of the polymerase in “zero-time” at standard cycling temperatures. Benefits • • • • • Enhanced processivity Innovative design for improved performance Phire Hot Start II DNA Polymerase is constructed by fusing a novel DNA polymerase (orange) and a small dsDNAbinding protein (yellow). This technology dramatically increases the processivity of the polymerase, thus improving its overall performance. Thermo Scientific Phire Hot Start II DNA Polymerase outperforms every Taq-based hot start polymerase on the market. This polymerase is significantly faster, extremely robust, and also capable of amplifying long DNA fragments with high yields. These features are achieved through advanced protein engineering of the polymerase. Phire Hot Start II DNA Polymerase incorporates a unique double-stranded DNA binding domain which allows short extension times (10-15 s/kb), improves yields, and increases fidelity 2-fold compared to Taq DNA polymerase. Bar Heading Phire Hot Start II DNA ctrl shift alt 4 Polymerase heading PCR PCR Phire – Speed and Specificity for Routine PCR E Quick hot start: no reactivation step Fast enzyme: amplify 4 times faster than with hot start Taq Robust: minimal reaction optimization due to high inhibitor tolerance High yields: abundant products due to high efficiency Longer PCR products: amplify significantly longer DNA fragments than with any hot start Taq www.thermoscientific.com/phire Ordering Information Phire Hot Start II DNA Polymerase F-122S200 x 50 µl rxns (or 500 x 20 µl rxns) Applications • • • • • Hot Start PCR Routine PCR Non-high fidelity PCR Fast PCR High throughput PCR F-122L1000 x 50 µl rxns (or 2500 x 20 µl rxns) Store at -20°C except DMSO. Store DMSO at room temperature. Product contents Phire Hot Start II DNA Polymerase is supplied with 5x Phire Reaction Buffer and DMSO. The buffer provides 1.5 mM MgCl2 in the final 1x concentration. Zero-time reactivation The hot start modification of Phire Hot Start II DNA Polymerase is based on the same Affibody inactivation technology utilized by Phusion Hot Start II DNA Polymerase. This technology increases the specificity of the PCR reaction with no additional time required for initial activation of the enzyme. 100 min 29 min Hot start Taq DNA polymerases Antibody-based Chemically modified 1 2 3 4 5 1 2 3 4 5 1 2 3 4 A B C D 107 min 106 min 44 min 97 min Superior yields in significantly shorter time A 1.5 kb fragment from the human cathepsin K gene was amplified with five different hot start DNA polymerases. Phire Hot Start II DNA Polymerase amplified high amounts of specific PCR product in just 29 minutes. In contrast, the PCR protocols for hot start Taq DNA polymerases from four major suppliers (A-D) were substantially longer and resulted in lower product yields. 80 Phire Hot Start II Hot start Taq DNA polymerases Antibody-based Chemically modified Phire Hot Start II 60 5 40 Phire Hot Start II amplifies longer fragments than any other hot start Taq Five genomic DNA fragments of different lengths were amplified with three different hot start DNA polymerases. Phire Hot Start II DNA Polymerase produced all five amplicons with very high yields. The competing hot start Taq DNA polymerases produced significantly lower yields and failed to amplify the 7.5 kb fragment. 24 www.thermoscientific.com/pcr 1 – 0.6 kb fragment of human glutathione peroxidase 3 gene 2 – 1.0 kb fragment of human glutathione peroxidase 3 gene 3 – 1.5 kb fragment of human cathepsin K gene 4 – 2.7 kb fragment of human ß-2-microglobulin gene 5 – 7.5 kb fragment of human ß-globin gene Supplier D Supplier C Supplier B Supplier A 0 Phire HS II 20 Complete PCR protocols in less than half the time A 600 bp fragment from human genomic DNA was amplified with five different hot start DNA polymerases. With Phire Hot Start II DNA Polymerase, the PCR protocol was completed up to four times faster than with Taq DNA polymerases utilizing chemically modified or antibody-based hot start technologies (suppliers A-D). Product references 1.Almeida T et al. “Differential expression of new splice variants of the neurotensin receptor 1 gene in human prostate cancer cell lines.” Peptides 31: 242-247 (2010). 2.Pinto FL, Lindblad P. “A guide for in-house design of template-switch-based 5’ rapid amplification of cDNA ends systems.” Analytical Biochemistry 397:227232 (2010). 3.He J. et al. “Rapid multiplex reverse transcription-PCR typing of influenza A and B virus, and subtyping of influenza A virus into H1, 2, 3, 5, 7, 9, N1 (human), N1 (animal), N2, and N7, including typing of novel swine origin influenza A (H1N1) virus, during the 2009 outbreak in Milwaukee, Wisconsin.” J. Clin. Microbiol. 47:2772-2778 (2009). KIT Kit Added color Related products Phusion Hot Start II High-Fidelity DNA Polymerase See p. 23 Maxima Reverse Transcriptase See p. 58 PCR Buffers See p. 71 Molecular Weight Markers See p. 72-73 dNTP Mixes See p. 74 www.thermoscientific.com/pcr 25 Description E Description Thermo Scientific Maxima Hot Start Taq DNA Polymerase is a chemically modified recombinant Taq DNA polymerase. The enzyme is inactive at room temperature, avoiding extension of non-specifically annealed primers or primer dimers and providing higher specificity of DNA amplification. The functional activity of the enzyme is restored during a short 4-minute incubation at 95°C. The activated enzyme maintains the same functionality as Taq DNA polymerase. Maxima Hot Start Taq DNA Polymerase is also available in a master mix format. Thermo Scientific Maxima Hot Start Green PCR Master Mix (2x) is a ready-to-use solution containing Maxima Hot Start Taq DNA Polymerase, optimized hot start PCR buffer, Mg2+, and dNTPs. The master mix is supplemented with two tracking dyes and a density reagent that allows for direct loading of PCR products on a gel. The dyes in the master mix do not interfere with PCR performance and are compatible with downstream applications such as DNA sequencing, ligation, and restriction digestion. The master mix retains all features of Maxima Hot Start Taq DNA Polymerase. It is capable of amplification of PCR products up to 3 kb from genomic DNA. Bar Heading Maxima Hot Start Green ctrl shift alt 4 PCR Master Mix heading PCR PCR B Bar Heading Maxima Hot Start Taq ctrl shift alt 4 DNA Polymerase heading Benefits www.thermoscientific.com/pcrsolutions Ordering Information Maxima Hot Start Taq DNA Polymerase EP0601 100 U (5 U/µl) EP0602 500 U (5 U/µl) EP0603 5 x 500 U (5 U/µl) Maxima Hot Start PCR Master Mix (2x) K1051 100 x 50 µl rxns K1052 500 x 50 µl rxns Store at -20°C. • • • Benefits Four minute activation time High PCR specificity and sensitivity Room temperature PCR set up • • • • • Applications • • • • • Hot Start PCR Routine PCR High throughput PCR Multiplex PCR Genotyping Applications • • • • • Product contents Maxima Hot Start Taq DNA Polymerase is supplied with 10x Hot Start PCR Buffer (200 mM Tris-HCl (pH 8.3 at 25°C), 200 mM KCl, 50 mM (NH4)2SO4), and 25 mM MgCl2 solution. Maxima Hot Start PCR Master Mix (2x) contains Maxima Hot Start Taq DNA polymerase, 2x Hot Start PCR buffer, 0.4 mM of each dNTP and 4 mM Mg2+. Supplied with nuclease-free water. M Maxima Hot Start Taq DNA Polymerase M www.thermoscientific.com/pcrsolutions Convenient – Maxima Hot Start Taq DNA Polymerase in a ready-to-use mix Hot start PCR – reaction set up at room temperature Four minute activation time Direct loading of PCR product on gels High specificity and sensitivity of PCR Supplier A M Supplier B M Hot Start PCR Routine PCR High throughput PCR Multiplex PCR Genotyping Ordering Information Maxima Hot Start Green PCR Master Mix (2x) K1061 100 x 50 µl rxns K1062 500 x 50 µl rxns Store at -20°C. Product contents Maxima Hot Start Green PCR Master Mix (2x) contains Maxima Hot Start Taq DNA polymerase, 2x hot start PCR buffer, 0.4 mM of each dNTP, 4 mM Mg2+, density reagent and two dyes for direct loading on agarose gels. Supplied with nuclease-free water. Specific amplification with Maxima Hot Start Taq DNA Polymerase 50 ng of human genomic DNA was amplified using hot start Taq DNA polymerases from different suppliers. M – GeneRuler 100 bp Plus DNA Ladder. Maxima Hot Start Green PCR Master Mix contains tracking dyes and a density reagent that allows for direct loading of PCR products on a gel A – unseparated in a well. B – blue and yellow dyes separated after gel electrophoresis. A B Related products Phusion Hot Start II High-Fidelity DNA Polymerase See p. 23 Related products Phire Hot Start II DNA Polymerase See p. 25 Maxima Reverse Transcriptase See p. 58 Maxima Reverse Transcriptase See p. 58 Phusion Hot Start II High-Fidelity DNA Polymerase See p. 23 Molecular Weight Markers See p. 72-73 Phire Hot Start II DNA Polymerase See p. 25 dNTP Mixes See p. 74 26 www.thermoscientific.com/pcr Molecular Weight Markers See p. 72-73 E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 27 Description E www.thermoscientific.com/pcrsolutions Ordering Information DreamTaq DNA Polymerase EP0701 200 U (5 U/µl) EP0702 500 U (5 U/µl) EP0703 5 x 500 U (5 U/µl) EP0704 20 x 500 U (5 U/µl) DreamTaq PCR Master Mix (2x) K1071 200 x 50 µl rxns K1072 1000 x 50 µl rxns Description Thermo Scientific DreamTaq DNA Polymerase is an enhanced Taq DNA polymerase optimized for all standard PCR applications. It ensures higher sensitivity, longer PCR products and higher yields compared to conventional Taq DNA polymerase. DreamTaq DNA Polymerase uses the same reaction set up and cycling conditions as conventional Taq DNA polymerase. It is supplied with optimized DreamTaq buffer, which includes 20 mM MgCl2. Thermo Scientific DreamTaq Green DNA Polymerase is a combination of DreamTaq DNA Polymerase and 10x DreamTaq Green Buffer. DreamTaq DNA Polymerase is an enhanced Taq polymerase optimized for high throughput PCR applications. It ensures higher sensitivity, longer PCR products and higher yields compared to conventional Taq DNA polymerase. DreamTaq generates PCR products with 3’-dA overhangs and does not incorporate dUTP. DreamTaq PCR Master Mix (2x) is a ready-to-use solution containing DreamTaq DNA Polymerase, optimized DreamTaq buffer, MgCl2 and dNTPs. This pre-mixed formulation saves time, and reduces contamination due to the fewer pipetting steps required for PCR set up. The master mix retains all features of DreamTaq DNA Polymerase. It is capable of robust amplification of up to 6 kb from genomic DNA and up to 20 kb from viral DNA. The 10x DreamTaq Green Buffer includes a density reagent and two tracking dyes for direct loading of PCR products on a gel. The colored buffer does not interfere with PCR performance and is compatible with downstream applications such as fluorescent DNA sequencing, ligation, and restriction digestion. For applications that require PCR product analysis by absorbance or fluorescence excitation, we recommend using the colorless 10x DreamTaq Buffer (#B65) or purifying the PCR product prior to analysis. Benefits • • • • • DreamTaq Green PCR Master Mix (2x) is a ready-to-use solution containing DreamTaq DNA Polymerase, optimized DreamTaq Green buffer, MgCl2, and dNTPs. The master mix retains all features of DreamTaq DNA Polymerase. It is capable of robust amplification of up to 6 kb from genomic DNA and up to 20 kb from viral DNA. Robust amplification with minimal optimization High yields of PCR products Higher sensitivity compared to conventional Taq DNA polymerase Amplification of long targets up to 6 kb from genomic DNA and up to 20 kb from viral DNA Incorporates modified nucleotides, but does not incorporate dUTP Benefits • • • • Applications • • • Routine PCR High throughput PCR Genotyping Direct loading of PCR product on gel High yields and high sensitivity of PCR Amplification of long targets up to 6 kb from genomic DNA and up to 20 kb from viral DNA Robust amplification of difficult templates Product contents DreamTaq DNA Polymerase is supplied with 10x DreamTaq Buffer (includes 20 mM MgCl2). DreamTaq PCR Master Mix (2x) contains: DreamTaq DNA Polymerase, 2x DreamTaq buffer, dNTPs and 4 mM MgCl2. Supplied with nuclease-free water. • • • E www.thermoscientific.com/pcrsolutions Ordering Information DreamTaq Green DNA Polymerase EP0711 200 U (5 U/µl) EP0712 500 U (5 U/µl) EP0713 5 x 500 U (5 U/µl) EP0714 20 x 500 U (5 U/µl) DreamTaq Green PCR Master Mix (2x) Applications Store at -20°C. Bar Heading DreamTaq Green DNA ctrl shift alt 4 Polymerase heading PCR PCR B Bar Heading DreamTaq DNA ctrl shift alt 4 Polymerase heading Routine PCR amplification Genotyping High throughput PCR K1081 200 x 50 µl rxns K1082 1000 x 50 µl rxns Store at -20°C. Product contents 1000 pg DNA (300 molecules) DreamTaq Green DNA Polymerase is supplied with 10x DreamTaq Green Buffer (includes 20 mM MgCl2). DreamTaq Green PCR Master Mix (2x) contains DreamTaq DNA Polymerase, 2x DreamTaq Green buffer, dNTPs and 4 mM MgCl2. Supplied with nuclease-free water. 300 pg DNA (100 molecules) 30 pg DNA (10 molecules) DreamTaq Green DNA Polymerase M D T 1 2 3 D T 1 2 3 D T 1 2 3 Supplier A Supplier B Supplier C Supplier D Supplier E M Comparison of PCR sensitivity and yield with DreamTaq DNA Polymerase and other commercial Taq DNA polymerases A 545 bp fragment from the human α-L-Fucosidase gene was amplified according to manufacturers’ recommendations using decreasing amounts of human genomic DNA. M 1 2 3 4 M 1 2 3 4 M 1 2 3 4 M 1 2 3 4 M 1 2 3 4 M 1 2 3 4 M Longer PCR fragments and higher yields with DreamTaq Green DNA Polymerase Amplification of different DNA targets using different enzymes that offer direct loading of PCR mixture on gels. PCR was performed according to supplier recommendations in a 50 µl reaction volume. 10 µl of each PCR mixture was loaded on the gel. M – FastRuler Low Range DNA Ladder, ready-to-use D – DreamTaq DNA Polymerase T – Taq DNA Polymerase 1-3 – Taq DNA polymerases from different suppliers M – GeneRuler Express DNA Ladder 1 – 424 bp lcs gene fragment from mouse genomic DNA 2 – 956 bp 7 chromosome STS (G31656) from human genomic DNA 3 – 2537 bp tPA gene fragment from human genomic DNA 4 – 5003 bp beta-globin gene fragment from human genomic DNA Related products 28 DreamTaq Green DNA Polymerases See p. 29 Related products Maxima Reverse Transcriptase See p. 58 Maxima Reverse Transcriptase See p. 58 PCR Buffers See p. 71 PCR Buffers See p. 71 Molecular Weight Markers See p. 72-73 Molecular Weight Markers See p. 72-73 dNTP Mixes See p. 74 dNTP Mixes See p. 74 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 29 Description E www.thermoscientific.com/pcrsolutions Ordering Information Taq DNA Polymerase (recombinant) EP0401 100 U (5 U/µl) EP0402 500 U (5 U/µl) EP0405 5 x 500 U (5 U/µl) EP0406 10 x 500 U (5 U/µl) Taq DNA Polymerase (native) EP0281 200 U (5 U/µl) EP0282 500 U (5 U/µl) Taq DNA Polymerase (native, with BSA) EP0071 200 U (5 U/µl) EP0072 500 U (5 U/µl) PCR Master Mix (2x) K0171 200 x 50 µl rxns K0172 1000 x 50 µl rxns Store at -20°C. Description Thermo Scientific Taq DNA Polymerase is a highly thermostable DNA polymerase from the thermophilic bacterium Thermus aquaticus. The enzyme catalyzes 5’→3’ synthesis of DNA, has no detectable 3’→5’ exonuclease (proofreading) activity and possesses low 5’→3’ exonuclease activity. In addition, Taq DNA Polymerase exhibits deoxynucleotidyl transferase activity, which frequently results in the addition of extra adenines at the 3’-end of PCR products. Recombinant Taq DNA Polymerase is the ideal tool for standard PCR of templates 5 kb or shorter. Native Taq DNA Polymerase is preferred for amplification of bacterial DNA sequences homologous to those found in E. coli. Taq DNA Polymerase (native, with BSA) is supplied with BSA as a stabilizing agent. This version of Taq DNA Polymerase is often the best choice when amplifying DNA samples of lower purity. PCR Master Mix is a 2x concentrated solution of Taq DNA Polymerase, dNTPs, and all of the components required for PCR, except DNA template and primers. This pre-mixed formulation saves time and reduces contamination due to a reduced number of pipetting steps required for PCR set up. The mix is optimized for efficient and reproducible PCR. • Thermostable – half life is more than 40 min at 95°C Generates PCR products with 3’-dA overhangs Supplied with two buffers – 10x Taq Buffer with KCl and 10x Taq Buffer with (NH4)2SO4; the latter allows for PCR with a wide range of magnesium concentrations (see figure below) and decreases non-specific priming. Incorporates modified nucleotides (e.g., biotin-, digoxigenin-, fluorescently-labeled nucleotides). Applications • • • • Long PCR products: – Up to 47 kb with viral DNA as template – Up to 21 kb with genomic DNA as template Ideal for GC-rich templates up to 85% Three times higher fidelity compared to Taq DNA Polymerase High yield E Ordering Information Long PCR Enzyme Mix K0181 100 U (5 U/µl) K0182 500 U (5 U/µl) Store all components at -20°C, except DMSO. Store DMSO at room temperature. *Not available in US. Applications • • Bar Heading Long PCR ctrl shift alt 4 Enzyme Mix* heading www.thermoscientific.com/pcrsolutions Benefits • • • Benefits • • • Thermo Scientific Long PCR Enzyme Mix is a unique blend of Taq DNA Polymerase and a thermostable high fidelity DNA polymerase with proofreading activity. The two enzymes synergistically generate long PCR products with greater yield and fidelity than Taq DNA Polymerase alone. The fidelity of PCR with this enzyme mix is three times higher than with Taq DNA Polymerase. The ratio of enzymes in the Long PCR Enzyme Mix is optimized for generation of very long amplicons: up to 47 kb with viral DNA and up to 21 kb with genomic DNA templates. The specially formulated Long PCR Buffer protects DNA from depurination and nicking during long thermal cycling. The products generated with the Long PCR Enzyme Mix are mostly 3’-dA tailed. Long PCR Enzyme Mix is also used for efficient amplification of GC-rich DNA regions. PCR PCR B Bar Heading Taq DNA ctrl shift alt 4 Polymerase heading Long range PCR PCR from GC-rich or difficult templates Product contents Routine PCR amplification of DNA fragments up to 5 kb DNA labeling High throughput PCR Long PCR Enzyme Mix is supplied with 10x Long PCR Buffer with 15 mM MgCl2, 10x Long PCR Buffer, 25 mM MgCl2 solution and dimethylsulfoxide (DMSO). Supplied with nuclease-free water. Product contents 40 kb 35 kb 30 kb Taq DNA Polymerases (recombinant and native) are supplied with 10x Taq Buffer with KCl, 10x Taq Buffer with (NH4)2SO4, and 25 mM MgCl2 solution. Taq DNA Polymerase (native with BSA) is also supplied with 20 mg/ml BSA solution. 25 kb 20 kb 4 5 PCR Master Mix (2x) contains Taq DNA polymerase (0.05 U/μl), reaction buffer, 4 mM MgCl2, 0.4 mM of each dNTP. Supplied with nuclease-free water. 1 mM M 2 mM 1.5 mM 3 mM 2.5 mM 4 mM 3.5 mM M PCR using Taq DNA Polymerase in 10x Taq Buffer with (NH4)2SO4 and different MgCl2 concentrations A 56 bp single copy gene from human genomic DNA was amplified at a wide range of Mg2+ concentrations. M M – GeneRuler 100 bp Plus DNA Ladder 1 2 3 M Amplification of long DNA fragments DNA fragments were amplified from 1.25 ng of lambda DNA in 50 µl of reaction mixture containing 2.5 U of Long PCR Enzyme Mix. M – Lambda Mix Marker 1-5 – PCR products 1 2 3 Successful amplification of a GC-rich template with the Long PCR Enzyme Mix Human IGFR II gene (85% GC content) was amplified using the Long PCR Enzyme Mix and two other commercial PCR systems for GC-rich templates. PCR mixtures (50 µl) contained 100 ng of human genomic DNA, 200 µM of each dNTP and 0.5 µM of each primer. Cycling conditions: 94°C, 2 min; 96°C, 10 s; 68°C, 1 min 30 s; 35 cycles; 72°C, 7 min. M – GeneRuler 100 bp Plus DNA Ladder 1 – Long PCR Enzyme Mix supplemented with 12% DMSO 2-3 – PCR systems for GC-rich templates from other vendors Related products DreamTaq DNA Polymerases See p. 28 DreamTaq Green DNA Polymerases See p. 29 PCR Buffers See p. 71 30 M Related products PCR Buffers See p. 71 Molecular Weight Markers See p. 72-73 Molecular Weight Markers See p. 72-73 dNTP Mixes See p. 74 dNTP Mixes See p. 74 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 31 Description KIT www.thermoscientific.com/phusion Ordering Information Phusion Site-Directed Mutagenesis Kit F-54120 rxns including 10 control rxns Store at -20°C. Description Thermo Scientific Phusion Site-Directed Mutagenesis Kit is a versatile and efficient tool for introducing point mutations, insertions or deletions in any type of plasmid DNA. With this kit, the entire plasmid is amplified using phosphorylated primers that introduce the desired changes. The amplified linear PCR product, containing the desired mutation, is circularized in a 5-minute ligation reaction with Quick T4 DNA Ligase. The resulting plasmid then can be transformed into competent E. coli cells. Thermo Scientific DyNAzyme I DNA Polymerase is a native thermostable DNA polymerase from Thermus brockianus. Store at -20°C. Ordering Information DyNAzyme I DNA Polymerase Kit F-550L 500 rxns Bar Heading DyNAzyme I ctrl shift alt 4 DNA Polymerase heading PCR PCR Phusion B Bar Heading ctrl shift alt 4 Site-Directed heading Mutagenesis Kit Benefits • • • • • • • • Robust and reliable exponential amplification method No requirements such as special vectors, restriction sites or methylation status for the target plasmid No need to destroy the starting template in a separate step High fidelity minimizes Phusion Hot Start II DNA Polymerase, unwanted secondary mutations Amplification of large plasmids up to 10 kb Hot start modification of the polymerase prevents amplification of non-specific products and unwanted degradation of primers prior to first cycle of PCR Quick T4 DNA Ligase included in the kit; no purification steps before or after ligation Compatible with all strains of competent E. coli cells Description Thermo Scientific DyNAzyme II DNA Polymerase is a recombinant enzyme originating from Thermus brockianus. It has improved thermal stability, enhanced DMSO tolerance and is ideal for all routine PCR applications. Applications • Generating point mutations, insertions and deletions in plasmid DNA Store at -20°C. Ordering Information DyNAzyme II DNA Polymerase F-501S 250 U (2 U/µl) F-501L 1000 U (2 U/µl) DyNAzyme II DNA Polymerase with Mg2+-free DyNAzyme Buffer and MgCl2 Solution F-503L Product contents Bar Heading DyNAzyme II ctrl shift alt 4 DNA Polymerase heading 1000 U (2 U/µl) The Phusion Site-Directed Mutagenesis Kit includes Phusion Hot Start II DNA Polymerase, 5x Phusion HF Buffer, dNTP mix, Quick T4 DNA Ligase (NEB), 2x Quick Ligation Buffer (NEB), and a Control Plasmid with Control Primer Mix. 5'P Target plasmid 5'P I ns M 5'P u t X F F 5'P Target plasmid R 5'P F 5'P R Target plasmid Insertion option 2 5'P D el 5'P F 5'P Ins F 5'P In s 5'P Target plasmid R 5'P F 5'P R D el 5'P R R Mu t X F Insertion option 1 R 5'P Deletion R Point mutation Ins F 5'P Description Thermo Scientific DyNAzyme EXT DNA Polymerase is an optimized mixture of DyNAzyme II DNA Polymerase and a proofreading enzyme, capable of amplifying templates up to 40 kb in long PCR reactions. Store at -20°C. 5'P X X Linear amplified target 5'P plasmid with desired mutation 5'P X X 5'P Ordering Information DyNAzyme EXT DNA Polymerase F-505S 200 U (1 U/µl) F-505L 1000 U (1 U/µl) Bar Heading DyNAzyme EXT ctrl shift alt 4 DNA Polymerase heading Step 1. Amplification of target plasmid with two phosphorylated primers. XX XX Mutated target plasmid Step 2. Plasmid circularization by ligation. Related products Step 3. Transformation into E. coli. Phusion High-Fidelity DNA Polymerases See p. 22 Product reference 1.Catic et al. “Sequence and structure evolved separately in a ribosomal ubiquitin variant.” EMBO J. 26, 34743483 (2007). 32 www.thermoscientific.com/pcr The Phusion Site-Directed Mutagenesis protocol www.thermoscientific.com/pcr 33 Description B Bar Heading ThermoPrime Taq ctrl shift alt 4 DNA Polymerase heading Thermo Scientific ThermoPrime Taq DNA Polymerase is a 94 kDa ultra-pure recombinant thermostable DNA polymerase obtained by high level expression of the Taq DNA polymerase gene in E. coli. ThermoPrime Taq DNA Polymerase AB-0301/A 400 x 25 µl rxns AB-0301/B 4000 x 25 µl rxns ThermoPrime Taq DNA Polymerase with MgCl2 pre-mixed into PCR Buffer AB-1301/B 4000 x 25 µl rxns ThermoPrime Master Mix, 1.1x concentration AB-0575/B 1600 x 25 µl rxns Description Thermo Scientific Red Hot Taq DNA Polymerase is the original “red” thermostable Taq DNA polymerase. It consists of ThermoPrime Taq DNA Polymerase with an inert red dye to facilitate accurate low volume pipetting and as an indicator of enzyme addition. This dye has no adverse effect on the outcome of PCR; yields are the same as with standard ThermoPrime Taq DNA Polymerase. Ordering Information Red Hot Taq DNA Polymerase AB-0406/B 800 x 25 µl rxns Bar Heading Red Hot Taq DNA ctrl shift alt 4 Polymerase heading PCR PCR Store at -20°C. Ordering Information Store at -20°C. ThermoPrime Master Mix, 2x concentration AB-0575/DC/B 1600 x 25 µl rxns Description Description ThermoPrime Taq DNA Polymerase in ReddyMix format Thermo Scientific ThermoPrime Taq DNA Polymerase with 10x ReddyMix PCR Buffer. This unique buffer has an inert red dye and a density reagent added. After thermal cycling, a sample of the PCR mix may be removed and loaded directly onto an agarose gel without the addition of loading dye. ReddyMix has no adverse effect on the outcome of PCR; yields are the same as with standard ThermoPrime Taq DNA Polymerase. Store at -20°C. Ordering Information ThermoPrime Taq DNA Polymerase with ReddyMix Buffer AB-0790/B 4000 x 25 µl rxns ThermoPrime Taq DNA Polymerase with MgCl2 Pre-mixed into ReddyMix Buffer AB-0785/A 400 x 25 µl rxns AB-0785/B 4000 x 25 µl rxns Thermo Scientific Extensor Long Range Enzyme Blend is a mix of ThermoPrime Taq DNA Polymerase and a proprietary thermostable proofreading enzyme. The two enzymes act synergistically to generate long PCR products, up to 20 kb. Extensor Long Range Enzyme Blend is available with 2 buffer formulations; Buffer 1 for templates up to 12 kb in length, and Buffer 2 for templates 12 - 20 kb and GC-rich or other difficult templates. The ReddyMix Master Mix contains an inert red dye and a density reagent that allows for direct loading onto agarose gels. Store at -20°C. Ordering Information Extensor Long Range Enzyme Blend AB-0720/B 400 x 25 µl rxns Extensor Long Range Enzyme Blend Extensor Long Range Enzyme Blend Master Mix with Buffer 1 Formulation (2x) AB-0792/A 80 x 25 µl rxns AB-0792/B 400 x 25 µl rxns Extensor Long Range Enzyme Blend ReddyMix Master Mix with Buffer 1 Formulation (2x) AB-0794/A 80 x 25 µl rxns AB-0794/B 400 x 25 µl rxns ReddyMix Master Mix, 1.1x concentration AB-0575/LD/A 160 x 25 µl rxns AB-0575/LD/B 1600 x 25 µl rxns ReddyMix Master Mix, 2x concentration AB-0575/DC/LD/A 160 x 25 µl rxns AB-0575/DC/LD/B 1600 x 25 µl rxns Description The Thermo Scientific High Fidelity PCR Enzyme Mix is a blend of Taq DNA Polymerase and a thermostable DNA polymerase with proofreading activity. The enzyme also incorporates modified nucleotides and generates both blunt-ended and 3’-dA tailed PCR products. Ordering Information High Fidelity Enzyme Mix K0191 100 U (5 U/µl) K0192 500 U (5 U/µl) High Fidelity Enzyme Mix Store at -20°C. Description Thermo-Start Taq DNA Polymerase Thermo Scientific Thermo-Start Taq DNA Polymerase is a chemically modified version of ThermoPrime Taq DNA Polymerase that remains completely inactive during reaction set up to prevent non-specific amplification and primer dimer formation. This enzyme requires an activation step at 95°C for 15 minutes. Store at -20°C. Ordering Information Thermo-Start Taq DNA Polymerase AB-0908/B 4000 x 25 µl rxns Thermo-Start Taq DNA Polymerase with MgCl2 pre-mixed into PCR Buffer AB-1908/B 4000 x 25 µl rxns Thermo-Start Taq DNA Polymerase with High Performance Buffer Formulation: AB-1057/A 400 x 25 µl rxns AB-1057/B 4000 x 25 µl rxns Thermo-Start Taq DNA Polymerase Master Mix, 2x conc. AB-0938/15/DC/B 1600 x 25 µl rxns Description Thermo Scientific Pfu DNA Polymerase is a highly thermostable DNA polymerase from the hyperthermophilic archaeum Pyrococcus furiosus. The enzyme catalyzes the template-dependent polymerization of nucleotides into duplex DNA in the 5’→3’ direction. Pfu DNA Polymerase also exhibits 3’→5’ exonuclease proofreading activity that enables the polymerase to correct nucleotide incorporation errors. It has no 5’→3’ exonuclease activity. Store at -20°C. Ordering Information Pfu DNA Polymerase (native) EP0571 100 U (2.5 U/µl) EP0572 500 U (2.5 U/µl) Pfu DNA Polymerase* Pfu DNA Polymerase (recombinant) EP0501 100 U (2.5 U/µl) EP0502 500 U (2.5 U/µl) * Not available in US. 34 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 35 Adding Some Color to the World of qPCR The Road to Quantification With the discovery that PCR could detect as few as 1 or 2 DNA molecules in a sample, came the realization that determining the absolute number of templates could be just as important. In addition, with the dynamic range limitations of microarray technology also becoming apparent, a method was needed to apply real numbers to PCR. Quantification could provide information on disease progression, viral load or transcript abundance. Initial attempts at quantification by PCR centered on experiments in which amplification of a native template was compared against amplification of a similar target spiked into the sample. However, the mathematical and practical drawbacks of this “competitive PCR” meant that within a few years, papers using this technique were no longer accepted for publication. Conventional PCR generally proceeds to an endpoint at which premature termination products and disappearance of substrates leads to a gradual cessation of target amplification. Routinely, PCR products are analyzed by agarose gel electrophoresis utilizing DNA binding dyes such as ethidium bromide (EtBr), but it is difficult to assess initial target concentration based on this approach. The difficulty arises because similar endpoint concentrations can emerge from a wide range of initial target concentrations, with appreciable differences in amplicon concentration being seen only at very low target molecule numbers. The Key to a Kinetic approach During their research at the Cetus Corporation, Russell Higuchi, Gavin Dollinger, Bob Griffith, and others noticed that PCR could generate high molecular weight DNA and that this could become complexed with small quantities of EtBr during the amplification reaction. Running PCR reactions which had EtBr in the tube from cycle 1 on a gel gave them a way of monitoring accumulation of DNA at the end of each round of amplification1. However, it quickly became apparent that it was possible to deduce how much target was present if a note was made of the first amplification cycle at which DNA could be detected. 36 www.thermoscientific.com/pcr This “kinetic” approach to PCR2 was a step-change away from endpoint analysis and stimulated research into more sensitive detection methods, rather than reliance on the transilluminator. The first quantitative PCR machines still used EtBr and ultraviolet light, but captured DNA/EtBr fluorescence using a CCD camera. The number of white pixels per tube against a dark background was found to be indirectly proportional to template concentration, but only after a correction had been made for tube to tube variation. By 1993, many of the concepts we now take for granted while doing qPCR were in place. Higuchi and his colleagues were monitoring PCR amplification in relative fluorescent units (RFU) and had deduced that if a standard curve of log target concentration against RFU was plotted, the point at which the amplicon was first detected could not only be used to calculate target DNA concentration, but also to assess how well the PCR reaction was working. The idea of the “efficiency” of a reaction, where 100% represents an ideal PCR in which the amount of amplicon doubles with each cycle, is now crucial to the detailed comparative experiments we do today. The Diversification of Real-Time Although quantification in PCR had become technically feasible, many still held doubts that primer pairs could be selective enough to generate gene-specific amplicons reliably in a closed tube system. While assessing the possibility that glass capillaries could be used to accelerate conventional PCR, Carl Wittwer noted that SYBR Green I could be used as a reliable monitor of DNA melting post-amplification3. The melt curves that were generated not only showed that the correct amplicon was the dominant double stranded species, but also if any non-specific dsDNA was being synthesized. Wittwer and his group went on to use fluorescence resonance energy transfer (FRET) principles to design oligonucleotide probes capable of even more specific detection. With probe and SYBR detection chemistries now available, qPCR began to be recognized in many areas. Adaptation of real-time acquisition of fluorescent data to an end-point-based system so that single nucleotide polymorphisms could be detected without sequencing was a significant step forward in genotyping. The interest in using qPCR to characterize genomes instead of resequencing at first led to the development of massively high throughput PCR machines using tubes of conventional size. ABgene’s water bath thermal cycler, the “H2OBIT”, allowed 10368 PCR reactions to be performed simultaneously in 200 μl tubes and was the size of a domestic chest freezer; these reactions could then be used for fluorescence-based SNP analysis in real-time instruments, but the need for miniaturization was “Using this multicolor system, pipetting of both the master mix and the sample can be easily monitored, significantly decreasing the risk for pipetting errors during reaction set up.” approaches to data analysis began to appear, including the introduction of relative quantification. Pioneered by universities in Germany and Belgium (Pfaffl4 and Vandesompele5 respectively), these approaches reduced error introduced when trying to quantify nucleic acid in absolute numbers. Many qPCR machines can now perform the relative quantification calculations which allow modern researchers to express transcript levels in numbers relative to stably-expressed reference genes rather than in absolute numbers. Added to this, the more recent additions of relative standard curves, and High Resolution Melt (HRM) modules and real-time PCR instruments offer more flexible use than ever before. with clear master mix. While the introduction of color into the reaction mix appeared at first to be a simple extension of the formulation, it hides the development effort needed to find a pigment which inhibits neither PCR nor the fluorescence detection chemistry. Thermo Scientific achieved this with their ABsolute Blue range of master mixes. Further improvement to this concept was achieved with the addition of the Finnzymes product line including fast DyNAmo ColorFlash master mixes. These qPCR products feature an innovative multi-color system to track pipetting. The master mix contains a blue dye, and a separate sample buffer contains a yellow dye. The qPCR reaction mix containing both components is green. Using this patent-pending multicolor system, pipetting of both the master mix and the sample can be easily monitored, significantly decreasing the risk for pipetting errors during reaction set up. The twenty years since the introduction of quantification into the PCR reaction has led to many changes. Once the preserve of well-funded specialist research groups, qPCR is now within reach of individual scientists who can use it as a tool to address a huge variety of problems in medicine and biology. True point-of-care qPCR is beginning to become available to physicians6, and research and development is likely to fuel a rapid expansion of personalized medicine as our understanding of genomes improves with increasing data appearing from nextgeneration sequencing and biomarker studies. Review Polymerase Chain Reaction (PCR) had become the universal workhorse of molecular biology by the mid 1990s, with most life science laboratories having at least one PCR instrument. PCR was also becoming increasingly significant as a diagnostic tool, with the first diagnostic test for human HLA-DQA being released in 1990. becoming apparent. Initially, single PCR tubes were fused together in strips of eight, and this is still a format used in research labs today. However, high throughput biology moved to 96-well qPCR formats, based on the form factor standardized for ELISA microtitre plates. Small arrays of 12 x 8 tubes of 100 - 200 μl maximum volume became what we now refer to as the 96-well plate, and remain a staple of the molecular biology lab. More recently, formats including 24 x 16 (384-well plates, 30 - 50 μl volume), and even 48 x 32 have begun to become more popular. The shape and function of qPCR plates have evolved with the qPCR machine, leading to the diversity displayed by the plates available in this product guide. As the kinetics of the qPCR reaction became better and better understood, the capability of qPCR machines to process and display information improved. Alternative 1Higuchi R, Dollinger G, Walsh PS, Griffith R. “Simultaneous amplification and detection of specific DNA sequences.” Biotechnology 10:413-417 (1992). 2Higuchi R, Fockler C, Dollinger G, Watson R. “Kinetic PCR: Real time monitoring of DNA amplification reactions.” Biotechnology 11:1026-1030 (1993). 3Wittwer CT, Herrmann MG, Moss AA, Rasmussen RP. “Continuous fluorescence monitoring of rapid cycle DNA amplification.” Biotechniques 22:130-1, 134-8 (1997). 4Pfaffl MW. “A new mathematical model for relative quantification in real-time RT– PCR.” Nucleic Acids Res. 29(9): e45 (2001). 5Vandesompele J, De Preter K et al. research0034.1–research0034.11.Genome Biol. 3:7 (2002). 6Bernard SP, Wittwer CT. “Real-Time PCR Technology for Cancer Diagnostics.” Clinical Chemistry 48:1178-1185 (2002). Colorful qPCR Advances in reagent composition have largely gone unremarked, but it is now possible to perform most qPCR reactions in a single type of master mix. ABgene (now part of Thermo Scientific) was the first to introduce master mix for PCR and applied some of the same technology towards producing a master mix which could work for most applications. This work was coupled with an examination of how reagents interacted with disposable plasticware and how different users used these materials. Moving away from caps and towards optically clear adhesive film meant that time spent sealing reactions could be reduced. The introduction of white qPCR plates reduced well-to-well light interference and increased sensitivity. However, while the high throughput sector welcomed the overall reduction in reaction volume enabled by improved detection chemistry and plate construction, researchers who prepared plates manually found that white plates were difficult to use www.thermoscientific.com/pcr 37 Thermo Scientific qPCR Reagents Selection Guide Performing SNP genotyping? RNA as starting material? See DyNAmo SNP Genotyping Master Mix on page 50. See our solutions for reverse transcription (RT), RT-PCR and RT-qPCR on pages 56-70. qPCR Choose your pre-designed Probe-based qPCR assays Gene expression assays for human and mouse genes 38 www.thermoscientific.com/pcr detection chemistry Probe Standard qPCR Master Mixes SYBR Green Fast qPCR Master Mixes Standard qPCR Master Mixes Solaris qPCR Gene Expression Assay gene-specific primers and probes See p. 44 ROX included in master mix ROX in separate vial Multicolor system to track pipetting, ROX in separate vial No color, ROX in separate vial ROX included in master mix ROX in separate vial Solaris qPCR Master Mixes See p. 45 Maxima Probe/ ROX qPCR Master Mix See p. 49 Maxima Probe qPCR Master Mix, ROX Solution provided See p. 49 DyNAmo ColorFlash Probe qPCR Kit See p. 48 DyNAmo Flash Probe qPCR Kit See p. 47 Maxima SYBR Green/ROX qPCR Master Mix See p. 53 Maxima SYBR Green qPCR Master Mix, ROX Solution provided See p. 53 Fast qPCR Master Mixes Fluorescein included in master mix Maxima SYBR Green/Fluorescein qPCR Master Mix See p. 53 Multicolor system to track pipetting, ROX in separate vial No color, ROX in separate vial DyNAmo ColorFlash SYBR Green qPCR Kit See p. 52 DyNAmo Flash SYBR Green qPCR Kit See p. 51 www.thermoscientific.com/pcr 39 qPCR Instrument Compatibility Table for Thermo Scientific qPCR Products This table helps you to choose the most optimal master mix for your instrument. Other options may be suitable as well. Please contact technical support for more information. Thermo Scientific Pre-designed qPCR Assays PikoReal® Real-Time PCR System Solaris Master Mix + ROX vial Life Technologies 7000, 7300, 7700, 7900, 7900HT, StepOne™, StepOne Plus™ Stratagene 7500, ViiA7 ● Bio-Rad Eppendorf Qiagen Cepheid Mx3000P®, Mx3005P®, Mx4000® Opticon®, Opticon 2, Chromo4™, CFX96™, CFX384™, MiniOpticon™ MyiQ™ iQ™5 Mastercycler® ep realplex Rotor-Gene™ 3000, Rotor-Gene 6000, Rotor-Gene Q SmartCycler® ● ● ● ● ● ● ● ● ● Roche Diagnostics LightCycler®, LightCycler 2.0 LightCycler 480 ● ● Solaris Master Mix (ROX mix) Solaris Master Mix (low ROX mix) ● ● ● ● Standard qPCR ● SYBR Green Chemistry Maxima SYBR Green/ROX qPCR Master Mix Maxima SYBR Green qPCR Master Mix, ROX Solution provided ● ● ● ● ● Maxima SYBR Green/Fluorescein qPCR Master Mix Fast qPCR DyNAmo Flash SYBR Green qPCR Kit ● ● ● ● ● ● ● ● ● DyNAmo ColorFlash SYBR Green qPCR Kit ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● Standard qPCR ● Probe Chemistry Maxima Probe/ROX qPCR Master Mix 40 Maxima Probe qPCR Master Mix, ROX Solution provided ● Fast qPCR DyNAmo Flash Probe qPCR Kit ● ● ● ● ● ● ● ● ● ● ● DyNAmo ColorFlash Probe qPCR Kit ● ● ● ● ● ● ● ● ● ● ● DyNAmo SNP Genotyping Master Mix ● ● ● ● ● ● ● ● ● ● ● www.thermoscientific.com/pcr www.thermoscientific.com/pcr 41 Search for Your Gene. Find Your Assay. Simple. we recommend using the following products in your Solaris assays: Solaris qPCR Master Mix all of the components required for reliable, sensitive and specific qPCR detection, optimized for use with the Solaris qPCR Gene Expression Assay See p. 45 What you get • Primer pair and MGB probe specific to your target gene • Sequence information for your gene-specific probe and primers Thermo Scientific Solaris qPCR Gene Expression Assays Thermo Scientific Solaris qPCR Gene Expression Assays are pre-designed, gene-specific probe and primer pairs that utilize minor groove binder (MGB™) and Superbase technologies to deliver repeatable, sensitive and gene-specific quantification. Through the use of advanced software design and probe technologies, we have adopted a novel approach to designing qPCR probe detection assays for human and mouse genes. With this approach, we are able to design each assay to a consensus sequence that covers all known splice variants of the target gene. This strategy allows us to recommend one optimal assay for each gene target, making it easier than ever to incorporate the benefits of qPCR probe detection assays into your workflow. Genomic DNA EXON 1 EXON 2 EXON 4 EXON 3 EXON 6 EXON 5 Splice Variants PRIMER PRIMER 1 EXON 1 EXON 2 2 PRIMER EXON 1 EXON 2 n Site 2 EXON 4 EXON 6 EXON 3 EXON 5 PRIMER Reverse Primer 3 EXON 1 EXON 6 PRIMER EXON 2 EXON 5 EXON 6 Detect all known splice variants of your target gene for comprehensive target analysis Solaris qPCR Assays are designed to a consensus sequence among all known splice variants so one assay provides comprehensive results. 140 120 EXON 7 Solaris qPCR Reference Gene products - the most commonly used reference genes to help you normalize expression levels of your experimental samples See p. 44 EXON 7 Forward Primer Probe n Site 1 EXON 3 PRIMER PRIMER PRIMER Target Gene Expression (% of control) For optimal results, Use the GENEius product search at www.thermoscientific.com/ solarissearch to search for your gene. You will receive one recommended assay for real-time quantification. Since the Solaris qPCR Gene Expression Assay detects all known splice variants, one assay is all you need. qPCR Pre-Designed Assays for the Analysis of Human and Mouse Gene Expression Solaris RNA Spike Control Kit - check that inhibition is not affecting your RT-qPCR results See p. 46 Verso cDNA Synthesis Kit generates high quality cDNA from any type of RNA and is ideal for RT-qPCR reactions in combination with Solaris qPCR Master Mixes See p. 70 100 80 60 40 20 ALDOA NTC Controls PPIB ALDOA detection NTC PPIB detection Untreated Mock 0.1nM 1nM 10nM 100nM 0.1nM 1nM 10nM 100nM Untreated Mock 0.1nM 1nM 10nM 100nM 0.1nM 1nM 10nM 100nM 0 Controls Schematic representation of the Solaris probe with advanced probe chemistries The Solaris algorithm incorporates advanced chemistries like MGB and Superbases into the probe design in order to create highly specific assays for even the most difficult design targets. Solaris Assays are highly reproducible Solaris Assays give consistent results even between different researchers and laboratories. siRNAs targeting ALDOA and PPIB, as well as a Non-targeting Control (NTC), were transfected into HeLa cells at 100, 10, 1 and 0.1 nM final concentrations. Cells were harvested and total RNA isolated 48 hrs post-treatment. cDNA was synthesized using Thermo Scientific Verso cDNA Synthesis Kit. An aliquot of the cDNA was amplified in two geographically separated laboratories using Solaris qPCR Gene Expression Assays for detection of ALDOA, PPIB, and GAPDH on a Roche LightCycler 480 (384-well) platform. Knockdown was calculated using the ΔΔCq method (normalized to GAPDH reference gene and NTC-treated cells). The same levels of knockdown were demonstrated for both gene targets between both researchers at both sites. 42 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 43 www.thermoscientific.com/solaris Description Benefits • • • • Ordering Information Solaris Assays are available as inventoried or built-to-order assays for human and mouse genes. Search for your gene at www.thermoscientific.com/solarissearch Description Each pre-designed Thermo Scientific Solaris qPCR Assay consists of a single MGB probe and primer pair specific to your target gene. • One assay per gene – assays detect all known splice variants of your gene Solaris assays will not require any major changes to your protocol No optimization needed – you can expect excellent results in terms of repeatability, reproducibility, sensitivity, dynamic range, efficiency, and specificity Universal thermal cycling conditions – all Solaris assays perform optimally using the same thermal protocol thereby providing maximum convenience Full sequence information provided with every assay Applications • Human & mouse gene expression analysis, used in conjunction with Solaris qPCR Master Mix 100 x 25 µl rxns AX-######-##-0200 200 x 25 µl rxns AX-######-##-0400 400 x 25 µl rxns AX-######-##-1000 1000 x 25 µl rxns where # represent gene/species specific code Solaris qPCR Reference Genes Target Human Mouse ACTB AX-003451-00-* AX-057827-00-* B2M AX-004366-00-* • • • • • • Product contents Solaris qPCR Gene Expression Assays are supplied as a 20x mix containing one gene-specific MGB probe (to result in a final 1x concentration of 200 nM) and two gene-specific primers (to result in a final 1x concentration of 200 nM per primer). Both MGB probe and primers incorporate Superbase technology. DNA CDC20 Gain the best possible data – developed to deliver optimal performance with Solaris assays Reproducibility and convenience – ready-to-use 2x master mix minimizes pipetting error and reduces set up time Error-free pipetting – see the blue master mix as you pipette, visually assess your set up AX-012541-00-* HPRT1 AX-008735-00-* PGK1 AX-006767-00-* PPIA AX-004979-00-* PPIB AX-004606-00-* AX-048843-00-* RPLPO AX-010864-00-* RPS18 AX-011890-00-* TBP AX-011790-00-* TFRC AX-003941-00-* *Please add the following 4 digit code to specify the required pack size. AX-######-##-0100 100 rxns (125 µl vol) AX-######-##-0200 200 rxns (250 µl vol) AX-######-##-0400 400 rxns (500 µl vol) AX-######-##-1000 1000 rxns (1250 µl vol) Store at -20°C. Avoid repeated freeze thawing. Solaris qPCR Gene Expression Master Mix See p. 45 Solaris RNA Spike Control Kit See p. 46 Verso cDNA Synthesis Kit See p. 70 44 www.thermoscientific.com/pcr Ordering Information Gene Expression Analysis RT-qPCR Real Time PCR AB-4350/INT100 x 25 µl rxns AB-4350/A 200 x 25 µl rxns AB-4350/B 400 x 25 µl rxns AB-4350/C 1000 x 25 µl rxns Product contents Solaris qPCR Gene Expression Master Mix is supplied as a 2x solution. It contains Thermo-Start Taq DNA Polymerase, a proprietary reaction buffer, dNTPs and ROX, an internal passive reference dye supplied either as a separate vial or as part of the master mix, depending on the product. Efficiency = 95% r2 = 0.999 Dyn Range = 10 LOD = 5 copies Solaris qPCR Gene Expression Master Mix with ROX AB-4351/INT100 x 25 µl rxns AB-4351/A 200 x 25 µl rxns AB-4351/B 400 x 25 µl rxns AB-4351/C 1000 x 25 µl rxns Solaris qPCR Gene Expression Master Mix with Low Rox AB-4352/INT100 x 25 µl rxns AB-4352/A 200 x 25 µl rxns AB-4352/B 400 x 25 µl rxns AB-4352/C 1000 x 25 µl rxns cDNA F2RL1 Efficiency = 97% r2 = 0.998 Dyn Range = 9 LOD = 50 copies Store -20°C. The reagents can be stored at 4°C for up to 1 month. Avoid repeated freeze thawing. Solaris Assays give reliable detection even at very low input concentrations, as judged by the PCR efficiency and r2 values Ten 10-fold dilutions of cDNA synthesized from synRNA amplicon sequence or DNA amplicon sequence were amplified on an ABI 7900HT instrument using Solaris qPCR Gene Expression Assay for F2RL1 or CDC20, respectively. The log-scale amplification curves and standard curves are shown along with the performance of each assay including efficiency, r2 value, dynamic range (out of 10 log10 dilutions) and the lower limit of detection. Solaris provides efficient, repeatable detection of all gene targets on all commonly used qPCR platforms and targets Related products www.thermoscientific.com/solaris Solaris qPCR Gene Expression Master Mix with separate ROX Vial GAPDH AX-004253-00-* AX-040917-00-* GUSB Solaris Bar Heading qPCR Gene ctrl shift altMaster Expression 4 heading Mixes Benefits Applications Solaris qPCR Gene Expression Assays AX-######-##-0100 Thermo Scientific Solaris qPCR Master Mixes are designed to be used with pre-designed Solaris qPCR Gene Expression Assays for reliable, sensitive, and specific detection. These optimized master mixes contain an inert blue dye. Working with blue reagents allows you to see your reagent as you pipette, track your progress across multiple wells, and visually assess your set up. This visual confirmation further enhances the repeatability of your data. Solaris master mixes provide optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). qPCR qPCR Solaris qPCR Gene B Bar Heading Expression Assays ctrl shift alt 4 – gene-specific primers heading and MGB-probe ABI 7900HT Roche LightCycler 480 Mx3000P Stratagene PCR Efficiency Repeatability (%) (r2) Target Gene ID RPS18 CDC45L ZYX RPS27L RPLP2 6222 8318 7791 51065 6181 98 100 100 100 101 0.996 1.000 0.998 1.000 1.000 C9orf86 MTHFD2 BACH1 ACTB VIM 55684 4522 571 60 7431 97 98 99 100 101 0.988 1.000 0.999 0.999 1.000 PPIB B2M POLR2H CENPE 5479 567 5437 1062 91 93 93 98 0.998 0.999 0.996 0.996 E Enzyme Master Mix Related products Solaris qPCR Gene Expression Assays See p. 44 Solaris qPCR Reference Genes Seep. 44 Solaris RNA Spike Control Kit See p. 46 Verso cDNA Synthesis Kit See p. 70 KIT Kit Added color www.thermoscientific.com/pcr 45 Description Description Thermo Scientific Solaris RNA Spike Control Kit is a simple way to check for RT-qPCR inhibition. Samples may produce inaccurate RT-qPCR data either because the RT step, or the qPCR step, is being inhibited. Inhibition can be caused not only by the presence of contaminants carried through from purification steps but also from the addition of excess RNA to the RT step. Solaris RNA Spike Control Kit significantly reduces the likelihood of obtaining poor quality RT-qPCR data arising from inhibition and enables adherence to the MIQE (Minimum Information for Publication of Quantitative Real-Time PCR Experiments) guidelines1. KIT www.thermoscientific.com/solaris Ordering Information Solaris RNA Spike Control Kit K-002200-C1-100 100 x 25 µl rxns K-002200-C1-200 200 x 25 µl rxns K-002200-C1-400 400 x 25 µl rxns K-002200-C1-1000 1000 x 25 µl rxns • • If you are not testing for inhibition, this may be the reason you are seeing unexpected or variable results If you are already testing for inhibition, this kit offers you a simpler and more reliable alternative approach • An RNA, not a DNA spike – assess the effects of inhibition throughout the entire RT-qPCR workflow Detect inhibition with just 6 wells of data prior to processing your samples – identify inhibition early to avoid processing inappropriate samples Appropriate for use with either probe or SYBR Green chemistry – protocol is not chemistry dependent • Sample assessment prior to RT-qPCR using either probe or SYBR Green detection strategy Product contents Extremely fast protocols: combined annealing and extension step of only 15 s Specific and sensitive detection of a wide range of template concentrations Included dUTP allows the use of UNG for prevention of carry-over contamination Convenient 2x master mix and optimized protocols Fast qPCR qPCR using sequence-specific probes RT-qPCR using sequence-specific probes 2x master mix (contains hot start Tbr DNA polymerase, optimized PCR buffer, MgCl2, and dNTP mix including dUTP) and 50x ROX passive reference dye. 100 fg 1 pg Solaris RNA Spike Control added here DyNAmo Flash Probe qPCR Kit F-455S100 x 20 µl rxns or 40 x 50 µl rxns F-455XL Product contents The kit is supplied in two parts: the Solaris RNA Spike Control (synthetic RNA molecule supplied as a 100x stock) and the corresponding Solaris qPCR RNA Spike Assay (20x concentration of probe and primer pair). Ordering Information F-455L500 x 20 µl rxns or 200 x 50 µl rxns Applications • • • Applications Store the Solaris qPCR RNA Spike Assay at -20°C and the Solaris RNA Spike Control at -80°C until ready for use. Avoid repeated freeze-thaw cycles. • • • • Bar Heading DyNAmo Flash Probe ctrl shift alt 4 qPCR Kit heading www.thermoscientific.com/qpcrsolutions Benefits Benefits • • Thermo Scientific DyNAmo Flash Probe qPCR Kit is the perfect choice for fast probe-based qPCR. The optimized reagents and extremely short cycling times deliver maximum speed, thus increasing sample throughput. Significant time savings are achieved with both conventional and fast real-time PCR instruments. Performance of the DyNAmo Flash Probe qPCR Kit is based on an efficient hot start Thermus brockianus DNA polymerase. Sensitivity and the excellent amplification efficiency across a wide range of template concentrations guarantee reproducible results. DyNAmo Flash Probe qPCR Kit is optimized for hydrolysis probes (e.g., Man probes) and can be used with both block- and capillary-based, real-time PCR instruments (See p. 40-41 for compatibility). qPCR qPCR B Bar Heading Solaris RNA Spike ctrl shift alt 4 Control Kit heading 2500 x 20 µl rxns or 1000 x 50 µl rxns Store -20°C. When using the 2x master mix, the leftover thawed mix can be refrozen and stored at -20°C without affecting the performance of the kit. 10 pg 100 pg 1 ng cDNA synthesis set up RNA prep High inhibitor concentration Run RT reaction RNA diluted by RT reaction components 10 ng Most manufacturers’ exogenous controls added here Some manufacturers’ exogenous controls added here qPCR reaction set up Aliquot of cDNA transferred to qPCR High amplification efficiency across a broad range of template concentrations Amplification of a 118 bp amplicon from the Salmonella typhimurium InvA gene with DyNAmo Flash Probe qPCR Kit and Opticon 2 from MJ/ Bio-Rad (combined annealing and extension 15 s, total run time 67 min). DyNAmo Flash Probe qPCR kit delivers high amplification efficiency with short analysis time. Continue to qPCR cDNA diluted by qPCR reaction components Low inhibitor concentration Points at which a spike-in or exogenous control molecule can be added to a two-step RT-qPCR process are displayed Inhibitors are most concentrated in extracted RNA, and are gradually diluted out during each step (represented by dark blue liquid becoming lighter). A control added to a qPCR reaction will not facilitate detection of inhibition occurring prior to this step. Related products DyNAmo ColorFlash Probe qPCR Kit See p. 48 Maxima First Strand cDNA Synthesis Kit See p. 59 Related products Solaris qPCR Gene Expression Master Mix See p. 45 46 www.thermoscientific.com/pcr 1. Bustin SA et al. “The MIQE guidelines: Minimum information for publication of quantitative Real-Time PCR experiments.” Clinical Chemistry 55:4 611-622 (2009). E Enzyme Oligo(dT)18 Primer See p. 76 Random Hexamer Primer See p. 76 Master Mix KIT Kit Added color www.thermoscientific.com/pcr 47 Description www.thermoscientific.com/qpcrsolutions Description Thermo Scientific DyNAmo ColorFlash Probe qPCR Kit offers equal performance to the DyNAmo Flash Probe kit (See p. 47). In addition, it incorporates an innovative multicolor system that ensures correct pipetting. The 2x master mix contains a blue dye, and a separate sample buffer contains a yellow dye. The qPCR reaction mix containing both components is green. Using this patent-pending multicolor system, pipetting of both the master mix and the sample can be easily monitored. This significantly decreases the risk for pipetting errors during reaction set up, especially when using white reaction vessels. The dyes do not affect the specificity or sensitivity of qPCR assays. DyNAmo Color Flash Probe qPCR Kit provides optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). Thermo Scientific Maxima Probe qPCR Master Mixes are ready-to-use solutions optimized for quantitative real-time PCR. The master mixes include Maxima Hot Start Taq DNA Polymerase and dNTPs in an optimized PCR buffer. Only template and primers need to be added. Bar Heading Maxima Probe qPCR ctrl shift alt 4 Master Mixes heading Maxima Hot Start Taq DNA Polymerase in combination with an optimized buffer ensures PCR specificity and sensitivity. dUTP is included in the mix for optional carry-over contamination control using uracil DNA glycosylase (UDG)1. The use of Maxima Probe qPCR Master Mixes in real-time PCR ensures reproducible, sensitive and specific quantification of genomic, plasmid, viral, and cDNA templates. www.thermoscientific.com/qpcrsolutions qPCR qPCR B Bar Heading DyNAmo ColorFlash ctrl shift alt 4 Probe qPCR Kit heading Maxima Probe qPCR Master Mixes provide optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). F-456S100 x 20 µl rxns or 40 x 50 µl rxns F-456L500 x 20 µl rxns or 200 x 50 µl rxns F-456XL 2500 x 20 µl rxns or 1000 x 50 µl rxns Store -20°C. When using the 2x master mix, the leftover thawed mix can be refrozen and stored at -20°C without affecting the performance of the kit. The yellow sample buffer solution is stable and can be stored at +4°C, but storage at -20°C with the other kit components is recommended. • • • • • Ordering Information Benefits Minimized risk of pipetting errors during reaction set up Especially beneficial when using white reaction vessels Extremely fast protocols due to combined annealing and extension step of only 15 s Specific and sensitive detection of a wide range of template concentrations dUTP included in the 2x master mix allows the use of UNG for prevention of carry-over contamination • Specificity – Maxima Hot Start Taq DNA Polymerase and the optimized buffer eliminate non-specific amplification and formation of primer dimers Sensitivity – detects low copy number targets Wide linear range – accurate quantification across 9 orders of magnitude Reproducibility and convenience – ready-to-use 2x master mix • • • Applications • • • Fast qPCR qPCR using sequence-specific probes RT-qPCR using sequence-specific probes 4 Product contents 2x master mix with blue dye (contains hot start version of a modified Tbr DNA polymerase, optimized PCR buffer, MgCl2, dNTP mix including dUTP), 40x yellow sample buffer solution with yellow dye and 50x ROX passive reference dye. + Master mix = Sample in buffer qPCR reaction mix Applications 3.5 3 Fluorescence (norm) DyNAmo ColorFlash Probe qPCR Kit Benefits 100 pg 2 1 1 pg total RNA 0.5 1 5 10 15 Related products 35 40 NTC 1 ng 10 -1 1 5 10 15 20 25 Cycle number 30 35 Random Hexamer Primer See p. 76 K0231 200 x 25 µl rxns K0232 1000 x 25 µl rxns K0233 4000 x 25 µl rxns Maxima Probe qPCR Master Mix (2x), ROX Solution provided K0261 200 x 25 µl rxns K0262 1000 x 25 µl rxns K0263 4000 x 25 µl rxns Store at -20°C in the dark for long term storage or at 4°C for up to one month. Avoid multiple freeze-thawing of ROX Solution. Product contents All Maxima Probe qPCR Master Mixes include Maxima Hot Start Taq DNA Polymerase and dNTPs in an optimized PCR buffer. ROX passive reference dye is either included in the master mix (Maxima Probe/ROX qPCR Master Mix) or provided in a separate vial (Maxima Probe qPCR Master Mix (2x), ROX Solution provided). All Maxima Probe qPCR Master Mixes are supplied with nuclease-free water. 40 NTC Related products Maxima Reverse Transcriptase See p. 58 1.Longo MC et al. “Use of uracil DNA glycosylase to control carry-over contamination in Polymerase Chain Reactions.” Gene 93:125-128 (1990). Oligo(dT)18 Primer See p. 76 Maxima Probe/ROX qPCR Master Mix (2x) Precise and reproducible results Amplification of the human PGK1 gene was performed on serial 2-fold dilutions of human genomic DNA (from 0.5 µg to 1 ng) in 4 replicate reactions of 25 µl. Reactions were performed on an ABI PRISM 7000 instrument. NTC is the non-template control. 1 Maxima First Strand cDNA Synthesis Kit See p. 59 www.thermoscientific.com/pcr 30 101 10 -2 DyNAmo Flash Probe qPCR Kit See p. 47 48 20 25 Cycle number Highly sensitive 2-step RT-qPCR Amplification of the human PPP1CA gene was performed on serial 10-fold dilutions of Jurkat cell total RNA (from 1 ng to 1 pg). First strand cDNA was generated with the RevertAid First Strand cDNA Synthesis Kit (#K1621). cDNA was amplified with the Maxima Probe/ROX qPCR Master Mix (2X) using the Man assay specific for PPP1CA. Reactions were performed on an ABI PRISM 7000 instrument. 1 pg of total RNA was successfully detected. NTC is the non-template control. Assists reaction set up with clear and white plates White reaction vessels are especially good for qPCR applications as they deliver higher signal intensities than clear vessels. However, traditional colorless reaction components are poorly visible in white wells, making reaction set up more difficult. DyNAmo ColorFlash qPCR Kits overcome this difficulty and decrease the risk of pipetting errors. In the image, the blue wells contain only the 2x master mix. The green color indicates that the sample DNA with yellow color has also been added into the reaction. qPCR using sequence-specific probes RT-qPCR using sequence-specific probes 1000 pg 1.5 0 -0.5 Blue + yellow = green DyNAmo ColorFlash qPCR Kits contain 2x master mix supplemented with a blue dye. The yellow 40x sample buffer is included as a separate vial. This buffer can be mixed with the samples to provide visual aid when pipetting. • • 10 pg 2.5 Fluorescence (norm) Ordering Information Maxima First Strand cDNA Synthesis Kit See p. 59 Oligo(dT)18 Primer See p. 76 Random Hexamer Primer See p. 76 E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 49 NEW www.thermoscientific.com/ snpgenotyping Ordering Information Description Description Thermo Scientific DyNAmo SNP Genotyping Master Mix delivers fast, high quality SNP genotyping to customers using end-point fluorescence detection on real-time PCR instruments. Reliable and reproducible detection of SNP alleles is achieved via a patent-pending master mix formulation that offers enhanced discrimination, even when targeting the most challenging amplicons. DyNAmo SNP Genotyping Master Mix has been optimized to offer superior performance when using TaqMan SNP Genotyping Assays or custom designed assays. DyNAmo SNP Genotyping Master Mix provides optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). DyNAmo Flash SYBR Green qPCR Kit provides optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). Benefits • • • • Improve your time to results – patent-pending mix formulation delivers fast protocol times (as short as 50 minutes) Achieve accurate genotyping results with as little as 0.5 ng DNA A unique two color system aids sample set-up procedures Consistent performance for high throughput laboratories – Pre-pipetted reactions stable for 3 days at 4°C DyNAmo SNP Genotyping Master Mix F-480S 200 x 25 µl rxns F-480L 1000 x 25 µl rxns F-480XL 4000 x 25 µl rxns Store -20°C. When using the 2x master mix, the leftover thawed mix can be refrozen and stored at -20°C without affecting the performance of the product. Applications • • • • Thermo Scientific DyNAmo Flash SYBR Green qPCR Kit is developed for fast real-time qPCR. It provides qPCR results faster than most SYBR Green kits without compromising the qPCR performance. A DNA-binding domain attached to the polymerase in this kit improves the physical stability of the polymerase-DNA complex, thus enhancing the processivity and robustness of the amplification. The high amplification efficiency of DyNAmo Flash SYBR Green qPCR Kit gives reliable quantification and early Cq values. Due to the high signal intensity, DyNAmo Flash SYBR Green qPCR provides an excellent signal-to-noise ratio. Typing of disease loci Mutation analysis Association studies Epidemiology studies • • • • • • • Product contents Supplier A (Mix 1) Supplier A (Mix 2) www.thermoscientific.com/qpcrsolutions Ordering Information Extremely fast protocols: Combined annealing and extension step of only 15 s Specific and sensitive detection of a wide range of template concentrations Included dUTP allows the use of UNG for prevention of carry-over contamination Convenient 2x master mix and optimized protocols DyNAmo Flash SYBR Green qPCR Kit F-415S100 x 20 µl rxns or 40 x 50 µl rxns F-415L500 x 20 µl rxns or 200 x 50 µl rxns F-415XL Applications 2x master mix with blue dye (contains hot start version of an engineered Tbr DNA polymerase, optimized PCR buffer, MgCl2, dNTP mix including dUTP), 40x Sample Buffer with yellow dye and 50x ROX passive reference dye. DyNAmo SNP Genotyping Master Mix Benefits DyNAmo Flash SYBR Green qPCR Kit qPCR qPCR DyNAmo SNP Genotyping Master Mix Fast qPCR qPCR using SYBR Green dye RT-qPCR using SYBR Green dye 2500 x 20 µl rxns or 1000 x 50 µl rxns Store -20°C. When using the 2x master mix, the leftover thawed mix can be refrozen and stored at -20°C without affecting the performance of the kit. Product contents 2x master mix (contains hot start version of a modified Tbr DNA polymerase, SYBR Green I, optimized PCR buffer, MgCl2, dNTP mix including dUTP) and 50x ROX passive reference dye. Supplier B 1 pg Regular amplicon (LAC2) 10 pg 100 pg 1 ng 10 ng 100 ng 1 µg Difficult amplicon (NOTCH2) DyNAmo SNP Genotyping Master Mix delivers superior performance also with challenging amplicons The performance of DyNAmo SNP Genotyping Master Mix was compared against three other industry leading master mixes specifically developed for genotyping protocols. All master mixes tested delivered an acceptable call rate for LAC2, but for a more challenging amplicon (NOTCH2), two of the four mixes failed to successfully call the correct genotypes. Efficient amplification and high signal intensity Amplification of a 141 bp cDNA amplicon from a human calmodulin gene with DyNAmo Flash SYBR Green qPCR Kit and Opticon 2 from MJ/Bio-Rad (combined annealing and extension 15 s, total cycling time 70 min). DyNAmo Flash SYBR Green qPCR Kit delivers efficient amplification and high signal intensity. Related products DyNAmo ColorFlash SYBR Green qPCR Kit See p. 52 Maxima Reverse Transcriptase See p. 58 Maxima First Strand cDNA Synthesis Kit See p. 59 Oligo(dT)18 Primer See p. 76 Random Hexamer Primer See p. 76 Product reference Uvarov P. et al. “A novel N-terminal isoform of the neuron-specific K-Cl cotransporter KCC2.” J. Biol. Chem. 282:30570-30576 (2007). 50 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 51 www.thermoscientific.com/qpcrsolutions Ordering Information DyNAmo ColorFlash SYBR Green qPCR Kit F-416S100 x 20 µl rxns or 40 x 50 µl rxns F-416L500 x 20 µl rxns or 200 x 50 µl rxns F-416XL 2500 x 20 µl rxns or 1000 x 50 µl rxns Store -20°C. When using the 2x master mix, the leftover thawed mix can be refrozen and stored at -20°C without affecting the performance of the kit. The yellow sample buffer solution is stable and can be stored at +4°C, but storage at -20°C with the other kit components is recommended. Description DyNAmo ColorFlash SYBR Green qPCR Kit provides optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). Thermo Scientific Maxima SYBR Green qPCR Master Mixes are ready-to-use solutions optimized for qPCR and 2-step RT-qPCR. The master mixes include Maxima Hot Start Taq DNA Polymerase and dNTPs in an optimized PCR buffer. Only template and primers need to be added. The SYBR Green I intercalating dye allows for DNA detection and analysis without using sequence-specific probes. Maxima Hot Start Taq DNA Polymerase in combination with an optimized buffer ensures PCR specificity and sensitivity. dUTP is included in the mix for optional carry-over contamination control using uracil DNA glycosylase (UDG). The use of Maxima SYBR Green qPCR Master Mixes in real-time PCR ensures reproducible, sensitive and specific quantification of genomic, plasmid, viral, and cDNA templates. Maxima SYBR Green qPCR Master Mixes provide optimal performance on most real-time thermal cyclers (See p. 40-41 for compatibility). Benefits • • • • • • Specificity – Maxima Hot Start Taq DNA Polymerase and the optimized buffer eliminate non-specific amplification and formation of primer dimers Sensitivity – detects low copy number targets Wide linear range – accurate quantification across 9 orders of magnitude Reproducibility and convenience – ready-to-use 2x master mix • • • Applications Fast qPCR qPCR using SYBR Green dye RT-qPCR using SYBR Green dye • • Product contents 2x master mix with blue dye (contains hot start version of a modified Tbr DNA polymerase, SYBR Green I, optimized PCR buffer, MgCl2, dNTP mix including dUTP), 40x sample buffer solution with yellow dye and 50x ROX passive reference dye. Master mix = Sample in buffer qPCR reaction mix Blue + yellow = green DyNAmo ColorFlash SYBR Green qPCR Kits contains 2x master mix supplemented with a blue dye. The yellow 40x sample buffer is included as a separate vial. This buffer can be mixed with the samples to provide visual aid when pipetting the samples. Maxima First Strand cDNA Synthesis Kit See p. 59 Random Hexamer Primer See p. 76 www.thermoscientific.com/pcr E Enzyme Master Mix 1000 x 25 µl rxns K0223 4000 x 25 µl rxns Maxima SYBR Green/Fluorescein qPCR Master Mix (2x) K0241 200 x 25 µl rxns K0242 1000 x 25 µl rxns K0243 4000 x 25 µl rxns K0251 200 x 25 µl rxns K0252 1000 x 25 µl rxns K0253 4000 x 25 µl rxns Store at -20°C in the dark for long term storage or at 4°C for up to one month. Avoid multiple freeze-thawing of ROX Solution. 3.5 8.0 7.0 6.0 5.0 4.0 3.0 2.0 1.0 0 3.0 2.5 2.0 1.5 1.0 0.5 8 12 16 20 24 28 32 Cycle number 36 40 1.4 1.2 1.0 0.8 0.6 0.4 0.2 0 65 70 75 80 Temperature (°C) 85 90 75 80 Temperature (°C) 85 90 2.1 1.8 1.5 1.2 0.9 0.6 0.3 dR/dT Fluorescence (norm) Assists reaction set up with clear and white plates White reaction vessels are especially good for qPCR applications as they deliver higher signal intensities than clear vessels. However, traditional colorless reaction components are poorly visible in white wells, making reaction set up more difficult. DyNAmo ColorFlash SYBR Green qPCR Kits overcomes this difficulty and decreases the risk of pipetting errors. In the image, the blue wells contain only the 2x master mix. The green color indicates that the sample DNA with yellow color has also been added into the reaction. Oligo(dT)18 Primer See p. 76 52 200 x 25 µl rxns K0222 0 B Maxima Reverse Transcriptase See p. 58 K0221 4.0 9.0 4 DyNAmo Flash SYBR Green qPCR Kit See p. 51 Maxima SYBR Green/ROX qPCR Master Mix (2x) Maxima SYBR Green qPCR Master Mix (2x), ROX Solution provided All Maxima SYBR Green qPCR Master Mixes include Maxima Hot Start Taq DNA Polymerase and dNTPs in an optimized PCR buffer. Maxima SYBR Green/ROX qPCR Master Mix (2x) is supplemented with ROX passive reference dye. Maxima SYBR Green/Fluorescein qPCR Master Mix (2x) is supplemented with fluorescein passive reference dye. For Maxima SYBR Green qPCR Master Mix, ROX Solution provided (2x), ROX is provided in a separate vial. All Maxima SYBR Green qPCR Master Mixes are supplied with nuclease-free water. ΔRn + qPCR using SYBR Green RT-qPCR using SYBR Green Product contents A Related products www.thermoscientific.com/qpcrsolutions Ordering Information Benefits Minimized risk of pipetting errors during reaction set up Especially beneficial when using white reaction vessels Extremely fast protocols due to combined annealing and extension step of only 15 s Specific and sensitive detection of a wide range of template concentrations dUTP included in the 2x master mix allows the use of UNG for prevention of carry-over contamination Applications • • • Maxima SYBR Green qPCR Master Mixes qPCR qPCR DyNAmo ColorFlash SYBR Green qPCR Kit Description Thermo Scientific DyNAmo ColorFlash SYBR Green qPCR Kit offers equal performance to the DyNAmo Flash SYBR Green qPCR kit (See p. 51). In addition, it incorporates an innovative multi-color system that ensures correct pipetting. The 2x master mix contains a blue dye, and a separate sample buffer contains a yellow dye. The qPCR reaction mix containing both components is green. Using this patent-pending multicolor system, pipetting of both the master mix and the sample can be easily monitored. This significantly decreases the risk for pipetting errors during reaction setup, especially when using white reaction vessels. The dyes do not affect the specificity or sensitivity of qPCR assays. Derivative reporter (-Rn) NEW 4 8 12 16 20 24 28 32 36 40 Cycle number 65 70 Related products Maxima Reverse Transcriptase See p. 58 Specific and reproducible qPCR with two different real-time PCR instruments using Maxima SYBR Green qPCR Master Mix (2x), ROX Solution provided Amplification of the human cMyc gene was performed on serial dilutions of Jurkat cell total RNA (10 ng to 100 fg). Instruments used: A: ABI 7500. B: Corbett RotorGene™ 3000. KIT Kit Added color Maxima First Strand cDNA Synthesis Kit See p. 59 Oligo(dT)18 Primer See p. 76 Random Hexamer Primer See p. 76 www.thermoscientific.com/pcr 53 Description 2x master mixes for probe chemistry. Suitable alternatives available for all common real-time instruments. Thermo Scientific ABsolute Blue qPCR Mixes utilize Thermo-Start Taq hot start enzyme for increased sensitivity. The master mixes incorporate an inert blue dye to enhance the contrast between reagent and plastic, making verification of master mix dispensing quick, easy, and foolproof. Store at -20°C. Description ABsolute qPCR Mixes Thermo Scientific ABsolute qPCR Mixes are optimized for use with hybridization probes and contain all the components necessary to perform quantitative PCR, with the exception of template and primers/probes. The 2x mix contains a proprietary reaction buffer that provides high sensitivity, specificity, and reproducibility. Store at -20°C. Description ABsolute Blue qPCR SYBR Green Mixes 2x master mixes for SYBR Green chemistry. Suitable alternative available for all common real-time instruments. Thermo Scientific ABsolute Blue qPCR SYBR Green Mixes utilize Thermo-Start Taq hot start enzyme for increased sensitivity. The master mixes incorporate an inert blue dye to enhance the contrast between reagent and plastic, making verification of master mix dispensing quick, easy, and foolproof. Store at -20°C. Description ABsolute qPCR SYBR Green Mixes 54 www.thermoscientific.com/pcr Thermo Scientific ABsolute qPCR SYBR Green Mixes are optimized for SYBR Green I assays and contain all the components necessary to perform quantitative PCR, with the exception of template and primers. The 2x qPCR SYBR Green Mix contains optimal levels of active SYBR Green I dye and Thermo-Start Taq DNA Polymerase supplied in a proprietary reaction buffer that enables detection of low copy number targets. The kits are available with the option of included ROX or fluorescein reference dyes. Store at -20°C. Description Ordering Information ABsolute Blue qPCR ROX Mix AB-4138/B 1600 x 25 µl rxns AB-4139/A 400 x 25 µl rxns AB-4139/B 4000 x 25 µl rxns ABsolute Blue qPCR Mix & ROX Vial AB-4136/A 200 x 25 µl rxns AB-4136/B 1600 x 25 µl rxns AB-4137/A 400 x 25 µl rxns AB-4137/B 4000 x 25 µl rxns ABsolute Blue qPCR low ROX Mix AB-4318/A 200 x 25 µl rxns AB-4318/B 1600 x 25 µl rxns AB-4319/A 400 x 25 µl rxns AB-4319/B 4000 x 25 µl rxns Thermo Scientific DyNAmo HS SYBR Green qPCR Kit is a ready-to-use 2x master mix for sensitive, quantitative real-time PCR. The master mix contains a modified Thermus brockianus DNA polymerase and all the other reagents needed for qPCR. Only template DNA and PCR primers need to be added by the user. The modified DNA polymerase in this kit incorporates a non-specific DNA-binding domain that lends physical stability to the polymerase-DNA complex. Ordering Information DyNAmo HS SYBR Green qPCR Kit F-410L 500 x 20 µl rxns or 200 x 50 µl rxns Bar Heading DyNAmo HS4SYBR Green ctrl shift alt qPCR Kit heading qPCR qPCR B Bar Heading ABsolute Blue ctrl shift alt 4 qPCR Mixes heading Store -20°C. After use, the leftover thawed 2x master mix can be refrozen and stored at -20°C. Ordering Information ABsolute qPCR Mix (no ROX) AB-1132/B 800 x 50 µl rxns AB-1133/A 200 x 50 µl rxns AB-1133/B 2000 x 50 µl rxns ABsolute qPCR Low ROX Mix AB-1318/B 800 x 50 µl rxns AB-1319/A 200 x 50 µl rxns AB-1319/B 2000 x 50 µl rxns ABsolute qPCR ROX (500nM) Mix AB-1138/A 100 x 50 µl rxns AB-1138/B 800 x 50 µl rxns AB-1139/A 200 x 50 µl rxns AB-1139/B 2000 x 50 µl rxns ABsolute qPCR Capillary Mix AB-1283/A 250 x 20 µl rxns AB-1283/B 2000 x 20 µl rxns ABsolute Blue qPCR SYBR Green Mix & ROX Vial AB-4166/A 200 x 25 µl rxns AB-4166/B 1600 x 25 µl rxns AB-4167/A 400 x 25 µl rxns AB-4167/B 4000 x 25 µl rxns Ordering Information DyNAmo Probe qPCR Kit F-450L 500 x 20 µl rxns or 200 x 50 µl rxns DyNAmo Probe qPCR Kit Store -20°C. After use, the leftover thawed 2x master mix can be refrozen and stored at -20°C. Ordering Information ABsolute Blue qPCR SYBR Green ROX Mix AB-4162/A 200 x 25 µl rxns AB-4162/B 1600 x 25 µl rxns AB-4163/A 400 x 25 µl rxns AB-4163/B 4000 x 25 µl rxns Description Thermo Scientific DyNAmo Probe qPCR Kit is a ready-to-use 2x master mix for highly specific quantitative PCR. The master mix contains all of the reagents needed for qPCR. Only template DNA, PCR primers and probe need to be added by the user. The 2x master mix includes a hot start Thermus brockianus DNA polymerase. ROX passive reference dye is also supplied with the kit in a separate tube for instruments that require ROX normalization. DyNAmo Probe qPCR Kit is compatible with all block-based and capillary-based real-time qPCR instruments. ABsolute Blue qPCR SYBR Green low ROX Mix AB-4322/B 1600 x 25 µl rxns AB-4323/A 400 x 25 µl rxns AB-4323/B 4000 x 25 µl rxns ABsolute Blue qPCR SYBR Green Fluorescein Mix AB-4219/A 200 x 25 µl rxns AB-4219/B 1600 x 25 µl rxns AB-4220/A 400 x 25 µl rxns AB-4220/B 4000 x 25 µl rxns Ordering Information ABsolute qPCR SYBR Green Mix (no ROX) AB-1158/A 100 x 50 µl rxns AB-1158/B 800 x 50 µl rxns AB-1159/A 200 x 50 µl rxns AB-1159/B 2000 x 50 µl rxns ABsolute qPCR SYBR Green Fluorescein Mix AB-1219/A 100 x 50 µl rxns AB-1219/B 800 x 50 µl rxns AB-1220/A 200 x 50 µl rxns AB-1220/B 2000 x 50 µl rxns ABsolute qPCR SYBR Green ROX (500nM) Mix AB-1162/B 800 x 50 µl rxns AB-1163/A 200 x 50 µl rxns AB-1163/B 2000 x 50 µl rxns ABsolute qPCR SYBR Green Low ROX Mix AB-1322/B 800 x 50 µl rxns AB-1323/A 200 x 50 µl rxns AB-1323/B 2000 x 50 µl rxns ABsolute qPCR SYBR Green Mix plus ROX Vial AB-1166/A 100 x 50 µl rxns AB-1166/B 800 x 50 µl rxns AB-1167/A 200 x 50 µl rxns AB-1167/B 2000 x 50 µl rxns ABsolute qPCR SYBR Green Capillary Mix AB-1285/B 2000 x 20 µl rxns www.thermoscientific.com/pcr 55 Solutions for RT-PCR Solutions for RT-qPCR RT-PCR is a rapid and sensitive method for analyzing gene expression, determining the presence or absence of transcripts or producing cDNA for cloning. There are two approaches for RT-PCR: 1-step or 2-step RT-PCR. The RNA target is first reverse transcribed into complementary DNA (cDNA), which is subsequently amplified either by traditional end-point PCR or real-time quantitative PCR (qPCR). Selection of Thermo Scientific reverse transcriptases (RTs) include both genetically modified M-MuLV RT enzymes as well as those obtained through in vitro evolution of M-MuLV RT, offering a range of RT enzymes from routine to enhanced performance. 1-step RT-PCR Benefits Quantitative reverse transcription PCR (RT-qPCR) has become a tool of choice for analyzing gene expression and viral load. The reverse transcription phase (mRNA cDNA) is crucial for precise and sensitive quantification, because the amounts of cDNA produced must be proportional to the original amounts of RNA. Successful cDNA synthesis is dependent on the integrity and purity of the template RNA and on using optimized reaction conditions. High-quality Thermo Scientific RT-qPCR reagents ensure the reliability of your experiments. RT enzyme selection Choose your RT enzyme or First Strand cDNA Synthesis Kit from the table below. Routine performance For analyzing gene expression in human and mouse, we offer convenient, pre-designed Solaris qPCR Gene Expression Assays See page Enhanced performance RevertAid H Minus Reverse Transcriptase2 RevertAid Premium Reverse Transcriptase3 Maxima Reverse Transcriptase RT-PCR up to 5 kb4 **** **** ***** ***** RT-PCR 5 - 20 kb4 ** *** ***** ***** Full length cDNA 5 - 20 kb ** *** ***** ***** cDNA labeling ** *** ***** **** * ***** ***** ** Optimal reaction temperature 42°C 42-45°C 50-55°C 50-55°C Active up to 50°C 55°C 60°C 65°C Reading length up to 13 kb 13 kb 20 kb 20 kb Yes No No Yes 0.1 ng 0.1 ng 1 pg 1 pg 70°C, 10 min 70°C, 10 min 85°C, 5 min 85°C, 5 min 60 min 60 min 30 min 15-30 min Enzyme, supplied with buffer See p. 64 See p. 62 See p. 60 See p. 58 First Strand cDNA Synthesis Kit See p. 65 See p. 63 See p. 61 See p. 59 5 RACE/Primer extension 5 Characteristics RNase H activity Sensitivity (total RNA) Inactivation Reaction time Available as Not available in Canada Not available in US 3 Not available in US and Canada 56 1 4 2 5 www.thermoscientific.com/pcr At their optimal temperatures Not for RACE Verso 1-Step RT-PCR Kits 1-step RT-qPCR Benefits • Fewer pipetting steps • Reduced risk of contamination • Suitable for high throughput amplification Recommended products Recommended products See p. 67 2-step RT-PCR Benefits RevertAid Reverse Transcriptase1 Applications 42 •Reverse transcription and PCR reactions occur in the same tube using sequencespecific primers • Minimal hands-on and protocol time • Reduced contamination risk •Run multiple reactions simultaneously for high throughput screening of RNA samples RT-PCR and RT-qPCR RNA as Starting Material: Thermo Scientific Solutions for RT-PCR and RT-qPCR •Separate reactions for cDNA synthesis and PCR •Both cDNA and PCR steps can be individually optimized: longer amplicon, higher fidelity or higher sensitivity •cDNA is synthesized using either random primers, oligo(dT) primers or sequencespecific primers •Multiple transcripts can be analyzed from a single RT reaction •Sample can be stored more safely as cDNA Recommended products Maxima Reverse Transcriptase or RevertAid Premium Reverse Transcriptase See p. 58 and 60. and Phusion High-Fidelity DNA Polymerase for obtaining the best PCR results See p. 22. For the complete list of PCR enzymes See pp. 12-13. Phusion RT-PCR Kit – complete kit for convenient high-fidelity 2-step RT-PCR See p. 66 Verso 1-step RT-qPCR Kits See pp. 68-69 2-step RT-qPCR Benefits • Separate RT and qPCR reactions •Optimized reaction conditions for both steps •cDNA can be stored and used for several qPCR reactions Recommended products Recommended products for the RT step: Maxima First Strand cDNA Synthesis Kit See p. 59 Recommended products for the qPCR step: Maxima qPCR Master Mixes for standard qPCR See p. 49 for probe mixes and page 53 for SYBR mixes. DyNAmo Flash or DyNAmo ColorFlash Kits for fast qPCR See pp. 47-48 for probe kits and 51-52 for SYBR kits. Recommended products Recommended products for pre-designed qPCR assays for human and mouse genes: Solaris qPCR Gene Expression Assays Solaris qPCR Master Mixes Verso cDNA Synthesis kit See p. 42-43 Protect your RNA from degradation using RiboLock RNase Inhibitor See page 75 www.thermoscientific.com/pcr 57 Description www.thermoscientific.com/rt Ordering Information Maxima Reverse Transcriptase EP0741 2000 U (200 U/µl) EP0742 10 000 U (200 U/µl) EP0743 4 x 10 000 U (200 U/µl) Store at -20°C. Maxima Reverse Transcriptase is capable of reproducible cDNA synthesis from a wide range of starting total RNA amounts (from 1 pg to 5 μg) at elevated temperatures (50-65°C). Due to its high thermostability, the enzyme maintains full activity during the entire reverse transcription reaction, generates high yields of cDNA and is able to synthesize very long RNA transcripts up to 20 kb. The reaction temperature can be increased up to 60°C for efficient transcription of RNA regions with a high secondary structure or to improve specificity using gene-specific primers. High yields of full-length cDNA up to 20 kb Active up to 65°C Thermostable – 90% active after incubation at 50°C for 60 minutes Efficient – complete cDNA synthesis in 15-30 minutes High sensitivity – reproducible cDNA synthesis from a wide range of total RNA quantities (1 pg – 5 μg) Incorporates modified nucleotides Applications • • • • • Maxima RT M-MuLV RT H Minus M-MuLV RT Maxima RT Vendor A Product contents 0.28 A 0.24 60 0.16 0.12 0.08 20 0.04 60 120 0.00 -0.02 240 Time, min M 60 30 15 5 M 60 30 15 5 M 60 30 15 5 M 2 6 10 14 18 22 26 30 34 38 Related products Maxima Probe qPCR Master Mixes See p. 49 Maxima SYBR Green qPCR Master Mixes See p. 53 High cDNA synthesis rate at 50°C Synthesis of cDNA was performed at 50°C for 5, 15, 30 and 60 minutes using 1 µg of 7 kb RNA transcript as a template. Reaction products were analyzed on a 1% alkaline agarose gel. Only Maxima RT was able to complete synthesis of a 7 kb transcript in 5 min. 39 37 35 33 31 29 27 25 23 21 19 17 The Maxima Universal First Strand cDNA Synthesis Kit differs from the Maxima First Strand cDNA Synthesis Kit by having separate kit components: Maxima Reverse Transcriptase, RiboLock RNase Inhibitor, 5x RT Buffer, 10 mM dNTPs, oligo (dT)18 primer, random hexamer primers, and nuclease-free water. K1661 B 50 rxns Store at -20°C. 10 Cycle number High thermostability of Maxima Reverse Transcriptase at 50°C Reverse transcriptases were incubated in 1x reaction mixture. At the indicated time points (5-240 minutes), enzyme activity was determined in a standard activity assay. 200 rxns Maxima Universal First Strand cDNA Synthesis Kit Maxima First Strand cDNA Synthesis Kit for RT-qPCR contains Maxima Enzyme Mix (Maxima Reverse Transcriptase and RiboLock RNase Inhibitor), 5x Reaction Mix (reaction buffer, dNTPs, oligo (dT)18 and random hexamer primers), and nuclease-free water. 0.20 0 5 30 50 rxns K1642 Store at -20°C. Vendor B 40 K1641 Only available in US and Canada. 80 0 Maxima First Strand cDNA Synthesis Kit for RT-qPCR 2-step RT-PCR 2-step RT-qPCR ΔRn Activity,% 100 Maxima Reverse Transcriptase is supplied with 5x RT Buffer (250 mM Tris-HCl (pH 8.3 at 25°C), 375 mM KCl, 15 mM MgCl2, 50 mM DTT). KIT Ordering Information Applications Product contents 2-step RT-PCR 2-step RT-qPCR First strand cDNA synthesis Construction of full length cDNA libraries DNA labeling Sensitive and reproducible cDNA synthesis from a wide range of total RNA amounts (1 pg - 5 μg) Increased synthesis rate – complete cDNA synthesis in 15 minutes Increased reaction temperature – up to 65°C Convenient format – pre-mixed solutions for use in RT-qPCR Increased reproducibility • • Maxima Bar Heading First Strand ctrl shift cDNA Synthesis alt 4 Kit heading for RT-qPCR www.thermoscientific.com/rt Benefits • • • • • Benefits • • • • • • Thermo Scientific Maxima First Strand cDNA Synthesis Kit for RT-qPCR is a convenient system optimized for cDNA synthesis in 2-step real time quantitative RT-PCR (RT-qPCR) applications. The kit uses Maxima Reverse Transcriptase, an advanced enzyme derived from in vitro evolution of M-MuLV RT. The enzyme features high thermostability, robustness and increased cDNA synthesis rate compared to wild type M-MuLV RT. The Maxima First Strand cDNA Synthesis Kit for RT-qPCR is capable of reproducible cDNA synthesis from a wide range of starting total RNA amounts (1 pg to 5 µg) at elevated temperatures (50-65°C). The synthesis reaction can be completed in 15-30 minutes. Components of the Maxima First Strand cDNA Synthesis Kit for RT-qPCR are pre-mixed to save time and to reduce the possibility of pipetting errors. Cycle E Description Thermo Scientific Maxima Reverse Transcriptase was developed through in vitro evolution of M-MuLV RT. The enzyme possesses an RNA-dependent and DNA-dependent polymerase activity as well as RNase H activity. The engineered enzyme features dramatically improved thermostability, robustness, and increased synthesis rate compared to wild type M-MuLV RT. RT-PCR and RT-qPCR RT-PCR and RT-qPCR B Bar Heading Maxima Reverse ctrl shift alt 4 Transcriptase heading 101 102 103 104 105 106 107 Quantity, pg Highly sensitive 2-step RT-qPCR. A – amplification plot. B – standard curve Amplification of the human PPP1CA gene was performed on varying amounts of Jurkat cell total RNA (5 μg, 2.5 μg, 1 μg, 100 ng, 10 ng, 1 ng, 100 pg, 10 pg, 1 pg). First strand cDNA was generated with the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (#K1641). cDNA was amplified with the Maxima Probe/ROX qPCR Master Mix (2x) using the Man assay specific for PPP1CA. Reactions were performed on an ABI 7500 Real-Time PCR instrument. 1 pg of total RNA was successfully detected. Reaction efficiency was 105%, slope-3.29, R2=0.999. DyNAmo Flash qPCR Master Mixes See p. 47 for probe and p. 51 for SYBR mixes DyNAmo ColorFlash qPCR Master Mixes See p. 48 for probe mixes and p. 52 for SYBR mixes Phusion High Fidelity DNA polymerase See p. 22 ΔRn Phire Hot Start II DNA Polymerase See p. 25 Long PCR Enzyme Mix See p. 31 dNTP Mixes See p. 74 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 2 6 10 14 Oligo(dT)18 Primer See p. 76 www.thermoscientific.com/pcr 22 26 30 34 38 Related products Maxima Probe qPCR Master Mixes See p. 49 Maxima SYBR Green qPCR Master Mixes See p. 53 DyNAmo Flash qPCR Master Mixes See p. 47 for probe and p. 51 for SYBR mixes DyNAmo ColorFlash qPCR Master Mixes See p. 48 for probe mixes and p. 52 for SYBR mixes Phusion High Fidelity DNA polymerase See p. 22 Long PCR Enzyme Mix See p. 31 Maxima Reverse Transcriptase See p. 58 Random Hexamer Primer See p. 76 58 18 Cycle number RiboLock RNase Inhibitor See p. 75 Reproducible RT-qPCR results using the Maxima First Strand cDNA Synthesis Kit for RT-qPCR First strand cDNA was generated from 100 ng-1 pg of total Jurkat cell RNA with the Maxima First Strand cDNA Synthesis Kit for RT-qPCR (#K1641) in 16 replicate reactions. Synthesized cDNA was used as a template in subsequent qPCR with Maxima SYBR Green/ROX qPCR Master Mix (#K0221) on the ABI 7500 Real-Time PCR instrument. Parallel RT reactions demonstrate reproducible cDNA synthesis and low variability levels with a wide range of starting RNA amounts. RiboLock RNase Inhibitor See p. 75 E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 59 Description E www.thermoscientific.com/rt Ordering Information RevertAid Premium Reverse Transcriptase EP0731 2000 U (200 U/µl) EP0732 10 000 U (200 U/µl) EP0733 40 000 U (200 U/µl) Store at -20°C. *Not available in US and Canada. Description Thermo Scientific RevertAid Premium Reverse Transcriptase was developed through in vitro evolution of M-MuLV RT. The enzyme possesses an RNA-dependent and DNA-dependent polymerase activity but lacks RNase H activity due to a mutation in the RNase H domain of M-MuLV RT. The engineered enzyme features dramatically improved thermostability, robustness and an increased synthesis rate compared to wild type M-MuLV RT. The eliminated RNase H activity enables the enzyme to produce very long RNA transcripts up to 20 kb. Due to its high thermostability, the enzyme maintains full activity during the entire reverse transcription reaction and generates high yields of cDNA. The reaction temperature can be increased up to 60°C for efficient transcription of RNA regions with a high secondary structure, or to improve specificity using gene-specific primers. Thermostable – 90% active after incubation at 50°C for 60 minutes in a reaction mixture Active up to 60°C High yields of full-length cDNA as long as 20 kb Efficient – complete cDNA synthesis in 30 minutes Incorporates modified nucleotides • • • • • • Benefits www.thermoscientific.com/rt Increased reaction temperatures – the first strand of cDNA can be synthesized within the 50-65°C temperature range High yields of full-length first strand cDNA with RNA templates up to 20 kb Flexible priming – oligo(dT)18, random hexamer or gene-specific primers • • • • First strand cDNA synthesis for RT-PCR and RT-qPCR Reverse transcription at elevated temperatures to reduce effects of secondary structure Synthesis of cDNA for cloning and expression Generation of labeled cDNA probes for microarrays DNA labeling Analysis of RNA by primer extension Ordering Information RevertAid Premium First Strand cDNA Synthesis Kit Applications Applications RevertAid Premium First Strand cDNA Synthesis Kit* KIT • • • Benefits • • • • • Thermo Scientific RevertAid Premium First Strand cDNA Synthesis Kit is a complete system for highly efficient synthesis of first strand cDNA. The kit uses the RevertAid Premium Reverse Transcriptase, which is an advanced enzyme derived by in vitro evolution of M-MuLV RT. The enzyme features the highest thermostability among the derivatives of M-MuLV RT and lacks RNase H activity. The RevertAid Premium First Strand cDNA Synthesis Kit allows synthesis of long cDNAs up to 20 kb at elevated temperatures (up to 60°C), superseding other systems’ abilities produce full-length cDNA. Due to increased synthesis rates the reaction can be completed in 30 min. First strand cDNA synthesis for RT-PCR Construction of cDNA libraries Generation of probes for hybridization Antisense RNA synthesis K1651 20 rxns K1652 100 rxns Store at -20°C. *Not available in US and Canada. Maxima Universal First Strand cDNA Synthesis Kit is available for customers in the US and Canada, See ordering information on page 59. Product contents RT-PCR and RT-qPCR RT-PCR and RT-qPCR RevertAid Premium Reverse Transcriptase* RevertAid Premium First Strand cDNA Synthesis Kit contains RevertAid Premium Enzyme Mix (RevertAid Premium Reverse Transcriptase and RiboLock RNase Inhibitor), 5x RT Buffer, dNTP Mix, Oligo(dT)18 Primer, Random Hexamer Primer, nuclease-free water. Product contents Fluorescence (norm) RevertAid Premium Reverse Transcriptase is supplied with 5x RT Buffer (250 mM Tris-HCl (pH 8.3 at 25°C), 375 mM KCl, 15 mM MgCl2, 50 mM DTT). 18 16 14 12 10 8 6 4 2 0 -2 1 5 10 15 20 25 Cycle number 30 35 40 Accurate quantification across 8 orders of magnitude with the RevertAid Premium Reverse Transcriptase RevertAid Premium Reverse Transcriptase was used in parallel first strand synthesis reactions with serial dilutions of in vitro transcribed GAPDH RNA (10-108 copies) for 15 minutes at 50°C. The synthesized cDNA was used in qPCR with Maxima SYBR Green/ROX qPCR Master Mix and primers specific to the GAPDH gene. Reaction efficiency was 96%, slope -3.43, R2 = 0.999. M 3.9 6.8 13.3 1 2 3 20.2 4 M Amplification of targets up to 20 kb in 2-step RT-PCR 1 µg of total RNA from Jurkat cells (1 and 2) or total RNA from mouse skeletal muscle (3 and 4) were used in a reverse transcription reaction with RevertAid Premium First Strand cDNA Synthesis Kit. Synthesized cDNA was used as a template in subsequent PCR with the Long PCR Enzyme Mix (#K0181) and primers specific for different genes: 3.9 kb – BCL2 (human B-cell CLL/lymphoma 2) 6.8 kb – POLE (human polymerase) 13.3 kb – Dmd (mouse dystrophin) 20.2 kb – Neb (mouse nebulin) Related products Phusion High-Fidelity DNA Polymerases See p. 22 Long PCR Enzyme Mix See p. 31 dNTP Mixes See p. 74 60 RiboLock RNase Inhibitor See p. 75 Related products Oligo(dT)18 Primer See p. 76 Long PCR Enzyme Mix See p. 31 Random Hexamer Primer See p. 76 Phusion High Fidelity DNA polymerases See p. 22 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 61 Description E Description Thermo Scientific RevertAid H Minus Reverse Transcriptase is a recombinant M-MuLV RT. The enzyme possesses an RNAdependent and DNA-dependent polymerase activity, but lacks RNase H activity due to a point mutation in the RNase H domain. RevertAid H Minus Reverse Transcriptase does not degrade RNA in RNA-DNA hybrids during synthesis of the first strand cDNA and therefore high yields of full-length cDNA from long templates are obtained. RevertAid H Minus Reverse Transcriptase maintains activity over a wide temperature range (42-50°C). Benefits www.thermoscientific.com/rt Ordering Information RevertAid H Minus Reverse Transcriptase EP0451 10 000 U (200 U/µl) EP0452 5 x 10 000 U (200 U/µl) Store at -20°C. *Not available in US. • • • • High yields of full-length first strand cDNA up to 13 kb Optimum activity at 42-45°C Active up to 55°C Incorporates modified nucleotides (e.g., Cy3-, Cy5-, rhodamine-, aminoallyl-, fluorescein-labeled nucleotides) First strand cDNA synthesis for RT-PCR and RT-qPCR Reverse transcription at elevated temperatures to reduce effects of secondary structure Synthesis of cDNA for cloning and expression Generation of labeled cDNA probes for microarrays DNA labeling Analysis of RNA by primer extension KIT www.thermoscientific.com/rt High yields of full-length first strand cDNA up to 13 kb Increased reaction temperatures in the range of 42°C to 55°C Supplied with recombinant RiboLock RNase Inhibitor Complete kit – oligo(dT)18 and random hexamer primers included with the kit RevertAid H Minus First Strand cDNA Synthesis Kit K1631 20 rxns K1632 100 rxns Store at -20°C. *Not available in US. Applications • • • Product contents RevertAid H Minus Reverse Transcriptase is supplied with 5x Reaction Buffer (250 mM Tris-HCl (pH 8.3 at 25°C), 250 mM KCl, 20 mM MgCl2, 50 mM DTT). First strand cDNA synthesis for RT-PCR and RT-qPCR Construction of full length cDNA libraries Antisense RNA synthesis Product contents The RevertAid H Minus First Strand cDNA Synthesis Kit contains RevertAid H Minus Reverse Transcriptase, RiboLock RNase Inhibitor, 5x Reaction Buffer, dNTP Mix, Oligo(dT)18 Primer, Random Hexamer Primer, Control RNA, Control Primers and nuclease-free water. 4564 bp 13305 bp 10092 bp 7850 bp 6149 bp 2023 bp Related products Maxima Probe qPCR Master Mixes See p. 49 Maxima SYBR Green qPCR Master Mixes See p. 53 M1 DyNAmo Flash qPCR Master Mixes See p. 47 for probe and p. 51 for SYBR mixes 62 RevertAid H Minus First Strand cDNA Synthesis Kit* Ordering Information Benefits • • • • Applications • • • • • • Thermo Scientific RevertAid H Minus First Strand cDNA Synthesis Kit is a complete system for efficient synthesis of first strand cDNA from RNA templates. The kit includes RevertAid H Minus Reverse Transcriptase, which has a point mutation that completely eliminates RNase H activity, therefore, it does not degrade RNA in RNA-DNA hybrids during synthesis of the first strand cDNA. The recombinant RiboLock RNase Inhibitor, supplied with the kit, effectively protects RNA template from degradation. It is fully compatible with the reverse transcription reaction, as it maintains activity at temperatures up to 55°C. The kit is supplied with both oligo(dT)18 and random hexamer primers. The oligo(dT)18 primer anneals selectively to the poly(A) tail of mRNA. Random hexamer primers do not require the presence of poly(A), therefore, they can be used for transcription of the 5’-end regions of mRNA or for cDNA synthesis using RNA without the poly(A) tail, e.g., microRNAs. Gene-specific primers may also be used with the kit. The first strand cDNA can be directly used as a template in PCR, realtime PCR or in second strand cDNA synthesis. 1 2 3 4 5 6 M2 Two-step RT-PCR using the RevertAid H Minus First Strand cDNA Synthesis Kit and Long PCR Enzyme Mix 1 μg of total mouse heart RNA and the oligo(dT)18 primer were used in a reverse transcription reaction with the RevertAid H Minus First Strand cDNA Synthesis Kit. Synthesized cDNA was used as a template in subsequent PCR with the Long PCR Enzyme Mix (#K0181). A PCR primer specific to the 5’-end of the mouse dystrophin gene mRNA and a series of flanking primers were used to amplify different regions of the gene. M1 – GeneRuler DNA Ladder Mix (#SM0331). 1-6 – RT-PCR products. M2 – Lambda – pUC Mix Marker (#SM0291). Related products Maxima Probe qPCR Master Mixes See p. 49 Maxima SYBR Green qPCR Master Mixes See p. 53 DyNAmo ColorFlash qPCR Master Mixes See p. 48 for probe mixes and p. 52 for SYBR mixes DyNAmo Flash qPCR Master Mixes See p. 47 for probe and p. 51 for SYBR mixes Maxima Reverse Transcriptase See p. 58 DyNAmo ColorFlash qPCR Master Mixes See p. 48 for probe mixes and p. 52 for SYBR mixes Phusion High-Fidelity DNA Polymerases See p. 22 Maxima Reverse Transcriptase See p. 58 Phire Hot Start II DNA Polymerase See p. 25 Phusion High-Fidelity DNA Polymerases See p. 22 Maxima Hot Start Taq DNA Polymerase See p. 26 Phire Hot Start II DNA Polymerase See p. 25 DreamTaq DNA Polymerase See p. 28 Maxima Hot Start Taq DNA Polymerase See p. 26 Long PCR Enzyme Mix See p. 31 DreamTaq DNA Polymerase See p. 28 Molecular Weight Markers See p. 72-73 Long PCR Enzyme Mix See p. 31 RiboLock RNase Inhibitor See p. 75 Molecular Weight Markers See p. 72-73 Oligo(dT)18 Primer See p. 76 dNTP Mixes See p. 74 Random Hexamer Primer See p. 76 RiboLock RNase Inhibitor See p. 75 www.thermoscientific.com/pcr RT-PCR and RT-qPCR RT-PCR and RT-qPCR RevertAid H Minus Reverse Transcriptase* E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 63 Description RevertAid Reverse Transcriptase* Description Thermo Scientific RevertAid Reverse Transcriptase (RT) is a recombinant M-MuLV RT. The enzyme possesses an RNAdependent and DNA-dependent polymerase activity and an RNase H activity specific for RNA in RNA-DNA hybrids. E www.thermoscientific.com/rt Ordering Information RevertAid Reverse Transcriptase EP0441 10 000 U (200 U/μl) EP0442 5 x 10 000 U (200 U/μl) Store at -20°C. *Not available in Canada. • • • • Efficient synthesis of full-length first strand cDNA up to 13 kb Optimum activity at 42°C Active up to 50°C Incorporates modified nucleotides (e.g., Cy3-, Cy5-, rhodamine-, aminoallyl-, fluorescein-labeled nucleotides) Applications • • • • • First strand cDNA synthesis for RT-PCR and RT-qPCR Synthesis of cDNA for cloning and expression Generation of labeled cDNA probes for microarrays DNA labeling Analysis of RNA by primer extension KIT Benefits • • • Product contents RevertAid Reverse Transcriptase is supplied with 5x Reaction Buffer (250 mM Tris-HCl (pH 8.3 at 25°C), 250 mM KCl, 20 mM MgCl2, 50 mM DTT). RevertAid First Strand cDNA Synthesis Kit* www.thermoscientific.com/rt Full-length first strand cDNA up to 13 kb Optimum reaction temperature 42°C Complete kit – all the components for the RT reaction are included Ordering Information RevertAid First Strand cDNA Synthesis Kit Applications • • • First strand cDNA synthesis for RT-PCR and RT-qPCR Construction of full length cDNA libraries Antisense RNA synthesis K1621 20 rxns K1622 100 rxns Store at -20°C. Keep control RNA (kit component) at -70°C for longer storage. *Not available in Canada. RT-PCR and RT-qPCR RT-PCR and RT-qPCR Benefits Thermo Scientific RevertAid First Strand cDNA Synthesis Kit is a complete system for efficient synthesis of first strand cDNA from RNA templates. The kit is suitable for synthesis of cDNA up to 13 kb. RiboLock RNase Inhibitor, supplied with the kit, effectively protects RNA templates from degradation. The kit is supplied with both oligo(dT)18 and random hexamer primers. The oligo(dT)18 primer anneals selectively to the poly(A) tail of mRNA. Random hexamer primers do not require the presence of the poly(A) tail, therefore, they can be used for transcription of the 5’-end regions of mRNA or cDNA synthesis of RNA species lacking a poly(A) tail (e.g., microRNAs). Gene-specific primers may also be used with the kit. Product contents The RevertAid First Strand cDNA Synthesis Kit contains RevertAid Reverse Transcriptase, RiboLock RNase Inhibitor, 5x Reaction Buffer, dNTP Mix, Oligo(dT)18 Primer, Random Hexamer Primer, Control GAPDH RNA, 10 μM Forward GAPDH Primer, 10 μM Reverse GAPDH Primer, and nuclease-free water. PCR-amplified regions from mouse dystrophin cDNA: 1, 2 – 5929-6465 bp 3, 4 – 3737-4876 bp 5, 6 – 316-2339 bp 7, 8 – 10627-13620 bp M1 – ZipRuler Express DNA Ladder 2 (#SM1373) M2 – ZipRuler Express DNA Ladder 1 (#SM1373) M1 1 2 3 4 5 6 7 8 PCR product length: 537 bp 1140 bp 2024 bp 2994 bp First Strand cDNA synthesized by RevertAid RT M2 PCR products Mouse dystrophin RNA Oligo dT primer Related products Maxima Probe qPCR Master Mixes See p. 49 1.0 Maxima SYBR Green qPCR Master Mixes See p. 53 3.0 4.0 3, 4 5.0 6.0 1, 2 7.0 8.0 9.0 10.0 11.0 12.0 13.0 13.8 kb 7, 8 Related products DyNAmo Flash qPCR Master Mixes See p. 47 for probe and p. 51 for SYBR mixes Full-length cDNA synthesis using the RevertAid First Strand cDNA Synthesis Kit 1 µg of total mouse heart RNA was used in a reverse transcription reaction using oligo(dT)18 primer. The synthesized cDNA was used as a template in subsequent PCR reactions with Taq DNA Polymerase. The ability to amplify the terminal 2024 bp fragment indicates that the entire 13.8 kb RNA sequence was reverse-transcribed. DyNAmo ColorFlash qPCR Master Mixes See p. 48 for probe mixes and p. 52 for SYBR mixes Maxima Reverse Transcriptase See p. 58 RiboLock RNase Inhibitor See p. 75 64 2.0 5, 6 Maxima Probe qPCR Master Mixes See p. 49 Maxima SYBR Green qPCR Master Mixes See p. 53 DyNAmo Flash qPCR Master Mixes See p. 47 for probe and p. 51 for SYBR mixes DyNAmo ColorFlash qPCR Master Mixes See p. 48 for probe mixes and p. 52 for SYBR mixes Phusion High-Fidelity DNA Polymerases See p. 22 Maxima Reverse Transcriptase See p. 58 DreamTaq DNA Polymerase See p. 28 Phusion High-Fidelity DNA Polymerases See p. 22 Taq DNA Polymerase See p. 30 DreamTaq DNA Polymerase See p. 28 Long PCR Enzyme Mix See p. 31 Taq DNA Polymerase See p. 30 dNTP Mixes See p. 74 Long PCR Enzyme Mix See p. 31 Oligo(dT)18 Primer See p. 76 Molecular Weight Markers See p. 72-73 Random Hexamer Primer See p. 76 RiboLock RNase Inhibitor See p. 75 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 65 Description KIT www.thermoscientific.com/rt Ordering Information Phusion RT-PCR Kit F-546S 20 rxns F-546L 100 rxns Store at -20°C. Description Thermo Scientific Phusion RT-PCR Kit is a complete 2-step kit designed for high-fidelity RT-PCR. The kit contains the full set of reagents required for performing cDNA synthesis and PCR in 2-steps. In the first step, a variety of RNA templates and all priming options may be used for efficient synthesis of cDNA with M-MuLV Reverse Transcriptase. In the second step, Phusion Hot Start II High-Fidelity DNA Polymerase is used for cDNA amplification. This polymerase is extremely accurate and robust, and the hot start modification guarantees additional specificity during PCR. The superior features of Phusion Hot Start II DNA Polymerase enable accurate cDNA amplification with high yields and short cycling times. Phusion RT-PCR Kit is an ideal choice when producing cDNA for cloning and gene expression studies. Benefits • • • • Broad range of RT-PCR products with high yields Accurate cDNA amplification with 52x Taq fidelity Short and simple cDNA synthesis and PCR protocols Easy to use; complete 2-step kit for RT-PCR The Verso 1-step RT-PCR system is also available with a ReddyMix option, where the master mix contains a dye and precipitant that allow RT-PCR reactions to be loaded directly onto an electrophoresis gel. The red dye migrates between bromophenol blue and xylene cyanol, at approximately 300 bp, depending on agarose concentration. Gene Expression Analysis Generation of cDNA products with superior fidelity for cloning and sequencing Phusion RT-PCR Kit contains RT enzyme mix (M-MuLV RNase H+ + RNase inhibitor), 10x RT Buffer (includes 50 mM MgCl2), Oligo(dT)15 primer (100 ng/µl), Random primers (hexamers, 50 ng/µl), 10 mM dNTP mix, Phusion Hot Start II DNA Polymerase (2 U/µl), 5x Phusion HF Buffer, Control RNA with carrier and Control Primer Mix (25 µM each). Phusion RT-PCR Kit M Supplier B Supplier A M M M M • • • • • • • Bar Heading Verso 1-Step ctrl shift alt 4 RT-PCR Kits heading KIT www.thermoscientific.com/rt Ordering Information Verso 1-Step Kit (with ThermoPrime Taq) AB-1454/A 80 x 25 µl rxns AB-1454/B 400 x 25 µl rxns Verso 1-Step Kit ReddyMix (with ThermoPrime Taq) AB-1454/LD/A 80 x 25 µl rxns Benefits Product contents bp The Verso system is available with ThermoPrime (standard PCR) or Thermo-Start (hot start) polymerase, the latter providing a more specific option that delivers higher yields and greatly reduces nonspecific primer extension before PCR. ThermoStart Taq DNA Polymerase is a chemically modified polymerase that remains inactive throughout the RT step, activated only by the high temperature incubation (95°C for 15 minutes) prior to PCR. An optional RT Enhancer is provided with kits and can be used during the RT step to remove any DNA contamination, eliminating the need for DNase I treatment. Applications • • Thermo Scientific Verso 1-Step RT-PCR system is a complete set of RT-PCR reagents that combines everything needed for RT-PCR. The Verso RT enzyme delivers high processivity and can be used at temperatures up to 57°C, delivering effective transcription through difficult RNA secondary structures. Verso also shows a better dynamic range than standard AMV or M-MuLV enzymes, with increases in template concentration giving rise to corresponding increases in product generated over a wider range of starting material concentrations. RT-PCR and RT-qPCR RT-PCR and RT-qPCR B Bar Heading ctrl shift RT-PCR Phusion alt 4 Kit heading Eliminate the need for DNase treatments – RT Enhancer (optional) prevents genomic DNA carry-over Enzyme choice – Standard PCR or hot start options available Available as ReddyMix formulation – eliminate post-PCR steps required for electrophoresis RT and PCR steps performed in single sealed tube – convenience coupled with reduced contamination risk Verso enzyme is highly sensitive in a broad dynamic range – accurately detect RNA input from 1pg to 1µg Wide working temperature range (42° - 57°C) for success with GC-rich and other difficult templates RNase Inhibitor included in RT enzyme mix AB-1454/LD/B 400 x 25 µl rxns Verso 1-Step Kit with Thermo-Start Taq (Hot Start) AB-1455/A 80 x 25 µl rxns AB-1455/B 400 x 25 µl rxns Store at -20°C. M Applications • • • • 1353 603 194 Gene Expression Analysis Viral/Bacterial detection One step RT-PCR High throughput applications Product contents Robust cDNA amplification and high yields with Phusion RT-PCR system A typical RT-PCR experiment for amplifying short cDNA fragments (192-1113 bp). Phusion RT-PCR system was compared to the RT-PCR systems from two major suppliers. Total RNA from human skeletal muscle was reverse transcribed with random priming. Amplification of cDNA was performed with a high-fidelity DNA polymerase recommended by the suppliers. Due to the various sizes of amplicons, a PCR protocol with the lowest annealing temperature and the longest extension time defined by amplicons was used. Robust Phusion RT-PCR Kit produced all 11 amplicons with highest yields. kb 10 8 6 3,3 66 M M Verso 1-step RT-PCR Kits include Verso Enzyme Mix (includes RNase inhibitor), 2x Master Mix ThermoPrime/Thermo-Start Taq DNA Polymerase, RT buffer, PCR buffer, dNTPs, MgCl2, (plus optional ReddyMix formulation) and RT Enhancer. Verso RNA Control Kit includes MS2 Positive Control RNA, MS2 Control Primer 1 and MS2 Control Primer 2. Phusion RT-PCR Kit amplifies long RT-PCR fragments 3.3 kb, 6 kb, 8 kb and 10 kb fragments of the human dystrophin mRNA were reverse transcribed and amplified with Phusion RT-PCR Kit. Oligo (dT)15 was used for priming. Starting template was human skeletal muscle total RNA (50 ng). Related products Phusion RT-PCR Kit See p. 66 Maxima Reverse Transcriptase See p. 58 Related products RevertAid Reverse Transcriptase See p. 64 Verso 1-Step RT-PCR Kits See p. 67 Phire Hot Start II DNA Polymerase See p. 25 Maxima Reverse Transcriptase See p. 58 Maxima Hot Start Taq DNA Polymerase See p. 26 RevertAid Premium Reverse Transcriptase See p. 60 DreamTaq DNA Polymerase See p. 28 Phusion Hot Start II DNA Polymerase See p. 23 Taq DNA Polymerase See p. 30 Molecular Weight Markers See p. 72-73 Molecular Weight Markers See p. 72-73 RiboLock RNase Inhibitor See p. 75 dNTP Mix, 10 mM each See p. 74 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 67 Description KIT www.thermoscientific.com/rt Description Thermo Scientific Verso 1-step RT-qPCR Kits for SYBR Green chemistry offer a quick and simple way to detect mRNA. The Verso RT enzyme delivers high processivity and can be used at temperatures up to 57°C, delivering effective transcription through difficult RNA secondary structures. An optional RT Enhancer is also provided and can be used during the RT step to remove any DNA contamination, eliminating the need for DNase I treatment. Thermo Scientific Verso 1-step RT-qPCR Kits for probe chemistry offer a quick and simple way to detect mRNA. The Verso RT enzyme delivers high processivity and can be used at temperatures up to 57°C, delivering effective transcription through difficult RNA secondary structures. An optional RT Enhancer is also provided and can be used during the RT step to remove any DNA contamination, eliminating the need for DNase I treatment. In a 1-step approach to RT-qPCR, both the RT step and qPCR steps are performed in a single tube (1-step RT-qPCR). Adopting a 1-step approach is ideal for primer sequence optimization and collecting comparative data in experiments that do not require subsequent cDNA storage. The approach minimizes the risk of contamination, and improvements in reproducibility may be observed as a result of reduced sample handling. Please note that random primers cannot be used during the RT step as this leads to non-specific amplification during qPCR. In a 1-step approach to RT-qPCR, both the RT step and qPCR steps are performed in a single tube (1-step RT-qPCR). Adopting a 1-step approach is ideal when no cDNA storage is necessary for subsequent experiments. The approach minimizes the risk of contamination, and improves reproducibility by reducing sample handling. Ordering Information Verso 1-Step RT-qPCR SYBR Green Mix + ROX Vial AB-4104/A 200 x 25 µl rxns AB-4104/C 400 x 25 µl rxns Verso 1-Step RT-qPCR SYBR Green ROX Mix AB-4105/A 200 x 25 µl rxns Benefits • • • • • • Eliminate the need for DNase treatments – RT Enhancer (optional) prevents genomic DNA carry-over RT and qPCR steps performed in single sealed tube – convenience coupled with reduced contamination risk Use of the entire RT reaction as template for qPCR – improved detection of low copy number targets Verso RT enzyme is highly sensitive with broad dynamic range – accurate detection of RNA from 1 pg - 1 ug Verso RT enzyme has a wide working temperature range (42° - 57°C) – improved success with GC-rich and other difficult templates Contains an inert blue dye for ease of pipetting during reaction setup AB-4106/A 200 x 25 µl rxns AB-4106/C 400 x 25 µl rxns Verso 1-Step RT-qPCR SYBR Green Fluorescein Mix AB-4107/A 200 x 25 µl rxns • • • • • • AB-4100/A 200 x 25 µl rxns Benefits • • • • • Eliminate the need for DNase treatments – RT Enhancer (optional) prevents genomic DNA carry-over RT and PCR steps performed in single sealed tube – convenience coupled with reduced contamination risk Use of the entire RT reaction as template for qPCR – improved detection of low copy number targets Verso RT enzyme is highly sensitive with broad dynamic range – accurate detection of RNA from 1 pg - 1 ug Verso RT enzyme has a wide working temperature range (42° - 57°C) – improved success with GC-rich and other difficult templates Contains an inert blue dye for ease of pipetting during reaction set up AB-4100/C 400 x 25 µl rxns Verso 1-Step RT-qPCR ROX Kit AB-4101/A 200 x 25 µl rxns AB-4101/C 400 x 25 µl rxns Verso 1-Step RT-qPCR Low ROX Kit AB-4102/A 200 x 25 µl rxns AB-4102/C 400 x 25 µl rxns Gene Expression Analysis RNAi validation Microarray validation Pathogen detection Genetic testing Disease research Applications • • • • • • AB-4107/C 400 x 25 µl rxns Product contents Store at -20°C. Avoid freeze/thaw cycles. Protect from light. Ordering Information Verso 1-Step RT-qPCR Kit plus ROX vial • Applications KIT www.thermoscientific.com/rt Verso 1-step RT-qPCR kits for probe chemistry are compatible with all standard probe chemistries including Solaris qPCR Gene Expression Assays. Please note that random primers cannot be used during the RT step as this leads to non-specific amplification during qPCR. AB-4105/C 400 x 25 µl rxns Verso 1-Step RT-qPCR SYBR Green Low ROX Mix Verso 1-Step RT-qPCR Kits for probe chemistry RT-PCR and RT-qPCR RT-PCR and RT-qPCR Verso 1-Step RT-qPCR Kits for SYBR Green chemistry Verso Enzyme Mix, 1-step qPCR SYBR Mix (includes Thermo-Start Taq DNA Polymerase, RT buffer, PCR buffer containing SYBR Green, dNTPs, MgCl2, inert blue dye and ROX reference dye where not provided as separate vial), RT Enhancer and MgCl2. Gene Expression Analysis RNAi validation Microarray validation Pathogen detection Genetic testing Disease research Store at -20°C. Avoid freeze/thaw cycles. Protect from light. Product contents Verso RT Enzyme Mix, 1-Step qPCR Mix (includes Thermo-Start Taq DNA Polymerase, RT buffer, PCR buffer, dNTPs, MgCl2, inert blue dye and ROX reference dye where not provided as separate vial) and RT Enhancer. RT Enhancer degrades genomic DNA, eliminating the need for separate DNase treatment The RT Enhancer, which is included in all Verso kits, is a unique enzyme that degrades contaminating genomic DNA at the start of the RT step. It is equally as effective as DNase I treatment but more convenient as it eliminates the need for a separate DNase I incubation prior to RT-qPCR. Figure demonstrates equal DNA degradation with RT enhancer and DNase I treatment. M 68 1 2 3 4 M Genomic DNA treated with: 1 – (No treatment) 2 – RT Enhancer 3 – (No treatment) 4 – DNase treatment M – DNA Marker Related products Related products Maxima First Strand cDNA Synthesis Kit See p.59 Maxima First Strand cDNA Synthesis Kit See p. 59 RevertAid First Strand cDNA Synthesis Kit See p. 65 Solaris qPCR Gene Expression Assays See p. 44 DyNAmo Flash and ColorFlash SYBR Green Kits See pp 47-48 for probe kits and 51-52 for SYBR kits. DyNAmo Flash and ColorFlash Probe Kits See pp. 47-48 for probe kits and 51-52 for SYBR kits. Maxima SYBR Green Master Mixes See p. 53 Maxima Probe qPCR Master Mixes See p. 49 www.thermoscientific.com/pcr E Enzyme Master Mix KIT Kit Added color www.thermoscientific.com/pcr 69 Description B Bar Heading DyNAmo cDNA ctrl shift alt 4 Synthesis Kit heading Thermo Scientific DyNAmo cDNA Synthesis Kit is designed for cDNA synthesis for 2-step quantitative reverse transcription-PCR (RT-qPCR) applications, where amplicons are usually around 100 bp in length. PCR Buffers Ordering Information DyNAmo cDNA Synthesis Kit F-470S 20 x 20 µl rxns F-470L 100 x 20 µl rxns Buffers for Phusion DNA Polymerases Phusion HF Buffer Pack: 1x buffer contains 1.5 mM MgCl2 RT-PCR and RT-qPCR F-518S 2 x 1.5 ml of 5x Phusion HF Buffer 1 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO F-518L 4 x 1.5 ml of 5x Phusion HF Buffer 2 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO ACCESSORY PRODUCTS The DyNAmo cDNA Synthesis Kit includes all necessary reagents for cDNA synthesis to be used in qPCR. Either total RNA, messenger RNA, viral RNA or in vitro transcribed RNA can be used as a template for reverse transcription. The kit includes both random primers and oligo(dT)15 primers. The user can choose either of these or alternatively use gene-specific primers.The reverse transcriptase in the kit is M-MuLV RNase H+. Store at -20°C. Phusion GC Buffer Pack: 1x buffer contains 1.5 mM MgCl2 F-519S 2 x 1.5 ml of 5x Phusion GC Buffer 1 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO F-519L 4 x 1.5 ml of 5x Phusion GC Buffer 2 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO Phusion HF Buffer Pack, Detergent-free: 1x buffer contains 1.5 mM MgCl2 F-520S 2 x 1.5 ml of Detergent-free 5x Phusion HF Buffer 1 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO F-520L 4 x 1.5 ml of Detergent-free 5x Phusion HF Buffer 2 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO Phusion GC Buffer Pack, Detergent-free: 1x buffer contains 1.5 mM MgCl2 F-521S 2 x 1.5 ml of Detergent-free 5x Phusion GC Buffer 1 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO F-521L 4 x 1.5 ml of Detergent-free 5x Phusion GC Buffer 2 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO Buffers for Phire DNA Polymerase Description DyNAmo SYBR Green 2-Step RT-qPCR Kit Thermo Scientific DyNAmo SYBR Green 2-Step RT-qPCR Kit includes all the necessary reagents for cDNA synthesis and SYBR Green qPCR. The reverse transcriptase in the kits is M-MuLV RNase H+, which provides higher sensitivity for qPCR than RNase H- reverse transcriptases. The RNase H activity in the RT enzyme facilitates annealing of PCR primers to the cDNA by degrading the RNA template from the RNA-cDNA hybrid before the PCR step. The performance of the qPCR step is based on a hot start version of a modified Thermus brockianus (Tbr) DNA polymerase. Store at -20°C. Phire Reaction Buffer: 1x buffer contains 1.5 mM MgCl2 Ordering Information DyNAmo SYBR Green 2-Step RT-qPCR Kit F-430L 100 RT reactions (20 µl each) and 200 qPCR reactions (50 µl each) F-524S 2 x 1.5 ml of 5x Phire Reaction Buffer 1 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO F-524L 4 x 1.5 ml of 5x Phire Reaction Buffer 2 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO Phire Reaction Buffer, Detergent-free: 1x buffer contains 1.5 mM MgCl2 F-525S 2 x 1.5 ml of Detergent-free 5x Phire Reaction Buffer 1 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO F-525L 4 x 1.5 ml of Detergent-free 5x Phire Reaction Buffer 2 x 1.5 ml of 50 mM MgCl2 solution 1 x 0.5 ml of 100% DMSO Buffers for DreamTaq and Taq DNA Polymerases 10x DreamTaq Buffer: Proprietary composition, contains 20 mM MgCl2 B65 4 x 1.25 ml of 10x DreamTaq Buffer 10x Taq Buffer with KCl: 100 mM Tris-HCl (pH 8.8 at 25°C), 500 mM KCl, 0.8% (v/v) Nonidet P40. Does not contain MgCl2 B38 4 x 1.25 ml of 10x Taq Buffer with KCl 10x Taq Buffer with KCl and 15 mM MgCl2: 100 mM Tris-HCl (pH 8.8 at 25°C), 500 mM KCl, 0.8% (v/v) Nonidet P40, 15 mM MgCl2 B16 4 x 1.25 ml of 10x Taq Buffer with KCl and 15 mM MgCl2 10x Taq Buffer with (NH4)2SO4: 750 mM Tris-HCl (pH 8.8 at 25°C), 200 mM (NH4)2SO4, 0.1% (v/v) Tween 20 Description Verso cDNA Synthesis Kit Thermo Scientific Verso cDNA Synthesis Kit is designed for robust transcription of RNA to create a complete cDNA pool. Store at -20°C. Ordering Information B33 4 x 1.25 ml of 10X Taq Buffer with (NH4)2SO4 10x Taq Buffer with (NH4)2SO4 and 20 mM MgCl2: 750 mM Tris-HCl (pH 8.8 at 25°C), 200 mM (NH4)2SO4, 0.1% (v/v) Tween 20, 20 mM MgCl2 Verso cDNA Synthesis Kit AB-1453/A Verso cDNA Synthesis Kit 40 x 20 µl rxns AB-1453/B Verso cDNA Synthesis Kit 100 x 20 µl rxns B34 4 x 1.25 ml of 10x Taq Buffer with (NH4)2SO4 and 20 mM MgCl2 10x Taq Buffer without Detergent: 100 mM Tris-HCl (pH 8.8 at 25°C), 500 mM KCl B55 4 x 1.25 ml of 10x Taq Buffer without Detergent Buffers for DyNAzyme DNA Polymerases Optimized DyNAzyme EXT Buffer, Detergent-free: 1x buffer contains: 50 mM Tris-HCl (pH 9.0 at 25°C), 1.5 mM MgCl2 and 15 mM (NH4)2SO4 F-517S 2 x 1.5 ml of 10x Optimized Detergent-free DyNAzyme EXT Buffer F-517L 4 x 1.5 ml of 10x Optimized Detergent-free DyNAzyme EXT Buffer Mg2+-free DyNAzyme Buffer and 50 mM MgCl2 Solution: 1x buffer contains: 10 mM Tris-HCl (pH 8.8 at 25°C), 50 mM KCl and 0.1% Triton® X-100 F-510S 2 x 1.5 ml of Mg2+-free 10x DyNAzyme Buffer 1 x 1.5 ml of 50 mM MgCl2 solution F-510L 4 x 1.5 ml of Mg2+-free 10x DyNAzyme Buffer 2 x 1.5 ml of 50 mM MgCl2 solution Optimized DyNAzyme Buffer: 1x buffer contains: 10 mM Tris-HCl (pH 8.8 at 25°C), 1.5 mM MgCl2, 50 mM KCl and 0.1% Triton® X-100 F-511S 2 x 1.5 ml of 10x Optimized DyNAzyme Buffer F-511L 4 x 1.5 ml of 10x Optimized DyNAzyme Buffer Optimized DyNAzyme Buffer, Detergent-free: 1x buffer contains: 10 mM Tris-HCl (pH 8.8 at 25°C), 1.5 mM MgCl2 and 50 mM KCl 70 www.thermoscientific.com/pcr F-516S 2 x 1.5 ml of 10x Optimized Detergent-free DyNAzyme Buffer F-516L 4 x 1.5 ml of 10x Optimized Detergent-free DyNAzyme Buffer www.thermoscientific.com/pcr 71 Store at room temperature or at 4°C for periods up to 6 months. For longer periods Store at -20°C. Benefits • • • • • • Fast separation (8-14 min) Short separation distance (10-20 mm) Sharp bands Easy-to-remember fragment sizes and quantities Ready‑to‑use – pre-mixed with loading dye Supplied with loading dye solution for sample DNA Benefits • • • Product contents • • Storage and Loading Buffer: 10 mM Tris-HCl (pH 7.6), 10 mM EDTA, 0.005% bromophenol blue, 10% glycerol. Storage and Loading Buffer for FastRuler Ultra Low Range DNA Ladder: 10 mM Tris-HCl (pH 7.6), 10 mM EDTA, 0.025% orange G, 0.005% xylene cyanol FF, 10% glycerol. 6x MassRuler DNA Loading Dye: 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 60% glycerol and 60 mM EDTA. 6x Orange DNA Loading Dye: 10 mM Tris-HCl (pH 7.6), 0.15% orange G, 0.03% xylene cyanol FF, 60% glycerol and 60 mM EDTA. FastRuler Low/Middle/High Range DNA Ladders are supplied with 6x MassRuler DNA Loading Dyes. FastRuler Ultra Low Range DNA Ladder is supplied with 6x Orange DNA Loading Dye. • 1. ng/20 µl ng/15 µl ng/10 µlng/5 µl ng/3 µl 200 100 50 20 10 80 80 80 80 124 60 60 60 60 93 40 40 40 40 62 20 20 20 20 31 bp ng/20 µl ng/15 µl ng/10 µl ng/5 µl ng/3 µl 1500 80 60 40 20 12 850 80 60 40 20 12 400 80 60 40 20 12 200 80 60 40 20 12 50 80 60 40 20 12 12 12 12 12 19 4% TopVision™ Agarose (#R0491) 20 µl/lane, 1X TBE, 7 V/cm, 14 min 2% TopVision™ Agarose (#R0491) 20 µl/lane, 1X TBE, 7 V/cm, 14 min FastRuler Ultra Low Range DNA Ladder, ready‑to‑use #SM1233 bp ng/20 µl 5000 2000 80 80 FastRuler Low Range DNA Ladder, ready‑to‑use #SM1103 bp ng/15µl ng/10 µl ng/5 µl ng/3 µl 60 60 40 40 20 20 12 12 850 80 60 40 400 80 60 40 100 80 60 40 1% TopVision™ Agarose (#R0491) 20 µl/lane, 1X TAE, 7 V/cm, 14 min 20 20 20 12 12 12 FastRuler Middle Range DNA Ladder, ready‑to‑use #SM1113 10000 4000 2000 1000 500 ng/20 µl ng/15 µl ng/10 µl ng/5 µl ng/3 µl 80 80 80 80 80 72 Cat. # Concentration ng/µl FastRuler Ultra Low Range DNA Ladder SM1233 22.2 FastRuler Low Range DNA Ladder SM1103 20 FastRuler Middle Range DNA Ladder SM1113 20 FastRuler High Range DNA Ladder SM1123 20 www.thermoscientific.com/pcr Volume Applications Loading µl µl/lane 50-333 3-20 40 40 40 40 40 20 20 20 20 20 1% TopVision Agarose (#R0491) 20 µl/lane, 1X TAE, 7 V/cm, 14 min FastRuler High Range DNA Ladder, ready‑to‑use #SM1123 Range bp Number of fragments 10-200 2x500 60 60 60 60 60 ™ Ordering Information DNA ladder, ready‑to‑use 1% TopVision™ Agarose (#R0491) bp 50-1,500 100-5,000 500-10,000 Agarose % 4.0 5 2.0 1.0 1.0 12 12 12 12 12 Ordering Information See below for details Store at room temperature or at 4°C for periods up to 6 months. For longer periods Store at -20°C. Product contents Ideal for both DNA sizing and approximate quantification Sharp bands Assembled from chromatography purified individual DNA fragments Bright reference bands Ready‑to‑use ladders can be directly loaded and are stable at room temperature for 6 months Supplied with loading dye for sample DNA bp ng/0.5 µg % 5000 40.0 8.0 3000 40.0 8.0 2000 40.0 1500 100.0 8.0 20.0 1000 750 40.0 40.0 8.0 8.0 500 100.0 20.0 300 50.0 10.0 100 50.0 10.0 0.5 µg/lane, 8 cm length gel, 1X TAE, 7 V/cm, 40 min 2. bp ng/0.5 µg % 20000 10000 7000 5000 4000 3000 20.0 20.0 20.0 75.0 20.0 20.0 4.0 4.0 4.0 15.0 4.0 4.0 2000 1500 20.0 80.0 4.0 16.0 1000 700 500 400 300 200 75 25.0 25.0 75.0 25.0 25.0 25.0 25.0 5.0 5.0 15.0 5.0 5.0 5.0 5.0 0.5 µg/lane, 8 cm length gel, 1X TAE, 7 V/cm, 45 min Each GeneRuler DNA ladder is available in two formats 1. GeneRuler Express DNA Ladder and O’GeneRuler Express DNA Ladder, ready-to-use 2. GeneRuler 1 kb Plus DNA Ladder and O’GeneRuler 1 kb Plus DNA Ladder, ready-to-use 3. GeneRuler 100 bp Plus DNA Ladder and O’GeneRuler 100 bp Plus DNA Ladder, ready-to-use 4. GeneRuler 50 bp DNA Ladder and O’GeneRuler 50 bp DNA Ladder, readyto-use GeneRuler DNA Ladders are supplied with 6x DNA Loading Dye. O’GeneRuler DNA Ladders are supplied with 6x Orange DNA Loading Dye. Storage Buffer (TE buffer): 10 mM Tris-HCl (pH 7.6) and 1 mM EDTA. 6x DNA Loading Dye: 10 mM Tris-HCl (pH 7.6), 0.03% bromophenol blue, 0.03% xylene cyanol FF, 60% glycerol and 60 mM EDTA. 6x Orange Loading Dye: 10 mM Tris-HCl (pH 7.6), 0.15% orange G, 0.03% xylene cyanol FF, 60% glycerol and 60 mM EDTA. 3. 1.7% TopVision™ Agarose (#R0491) See below for details 1% TopVision™ Agarose (#R0491) Ordering Information GeneRuler Bar Heading and ctrl shift alt 4DNA O’GeneRuler heading Ladders bp ng/0.5 µg 3000 2000 1500 1200 1000 900 800 700 600 500 400 28.0 28.0 28.0 28.0 80.0 27.0 27.0 27.0 27.0 80.0 30.0 % 5.6 5.6 5.6 5.6 16.0 5.4 5.4 5.4 5.4 16.0 6.0 300 30.0 6.0 200 30.0 6.0 100 30.0 6.0 4. bp ng/0.5µg 0.5 µg/lane, 8 cm length gel, 1X TBE, 5 V/cm, 1 h ACCESSORY PRODUCTS ACCESSORY PRODUCTS FastRuler DNA Ladders, ready-to-use Description Thermo Scientific GeneRuler DNA ladders are mixtures of chromatography-purified individual DNA fragments. The GeneRuler line includes the most popular ladders such as the 100 bp and 1 kb DNA Ladder. GeneRuler DNA ladders are available in two formats: conventional (TE buffer) and a ready‑to‑use format (premixed with 6x DNA Loading Dye which contains bromophenol blue and xylene cyanol FF). Conventional versions can be labeled radioactively with T4 Polynucleotide Kinase (#EK0031). O’GeneRuler DNA ladders are another ready‑to‑use version of GeneRuler DNA ladders. They are pre-mixed with 6x Orange DNA Loading Dye, which contains xylene cyanol FF and orange G. In a 1% agarose gel orange G dye migrates at 50 bp, therefore O’GeneRuler DNA ladders are ideal when visualization of small DNA fragments is important. GeneRuler and O’GeneRuler Express DNA ladders are designed for fast separation (in 5-15 min at 23 V/cm) under a wide range of electrophoresis conditions, in different buffers, voltages or gel percentages. 2.5% TopVision™ Agarose (#R0491) Description Thermo Scientific FastRuler DNA ladders are specifically designed for fast sizing and quantification of double-stranded DNA in 48-well (or 96-well) high throughput gels, as well as in conventional agarose gels. These ladders are mixtures of five blunt-end chromatography-purified individual DNA fragments that are easily resolved in a short separation distance (10-20 mm) after an 8-14 minute run. The ladders are especially useful for electrophoresis of PCR products. FastRuler Ultra Low Range DNA Ladder, ready‑to‑use contains dephosphorylated DNA fragments and is ideal for 5’-end labeling with T4 Polynucleotide Kinase (#EK0031) in a forward reaction. % 1000 900 800 700 600 500 400 300 250 200 150 100 30.0 30.0 30.0 30.0 30.0 75.0 30.0 30.0 75.0 35.0 35.0 35.0 6.0 6.0 6.0 6.0 6.0 15.0 6.0 6.0 15.0 7.0 7.0 7.0 50 35.0 7.0 0.5 µg/lane, 8 cm length gel, 1X TBE, 5 V/cm, 1 h Ordering Information DNA ladder GeneRuler 1 kb Plus DNA Ladder GeneRuler 1 kb Plus DNA Ladder, ready-to-use O’GeneRuler 1 kb Plus DNA Ladder, ready-to-use GeneRuler 100 bp Plus DNA Ladder GeneRuler 100 bp Plus DNA Ladder, ready-to-use O’GeneRuler 100 bp Plus DNA Ladder, ready-to-use GeneRuler 50 bp DNA Ladder GeneRuler 50 bp DNA Ladder, ready-to-use O’GeneRuler 50 bp DNA Ladder, ready-to-use GeneRuler Express DNA Ladder GeneRuler Express DNA Ladder, ready-to-use O’GeneRuler Express DNA Ladder, ready-to-use Cat. # SM1331 SM1332 SM1333 SM1334 SM1343 SM0321 SM0322 SM0323 SM0324 SM1153 SM0371 SM0372 SM0373 SM1133 SM1551 SM1552 SM1553 SM1563 Concentration µg/µl Amount µg 250 (5x50) 1250 (25x50) 250 (5x50) 50 250 (5x50) Applications 0.5 µg/lane 500 2500 500 100 500 50 250 (5x50) 50 250 (5x50) 50 100 500 100 500 100 0.5 50 250 (5x50) 100 500 0.5 (1) 0.1 50 100 0.5 (5) 0.5 50 250 (5x50) 100 500 0.1 50 100 0.5 0.1 0.5 0.1 Loading µg (µl)/lane Range bp Number of fragments 75-20,000 15 100-3,000 14 50-1,000 13 0.5 (1) 0.5 (5) 0.5 (1) 0.5 (5) See p. xxx on how to order 0.5 (1) 100-5,000 9 0.5 (5) www.thermoscientific.com/pcr 73 Description Ordering Information dNTP Set, 100 mM Solutions R0181 4 x 0.25 ml R0182 4 x 1 ml R0186 4 x 5 ml Description Thermo Scientific PureExtreme dNTPs are supplied in aqueous solutions titrated to pH 7.0 with NaOH. Thermo Fisher Scientific is one of a few primary manufacturers of nucleotides in the industry. Benefits • • • Benefits Greater than 99% purity confirmed by HPLC Free of human and E. coli DNA Highly stable – the neutral pH of nucleotide solutions ensures the stability during long-term storage Application dNTPs, 100 mM Solutions R0141 0.25 ml dATP R0151 0.25 ml dCTP R0161 0.25 ml dGTP R0171 0.25 ml dTTP R0133 0.25 ml dUTP • • • • • 1 ml R0242 5 x 1 ml Long range PCR (40 kb) cDNA synthesis and RT-PCR Real-time PCR Standard PCR High-fidelity PCR R0191 0.2 ml R0192 1 ml R0193 5 x 1 ml dGTP 99.56% purity dATP 99.40% purity 8.50 8.79 dTTP 99.44% purity dCTP 99.52% purity Active in Thermo Scientific buffers for restriction enzymes and thermophilic polymerases Applications • • • • • • • dNTP Set components: 100 mM dATP, 100 mM dCTP, 100 mM dGTP, 100 mM dTTP. dNTPs contain: 100 mM appropriate dNTP solution. dNTP Mixes contain: 2mM/10mM/25mM of each dATP, dCTP, dGTP, dTTP. dNTP/dUTP Mix contains: 2 mM of each dATP, dCTP, dGTP and 4 mM of dUTP. 8.99 10.83 dNTP Mix, 10 mM each • Product contents dNTP Mix, 2 mM each R0241 Thermo Scientific Uracil-DNA Glycosylase (UDG, UNG) catalyzes the hydrolysis of the N-glycosylic bond between uracil and sugar, leaving an apyrimidinic site in uracil-containing single or double-stranded DNA. Shows no activity on RNA. Control of carry-over contamination in PCR Glycosylase mediated single nucleotide polymorphism detection (GMPD) Site-directed mutagenesis As a probe for protein-DNA interaction studies SNP genotyping Cloning of PCR products Generation of single-strand overhangs of PCR products and cDNA Uracil-DNA Bar Heading ctrl shift alt 4 Glycosylase heading (UDG, UNG) Ordering Information Uracil-DNA Glycosylase EN0361 200 U (1 U/µl) EN0362 5 x 200 U (1 U/µl) Store at -20°C. Product contents Uracil-DNA Glycosylase (UDG, UNG) is supplied with: 10x Reaction Buffer. Storage buffer: 30 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.05% (v/v) Tween 20 and 50% (v/v) glycerol. 10x Reaction Buffer: 200 mM Tris-HCl (pH 8.2 at 25°C), 10 mM EDTA, 100 mM NaCl. Notice: use of this enzyme in certain applications may be covered by patents and may require a license. ACCESSORY PRODUCTS ACCESSORY PRODUCTS B Bar Heading Deoxyribonucleotide ctrl shift alt 4 Triphosphates (dNTPs) heading dNTP Mix, 25 mM each R1121 1 ml R1122 5 x 1 ml Description Thermo Scientific RiboLock RNase Inhibitor inhibits the activity of RNases A, B and C by binding them in a noncompetitive mode at a 1:1 ratio. It does not inhibit eukaryotic RNases T1, T2, U1, U2, CL3, or prokaryotic RNases I and H. dNTP/dUTP Mix R0251 1ml Store at -20°C. 10.25 8.48 8.20 Benefits 7.38 • • PureExtreme dNTPs are greater than 99% pure by HPLC Column: TOSOH TSK gel ODS-100V, 150x4.6 mm. Buffer A: 100 mM triethylamonium acetate, pH 7.0 Buffer B: 60% acetonitrile/A, Gradient: 0-25% B, Flow rate: 1 ml/min Applications • dCTP www.thermoscientific.com/pcr Performs under a wide range of reaction conditions Protects RNA from degradation at temperatures up to 55°C Ordering Information RiboLock RNase Inhibitor Formula C 9H13N 3O13P 3Na 3 Molecular Weight 533.1 (acid form: 467.1) 74 RiboLock RNase Inhibitor dATP dGTP Formula C10H13N5O12P 3Na 3 Molecular Weight 557.2 (acid form: 491.2) Formula C10H13N5O13P 3Na 3 Molecular Weight 573.2 (acid form: 507.2) • • • Inhibition of RNA degradation in the following: - In vitro transcription - cDNA synthesis - In vitro translation - Isolation of mammalian cell fractions that contain mRNA-protein complex - RNA amplification RNA purification and storage Separation and identification of specific ribonuclease activities Studies of tumor suppression EO0381 2500 U (40 U/µl) EO0382 4 x 2500 U (40 U/µl) EO0384 24 x 2500 U (40 U/µl) Store at -20°C. Product contents RiboLock RNase Inhibitor is supplied in storage buffer: 20 mM HEPES-NaOH (pH 7.5), 50 mM NaCl, 8 mM DTT, 0.5 mM ELUGENT Detergent and 50% (v/v) glycerol. dTTP dUTP Formula C10H14N2O14P 3Na 3 Molecular Weight 548.1 (acid form: 482.1) Formula C 9H12N2O14P 3Na 3 Molecular Weight 534.1 (acid form: 468.1) www.thermoscientific.com/pcr 75 Description Deionized and 0.22 µm membrane-filtered nuclease-free water. Ideal for all molecular biology applications. Store at -20°C. Description B Bar Heading ctrl shift MgCl 25alt mM 4 2’ heading An aqueous solution of 0.22 µm membrane-filtered magnesium chloride, used for optimization of magnesium ion concentration in PCR. Store at -20°C. B Bar Heading ctrl Oligo(dT) shift alt Primer 4 18 heading Thermo Scientific Oligo(dT)18 Primer is a synthetic single-stranded 18-mer oligonucleotide with 5’- and 3’-hydroxyl ends. The primer is supplied as a ready-to-use, 20x concentrated aqueous solution. Ideal for first strand cDNA synthesis. Store at -20°C. B Bar Heading Random Hexamer ctrl shift alt 4 Primer heading Thermo Scientific Random Hexamer Primer is a mixture of single-stranded random hexanucleotides with 5’- and 3’-hydroxyl ends. The primer is supplied as a ready-to-use, 20x concentrated aqueous solution. Ideal for first strand cDNA synthesis. Store at -20°C. Description Description 76 www.thermoscientific.com/pcr Ordering Information Water, nuclease-free R0581 4 x 1.25 ml R0582 30 ml Description Thermo Scientific Direct PCR enables PCR directly from source materials without prior DNA purification. The best results are obtained by using a very small amount of sample as starting material. The Harris Uni-Core is a convenient tool for cutting very small punch discs from materials such as animal tissue, plant leaves or Whatman FTA or Whatman 903 cards for Direct PCR. A compatible Harris Cutting Mat is used to provide an even cutting surface for the Harris Uni-Core. Ordering Information F-185S Harris Uni-Core 0.50 mm (blue) bag of 5 F-185L Harris Uni-Core 0.50 mm (blue) box of 25 F-180S Harris Uni-Core 0.35 mm (pink) bag of 5 F-180L Harris Uni-Core 0.35 mm (pink) box of 25 F-190S Harris Cutting Mat 6.4 x 7.6 cm bag of 5 Bar Heading Harris Uni-Core and ctrl shiftMat alt 4for Cutting heading Direct PCR PCR ACCESSORY PRODUCTS ACCESSORY PRODUCTS PCR B Bar Heading Water, ctrl shift alt 4 nuclease-free heading Ordering Information 25 mM MgCl2 R0971 4 x 1.25 ml Ordering Information Oligo(dT)18 Primer SO131 60 µl SO132 120 µl Ordering Information Random Hexamer Primer SO142 120 µl www.thermoscientific.com/pcr 77 Protocols and Recommendations: PCR One of the most popular and efficient methods for prevention of carryover contamination is to use uracil DNA glycosylase* (UDG or UNG) in the PCR reaction1. A part or all of the dTTP in the PCR reaction is substituted by dUTP and therefore all PCR products generated contain dUTP. Prior to each PCR, a short incubation with UDG degrades such contaminating amplicons carried over from the previous PCR. Incorporation of dUTP does not affect the intensity of ethidium bromide staining or the electrophoretic mobility of the PCR product, therefore the reactions can be analyzed by standard agarose gel electrophoresis. Taq DNA polymerase will incorporate dUTP into a PCR product, but other polymerases or enzyme mixes (e.g, DreamTaq DNA Polymerase (#EP071), Phusion High-Fidelity DNA Polymerase (#F-530), or the Long PCR Enzyme Mix (#K0181), do not incorporate dUTP or may incorporate with much lower efficiency. * The use of UDG in certain territories may be covered by patents and require a license. • • • If the primer contains more than 25 nucleotides specialized computer programs e.g, REviewer (www.thermoscientific. com/reviewer) are recommended to account for interactions of adjacent bases, effect of salt concentration, etc. For calculation of primer melting temperature only, consider nucleotides homologous to the template. Optimal annealing temperature for Phusion DNA Polymerases may differ significantly from that of Taq based polymerases. Always use the Tm calculator and instructions at www.thermoscientific.com/pcrwebtools to determine the Tm values of primers and optimal annealing temperature. Considerations for Subsequent Cloning of PCR Products: • When introducing restriction endonuclease sites into primers for subsequent digestion and cloning of a PCR product, extra bases are required for efficient cleavage by restriction enzymes. Refer to www.thermoscientific.com/fermentas where you can find more information about the use of conventional restriction enzymes and new FastDigest Restiction Enzymes. Thermo Scientific DNA Polymerases and cloning Phusion DNA polymerases have an extremely low error rate, which makes them the ideal choice for cloning. We strongly recommend Phusion DNA polymerases for all cloning applications. Below, you can find information about cloning PCR products amplified with Phusion. However, if you are cloning PCR products amplified with other Thermo Scientific DNA polymerases, you need to consider that different DNA polymerases create different types of ends in the PCR products, which affects the subsequent cloning procedure. Additional information can be found below. PCR product ends Suitability for cloning Phusion Hot Start II High-Fidelity DNA Polymerase blunt *** Phusion High-Fidelity DNA Polymerase blunt *** Phusion Flash High-Fidelity DNA Polymerase blunt *** Phire Hot Start II DNA Polymerase blunt * blunt/A-overhang * Maxima Hot Start Taq DNA Polymerase A-overhang * DreamTaq DNA Polymerase A-overhang * Taq DNA Polymerase A-overhang * Long PCR Enzyme Mix Guidelines for Primer Design Use the REviewer primer design software at www.thermoscientific. com/reviewer or follow general recommendations for PCR primer design below: • PCR primers are generally 15-30 nucleotides long. • Optimal GC content of the primer is 40-60%. Ideally, C and G nucleotides should be distributed uniformly along the primer. • To lower the risk of nonspecific priming, avoid placing more than three G or C nucleotides at the 3’-end of the primer. • Avoid primer self-complementarities, complementarities between the primers and direct repeats in a primer to prevent hairpin formation and primer dimerization. • Check for possible complementary sites between primers and template DNA. • When designing degenerate primers, place at least 3 conservative nucleotides at the 3’-end. • Differences in the melting temperature (Tm) of the two primers should not exceed 5°C for conventional PCR. Estimation of Primer Melting Temperature: • For primers containing less than 25 nucleotides, the approx. melting temperature (Tm) can be calculated using the following equation: Tm = 4 (G + C) + 2 (A + T), where G, C, A, T = number of respective nucleotides in the primer. 78 www.thermoscientific.com/pcr Phusion DNA polymerases – the best choice for high-fidelity cloning Phusion DNA Polymerases create blunt end DNA products. When cloning fragments amplified with Phusion DNA Polymerases, blunt end cloning is recommended. If TA cloning is required, it can be performed by adding 3’-dA overhangs to the blunt PCR product with a different polymerase (e.g., Taq DNA Polymerase). Protocol for adding 3’-dA-overhangs (TA cloning) 1. Purify the PCR product (e.g., with a PCR purification kit or phenol extraction and DNA precipitation). Before adding the overhangs it is very important to remove all the Phusion DNA Polymerase by purifying the PCR product carefully, as the proofreading activity in Phusion DNA Polymerase is very strong. Any remaining Phusion DNA Polymerase will degrade the A overhangs, thus creating blunt ends again. 2. dA-addition with Taq DNA polymerase. Reaction components: Purified PCR product , 0.2 mM dATP, 1x Taq Buffer and 1 U Taq DNA Polymerase. Incubate 20 min at 72°C. 3. Proceed to TA cloning. For optimal ligation efficiency, we recommend using fresh PCR products, since 3’-dA-overhangs will gradually be lost during storage. Guidelines to avoid RNase contamination Before starting the RT-PCR assay please read the protocols and recommendations for PCR. RNA purity and integrity is essential for synthesis of full-length cDNA. The RNA quality can be affected by RNase A, which is a highly stable contaminant commonly found in the laboratory environment. RNase contamination is always a concern when working with RNA. All Thermo Scientific products used in reverse transcription reactions (enzymes, buffers, water, nucleotides and oligonucleotides) have been functionally tested to be ribonuclease free. To prevent contamination of the reaction components, both the laboratory environment and all home-made solutions must be free of RNases. General recommendations to avoid RNase contamination: • DEPC-treat all tubes and pipette tips to be used in cDNA synthesis or use certified nuclease-free labware. • Use pipettes dedicated for RNA work. • Wear gloves when handling RNA and all reagents, as skin is a common source of RNases. Change gloves frequently. • Use certified reagents, including high quality water (e.g., DEPCtreated Water). • Use an RNase inhibitor, such as RiboLock RNase Inhibitor (#EO0381) to stabilize RNA. • Always assess the integrity of RNA prior to cDNA synthesis. For example, if sharp bands of both the human 18S rRNA (runs at approx. 1.9 kb) and the 28S rRNA (runs at approx. 5 kb) are formed during denaturing agarose gel electrophoresis of total RNA, the mRNA in the sample is considered to be intact. Components of the RT reaction mixture Template RNA Total cellular RNA isolated by standard methods can be successfully used with Thermo Scientific reverse transcriptases or kits for first strand cDNA synthesis. The purified RNA must be free of salts, metal ions, ethanol, and phenol to avoid inhibition during the reverse transcription reaction. The template RNA for RT-PCR should also be free of genomic DNA contamination to avoid false-positive PCR or qPCR. It is recommended to use DNase I, RNase-free (#EN0521), to remove trace amounts of genomic DNA from RNA preparations. Always perform a control RT-PCR reaction with an RNA template that has not been transcribed with reverse transcriptase. Removal of Genomic DNA from RNA preparations: 1. Add to an RNase-free tube: RNA 1-2 μg 10x reaction buffer with MgCl2 1 μl DNase I, RNase-free (#EN0521) 1-2 μl (1-2 U) DEPC-treated Water to 9 μl Total volume 10 μl 2. Incubate 30 min at 37°C. 3. Add 1 μl of 50 mM EDTA and incubate 10 min at 65°C. RNA hydrolyzes if heated in the absence of a chelating agent2. Alternatively, use phenol/chloroform extraction. 4. Use the prepared RNA as a template for reverse transcription. Note • • • Do not use more than 1 U of DNase I per μg of RNA. Reaction mixture can be scaled up for larger amounts of RNA. The recommended final concentration of RNA is 0.1-0.2 μg/μl. RiboLock RNase Inhibitor (#EO0381), typically at 1 U/μl, can also be included in the reaction mixture to inactivate type A RNases potentially present in the initial RNA solution. Primers Synthesis of first strand cDNA can be primed with either oligo(dT)18, random primers or gene-specific primers. Oligo(dT)18 primes cDNA synthesis from the poly(A) tail present at the 3’-end of eukaryotic mRNA. Random primers, e.g., hexamers, initiate cDNA synthesis from all RNA species (rRNA and mRNA) present in total RNA samples. This results in greater complexity of the resulting cDNA than using just the oligo(dT)18 primer and may reduce sensitivity and/or specificity of the subsequent PCR reaction. However, there are situations where random primers are preferred, such as cDNA synthesis using eukaryotic mRNAs without a poly(A) tail, or cDNA synthesis using a poly(A)-enriched RNA sample as well as RT-PCR of 5’ regions of long mRNAs. Gene-specific primers provide the greatest specificity for cDNA synthesis; such primers must be obtained by the user. Enzymes All Thermo Scientific RT enzymes are suitable for the synthesis of full-length first strand cDNA, but they differ in reaction temperatures, amounts of RNA transcribed, sensitivity and RNase H activity. See the RT Enzyme Selection table on p. 56 for the reaction conditions recommended for each enzyme. PROTOCOLS AND TECHNICAL GUIDELINES PROTOCOLS AND TECHNICAL GUIDELINES Guidelines for Preventing Contamination of PCR During PCR more than 10 million copies from the template DNA are generated. Care must be taken to avoid contamination with other templates and amplicons that may be present in the laboratory environment. General recommendations to lower the risk of contamination are the following: • Prepare your DNA sample, set up the PCR mixture, perform thermal cycling and analyze PCR products in separate areas. • Set up mixtures for PCR in a laminar flow cabinet equipped with a UV lamp. • Wear fresh gloves for DNA purification and reaction set up. • Use containers dedicated for PCR. Use positive displacement pipettes, or use pipette tips with aerosol filters to prepare DNA samples and setup PCR. • Use certified reagents, including high quality water (e.g., Water, nuclease-free, #R0581). • Always perform No Template Control (NTC) reactions to check for the absence of contamination. Protocols and Recommendations: RT-PCR First Strand cDNA synthesis The protocol listed below is for first strand cDNA synthesis using the RevertAid H Minus Reverse Transcriptase. For specific reaction conditions using other enzymes, see the RT Enzyme Selection table on p. 56. Master Mix In order to prepare several parallel reactions and to minimize the possibility of pipetting errors and contamination, prepare an RT master mix by adding all reaction components except for the RNA and the primer into one vial. Prepare enough master mix for the number of reactions and add one extra to compensate for pipetting errors. Pipette the template RNA into individual tubes and keep on ice. Aliquot the prepared master mix into the tubes with RNA. Mix and briefly centrifuge all components after thawing; keep on ice. 1. Add to sterile, nuclease-free tubes on ice in the indicated order: Template RNA total RNA or poly(A) RNA or specific RNA 0.1 ng - 5 μg 10-500 ng 0.01 pg - 0.5 μg Primer Oligo(dT)18 (#SO131) or Random hexamer (#SO142) or Gene-specific 0.5 μg (100 pmol) 0.2 μg (100 pmol) 15-20 pmol DEPC-treated Water (#R0601) to 12.5 μl Total volume 12.5 μl www.thermoscientific.com/pcr 79 80 5x reaction buffer 4 μl RiboLock RNase Inhibitor (#EO0381) 0.5 μl (20 U) dNTP Mix, 10 mM each (#R0191) 2 μl (1 mM final concentration) RevertAid H Minus Reverse Transcriptase (#EP0451) 1 μl (200 U) Total volume 20 μl Note • • PCR and RT-PCR Troubleshooting Guide The reverse transcription reaction product can be directly used in PCR or stored at -20°C. Use 2 μl of the reaction mix to perform PCR in 50 μl of reaction volume. References 1. Longo MC et al. “Use of uracil DNA glycosylase to control carry-over contamination in Polymerase Chain Reactions.” Gene 93:125-8 (1990). 2. Wiame I et al. “Irreversible heat activation of DNaseI without RNA degradation.” BioTechniques 29:252-256 (2000). 4. Mix gently and centrifuge briefly. 5. If the oligo(dT)18 primer or a gene-specific primer is used, incubate 60 min at 42°C. If random hexamer primers are used, incubate 10 min at 25°C followed by 60 min at 42°C. For transcription of GC-rich RNA, reaction temperature can be increased to 45°C. 6. Terminate the reaction by heating at 70°C for 5 min. PCR or RT-PCR problem 1 Low yield or no PCR/RT-PCR product 2 Non-specific PCR products 3 Sequence errors in PCR product 4 PCR/RT-PCR product in ne- gative control 5 Inefficient PCR cloning 1.1 Low template quality or quantity 2.1 Incorrect primer design 3.1 Sequence errors within a PCR product 3.2 Sequence errors at PCR product termini 4.1 Cross-over contamination 5.1 Incorrect choice of polymerase 1.2 Incorrect primer design 2.2 Reaction set up at room temperature 3.1.1 Low fidelity polymerase 3.2.1 Faulty primer design 4.2 Carry-over contamination 5.2 Inefficient cleavage of PCR product 1.3 Suboptimal thermal cycling conditions 2.3 Suboptimal reaction conditions 3.1.2 Suboptimal reaction conditions 3.2.2 Low primer quality 4.3 Incorrect primer design 5.3 Inefficient dA-tailing of PCR product 1.4 Suboptimal reaction conditions 2.4 Suboptimal thermal cycling conditions 3.1.3 Overexposure of PCR product to UV light 3.2.3 Alteration of ends during cloning 4.4 RNA contaminated with genomic DNA 5.4 Nuclease contamination 3.1.4 Sequencing error 3.2.4 Sequencing error qPCR Optimization Guide OPTIMIZATION PARAMETER RECOMMENDATION qPCR plate It is recommended that opaque white PCR plates are used for qPCR analysis. The white color virtually eliminates well-to-well signal bleed and improves the efficiency of fluorescent detection thereby increasing assay sensitivity and well-to-well consistency. Template quality It is essential that the nucleic acids are sufficiently pure for qPCR analysis. Template contamination (ie. genomic DNA, protein, carbohydrates or organic solvents) can have a huge impact on assay reliability and reproducibility. Template quality should be determined by spectrophotometry (i.e., Thermo Scientific NanoDrop), microfluidics or PAGE. Amplicon size Ideally, the amplicon length should be between 100 bp and 150 bp to ensure that qPCR reaction efficiency is as close to 100% as possible. Good qPCR efficiency promotes assay reproducibility and sensitivity. Follow reagent-specific instructions for amplicon length. Primer design for SYBR Green chemistry Given that PCR primers are a relatively inexpensive component of a qPCR assay, it is good practice to order and test at least 2 primer pairs for every new qPCR assay. This will maximize the chance of establishing a reliable, reproducible and sensitive assay. Test primers Measure the reproducibility, specificity, sensitivity and dynamic range of your qPCR assay using SYBR Green chemistry across a template dilution series. Ideally, the efficiency of the qPCR reaction should be at least 90% and below 105%, while the assay reproducibility should be higher than r=0.998. Efficient RT Initially, the RT step should be performed as specified in the supplier protocol. However, the length and the temperature of the RT step can be optimized to increase the efficiency of the reverse transcriptase. The reverse transcription should be tested across a range of RNA concentrations to ensure assay linearity. Hot Start qPCR protocols include a heating step at 95°C to ensure the hot start DNA polymerase is fully activated. Reagent specific instructions should be followed. A heating step that is too short will impact assay reproducibility and sensitivity. Thermal protocol It is always recommended to use the thermal protocol recommended in the Thermo Scientific qPCR master mix user guide, even if your assay has been optimized using an alternative supplier’s mix. If assay optimization is required, the annealing temperature should be examined first. Annealing temperature Test a range of annealing temperatures. Depending on the qPCR results, the annealing temperature should be increased or decreased in 2-3°C increments. This can be done in a single experiment using a thermal gradient. Alternatively, a range of annealing temperatures should be tested using multiple qPCR experiments. Primer concentration Always start by using the primer concentration recommended in the master mix protocol. If optimization is required, try stepping the primer concentration up or down in 25 nM increments. www.thermoscientific.com/pcr 1.5 Complex template www.thermoscientific.com/pcr PROTOCOLS AND TECHNICAL GUIDELINES PROTOCOLS AND TECHNICAL GUIDELINES 2. Optional: if RNA template is GC-rich or is known to contain secondary structures, mix gently, centrifuge briefly and incubate at 65°C for 5 min, chill on ice, briefly centrifuge and place on ice. 3. Add the following components in the indicated order or prepare a master mix: 81 PCR and RT-PCR Troubleshooting Guide 1. Low yield or no PCR/RT-PCR product POSSIBLE CAUSES 1.1 Low template quality or quantity. ACTIONS Poor template integrity. DNA templates. Evaluate template integrity by agarose gel electrophoresis. Use DNA isolation methods that minimize shearing and nicking of DNA. Resuspend isolated DNA in TE buffer, pH 8.0, or in Water, nuclease-free (#R0581). RNA templates. RNA purity and integrity is essential for synthesis of full-length cDNA, which results in high quality RT-PCR products. Always assess the integrity of RNA prior to cDNA synthesis. For example, if sharp bands of both the human 18S rRNA (runs at approx. 1.9 kb) and the 28S rRNA (runs at approx. 5 kb) are formed during denaturing agarose gel electrophoresis of total human RNA, the mRNA in the sample is intact. Follow general recommendations to avoid RNase contamination. (See p. 79). 1. Low yield or no PCR/RT-PCR product 1.3 Suboptimal thermal cycling conditions. Number of cycles. The number of cycles varies depending on the amount of template DNA in the PCR mixture and the expected yield of the PCR product. Generally 25-35 cycles are sufficient to produce an adequate yield of PCR product. Note that 40 cycles is recommended for Direct PCR kits. If less than 10 copies of the template DNA are present in the reaction, extend the number of cycles to 40. For calculation of the template copy number, use the DNA Copy Number Calculator at www.thermoscientific.com/pcrwebtools. 1.4 Suboptimal reaction conditions. Insufficient amount of DNA polymerase. Follow the instructions in your polymerase user guide to determine the optimal amount of DNA polymerase. Low template purity. DNA templates. Generally most commercially available DNA purification methods yield templates suitable for PCR. The Thermo Scientific Fermentas product line includes several DNA purification kits such as Genomic DNA Purification Kit (#K0512) and GeneJET Plasmid Miniprep Kit (#K0502). See www.thermoscientific.com/fermentas. Trace amounts of certain agents used in home-made DNA purification protocols, such as phenol, EDTA, and Proteinase K may inhibit thermostable DNA polymerases. In addition, high ionic concentrations (e.g., K+, Mg2+, etc.) may lead to suboptimal reaction conditions for the DNA polymerase. In such cases, the template should be re-purified using a PCR Purification Kit (for example #KO701) or re-precipitated and washed with 70% ethanol. The purity of DNA can be measured spectrophotometrically (e.g., using Thermo Scientific NanoDrop spectrophotometer) by analyzing the A260/A280 ratio (1.8-2.1 is optimal). RNA templates. Trace amounts of agents used in RNA purification protocols may remain in solution and inhibit reverse transcriptases, (e.g., SDS, EDTA, guanidine salts, phosphate, pyrophosphate, polyamines, or a spermidine). Precipitate the RNA with ethanol and wash the pellet with 75% ethanol. The purity of RNA can be measured spectrophotometrically (e.g., using Thermo Scientific NanoDrop spectrophotometer) by analyzing the A260/A280 ratio for which the ratio 1.8-2.0 is optimal. Measure the absorbance of RNA sample in 10 mM Tris-HCl, pH 7.5, rather than unbuffered water (A260/A280 ratio is influenced by pH). 1.2 Incorrect primer design. DNA templates. Use REviewer primer design software at www.thermoscientific.com/reviewer or follow general recommendations for PCR primer design (See Guidelines for Primer Design on p. 78). Make sure primers are not self-complementary and avoid complementary sequences in primer pairs. Extension of primer duplexes will consume reaction components and result in lower yields of the target PCR product. Verify that the primers are complementary to the correct strands of template DNA. RNA templates. Use the correct primer for the type of RNA template used for reverse transcription (See p. 79). Do not use the oligo(dT)18 primer for bacterial RNA or RNA lacking a poly(A) tail, in such cases the random hexamer primer is recommended. If you use a sequence-specific primer, ensure that it is complementary to the 3’-end of the template RNA. 1.3 Suboptimal thermal cycling conditions. Follow the PCR cycling instructions for the specific DNA polymerase you are using; optimal thermal cycling conditions vary between different polymerases. Annealing. Choose the annealing temperature according to your polymerase user guide. Note that the annealing temperatures may differ between different polymerases such as Phusion and Taq DNA Polymerases. The annealing temperature may be optimized stepwise in 1-2°C increments. If available, use a gradient cycler to optimize the annealing temperature of a specific primer pair (±10°C). The annealing temperature also has to be adjusted when additives that change the melting temperature of the primer-template duplex are used, e.g., glycerol, DMSO, formamide, betaine, TMANO (trimetylamine-N-oxide). Extension. The recommended reaction temperature is 72°C. Always refer to your polymerase user guide when determining the optimal reaction temperatures www.thermoscientific.com/pcr Insufficient amount of primer. Generally the PCR reaction is successful with a wide range of PCR primer concentrations (0.1-1 μM) and the optimal conditions will vary depending on the specific primer/template pair. A primer concentration of 0.4 μM is a good starting point for optimization. For long PCR and PCR with degenerate primers a minimum of 0.5 μM is recommended. Check for primer degradation on a denaturing polyacrylamide gel. In the absence of dNTPs, PCR primers may degrade due to the 3’→5’ exonuclease activity of Phusion High-Fidelity DNA Polymerase. Therefore, PCR mixtures should be kept on ice during the reaction set up and the polymerase should be the last component added to the reaction mixture. Alternatively, Phusion Hot Start II High-Fidelity DNA Polymerase (#F-549) can be used because its 3’→5’ exonuclease activity is inhibited at room temperatures,which facilitates the reaction set up. Insufficient Mg2+ concentration. Generally, Mg2+ concentration is pre-optimized in our PCR buffers, therefore, Mg2+ optimization is not needed in most cases. Check the buffer Mg2+ concentration in the user instructions. If the Mg2+ concentration is too low, the yield of PCR product may be reduced. Due to the binding of Mg2+ to dNTPs, primers and DNA template, Mg2+ concentration may need to be optimized for maximal PCR yields. The recommended concentration range for optimizations is 1-4 mM. If the template DNA contains EDTA or other metal chelators, the Mg2+ ion concentration in the PCR mixture should be increased accordingly (1 molecule of EDTA binds 1 molecule of Mg2+). In certain PCR applications higher dNTP concentrations are required. dNTPs also complex Mg2+, therefore the Mg2+ concentration has to be increased accordingly. dUTP or modified nucleotides in reaction mix. Proofreading polymerases (such as Phusion High-Fidelity DNA Polymerases) cannot incorporate dUTP. The polymerase cannot read dUTP or dITP-derivatives in the template strand so the use of these analogues or primers containing them is not recommended. If possible, use non-proofreading polymerases like Taq DNA Polymerase to incorporate dUTP into the PCR product. Low quantity of template. DNA templates. Make sure you have used the amount of template that is recommended in your polymerase user guide. Use enzymes or master mixes with higher sensitivity than that of Taq DNA Polymerase, e.g., DreamTaq DNA Polymerase (#EP0701), Phire Hot Start II DNA Polymerase (#F-122) or Phusion High-Fidelity DNA Polymerases (e.g., #F-530). RNA templates. Increase the amount of template to the recommended level. After DNase I treatment, terminate the reaction by heat inactivation in the presence of EDTA. Heat inactivation in the presence of divalent cations degrades RNA. 82 POSSIBLE ACTIONS CAUSES PROTOCOLS AND TECHNICAL GUIDELINES PROTOCOLS AND TECHNICAL GUIDELINES PROBLEM PROBLEM Master Mix solution not homogeneous. If using ready-to-use PCR master mixes, take care to completely thaw and thoroughly mix the master mix by flipping the tube before assembling the PCR reaction. 1.5 Complex template. GC-rich template. DNA templates. If the template has high GC content, and/or forms a complex secondary structure, we recommend using Long PCR Enzyme Mix (#K0181) for standard PCR applications and Phusion DNA Polymerase (#F-530) with GC Buffer (#F-519) for high-fidelity applications. Alternatively, DNA denaturation can be enhanced by the addition of either 10-15% glycerol, 3-10% DMSO or 5% formamide. When any of these additives are used in high concentration, the annealing temperature should be lowered. Additives like DMSO and formamide may inhibit polymerase activity so titrating the enzyme amount may be required for optimal results with these additives. RNA templates. If the RNA template is GC rich or known to contain secondary structures, use reverse transcriptases with high thermostability, e.g., RevertAid Premium Reverse Transcriptase (#EP0731) or Maxima Reverse Transcriptase (#EP0741) and increase the temperature of the reverse transcription reaction. Long template. Use appropriate long PCR enzymes for templates longer than 5 kb, (e.g., Long PCR Enzyme Mix (#K0181)) for standard PCR applications and Phusion DNA Polymerases (e.g., #F-530) for applications that require high-fidelity. Make sure the template DNA integrity is not compromised and that you have used the recommended denaturation temperature. 2. Non-specific PCR products 2.1 Incorrect primer design. Use REviewer primer design software at www.thermoscientific.com/reviewer or follow the general recommendations for PCR primer design (See Guidelines for Primer Design on p.78). Verify that the primers are complementary to the correct strands of template DNA. Verify that the primers are specific to the template region selected for amplification and have no complementarity with other regions in the template DNA. Otherwise, primers will anneal non-specifically and generate unexpected PCR products. Ensure that the primers are not self-complementary, otherwise extension of primer duplexes will generate unexpected products. Avoid direct repeats in the primers to limit the appearance of large PCR products compared to the target amplicon. www.thermoscientific.com/pcr 83 PROBLEM 3. Sequence errors in PCR product 2.2 Reaction set-up at room temperature. When a PCR reaction is set up at room temperature, DNA polymerases exhibit low but noticeable activity. As a result non-specific priming events may lead to the generation of unexpected amplification products during PCR. To avoid this, when using non-hot start polymerases, the PCR reaction set up should always be performed on ice. Alternatively, use hot start PCR enzymes that have no activity at room temperature and are activated only at high temperatures during PCR cycling. In hot start PCR, non-specific amplification is minimized and target yield is increased. PCR can be set up at room temperature with hot start enzymes. 2.3 Suboptimal reaction conditions. Excess Mg2+ concentration. If the Mg2+ concentration is too high, non-specific PCR products may appear. The recommended concentration range for optimizations is 1-4 mM. Follow the instructions given in your polymerase user guide. 2.4 Suboptimal thermal cycling conditions. Follow the instructions given in your polymerase user guide. If available, use a gradient cycler to optimize the annealing temperature of a specific PCR (±10°C). The annealing temperature also has to be adjusted when additives that change the melting temperature of the primer-template duplex are used (e.g., glycerol, DMSO, formamide, betaine, TMANO [trimetylamine-N-oxide] or hydroxy-ectoine). 3.1 Sequence errors within a PCR product. DNA sequence errors detected after cloning and sequencing of PCR product can be a result of procedures used for cloning, therefore please also refer to the troubleshooting guide for molecular cloning at www.thermoscientific.com/fermentas. PROBLEM 4. PCR/RTPCR product in negative control Template amount too high. Higher amounts of template increase the risk of generating non-specific PCR products. Usually less template DNA is required when the template material is low complexity plasmid or BAC DNA. Follow the instructions given in your polymerase user guide. Low fidelity thermostable DNA polymerase used in PCR. For downstream applications such as cloning or site-directed mutagenesis, high fidelity thermostable DNA polymerases, such as Phusion High-Fidelity DNA Polymerases (e.g., #F-530), are recommended. Sub-optimal reaction conditions. • Excess Mg2+ concentration: if the Mg2+ concentration is too high, the fidelity of the PCR decreases. The recommended Mg2+ concentration range for PCR optimizations is 1-4 mM. • Suboptimal template concentration: follow the instructions in your polymerase user guide. • Imbalanced dNTP concentration. It is very important to have equal concentrations of all the nucleotides (dATP, dCTP, dGTP and dTTP) in the reaction. If the nucleotide concentrations are not balanced, the PCR error rate may dramatically increase. Thermo Scientific Fermentas dNTP Mixes contain either 2 mM (#R0241) or 10 mM (#R0191), or 25 mM (#R1121) of each nucleotide. The concentrations of all four dNTPs are perfectly balanced to provide fidelity and to increase the yield of PCR products. 5. Inefficient PCR cloning POSSIBLE ACTIONS CAUSES 4.1 Cross-over The PCR reaction was contaminated by DNA or RNA present in the working environment. Avoid contamination by contamination. following general working recommendations described on p. 78. 4.2 Carry-over contamination. The PCR reaction was contaminated by amplicons from previous reactions. If the same amplicon is to be generated multiple times, use carryover contamination control techniques. A common method used to avoid carry-over contamination is to incorporate dUTP into PCR products generated in the working environment followed by treatment with UDG3. Note that proofreading polymerases cannot utilize dUTP in the polymerization reaction. 4.3 Incorrect primer design. DNA templates. Avoid direct repeats, self-complementarities and complementarities spanning between primer pairs, as primer multimers generate unexpected products. RNA templates. To avoid amplification of genomic DNA, design PCR primers on exon-intron boundaries. Remove gDNA from RNA using DNase I, RNase-free (#ENO521) (See protocol on p. 79). 4.4 RNA template contaminated with genomic DNA. PCR product in the Minus RT control indicates contamination with genomic DNA. Perform DNase I digestion prior to reverse transcription (See protocol on p. 79). 5.1 Incorrect choice of polymerase. For generation of PCR products suitable for direct blunt-end cloning use a proofreading DNA polymerase such as Phusion High-Fidelity DNA Polymerases (e.g., #F-530). If TA cloning is required, it can be performed by adding 3’-dA overhangs to the blunt PCR product with a non-proofreading polymerase such as DreamTaq DNA Polymerase (#EP0701), Maxima Hot Start Taq DNA Polymerase (#EP0601) or Taq DNA Polymerase (#EP0401). (See protocol on page 78). For efficient cloning with any DNA polymerase, use Thermo Scientific CloneJET PCR Cloning Kit (#K1231). 5.2 Inefficient cleavage of PCR product. Incorrect primer design. When introducing restriction endonuclease sites into primers for subsequent digestion and cloning of a PCR product, extra bases are required for efficient cleavage by conventional restriction enzymes. Refer to www.thermoscientific. com/fermentas where you can find more information about the use of conventional restriction enzymes and new FastDigest Restriction Enzymes. Low primer quality. As oligonucleotides are synthesized in the 3’→5’ direction, inconsistencies may appear in the 5’ end. Reorder primers from a reliable supplier. DNA polymerase is present in digestion reaction mixture. For cloning purposes, remove active thermophilic DNA polymerase before digestion of a PCR product by spin column purification using Thermo Scientific GeneJET PCR Purification Kit (#KO701) or phenol/chloroform extraction and subsequent ethanol precipitation. DNA polymerase may alter the ends of cleaved PCR products and reduce the ligation efficiency. Overexposure of PCR product to UV light Use a long UV wavelength (360 nm) light-box when analyzing and excising PCR products from an agarose gel. When using a short wavelength UV (254-312 nm) light-box, limit exposure to UV to few seconds. Keep the gel on a glass or plastic plate during illumination with UV. Alternatively, use dyes visible in ambient light to visualize PCR products in standard agarose gels1, 2. Sequencing error. To verify the reliability of sequencing results, sequence both DNA strands. 3.2 Sequence errors at PCR product termini. Low primer quality. As oligonucleotides are synthesized in 3’→5’ direction, sequence inconsistencies may appear near the 5’ end. Reorder primers from a reliable supplier. Use PAGE or HPLC-purified primers in applications requiring full length primers such as site-directed mutagenesis. Alteration of PCR product ends during cloning. • Nuclease contamination: DNA nucleases present during extraction procedures or in the digestion or ligation reaction mixture may alter the ends of the PCR product. Please refer to troubleshooting for molecular cloning at www.thermoscientific.com/fermentas. • DNA polymerase present in digestion reaction mixture: remove active thermophilic DNA polymerases before digestion of a PCR product by spin column purification using a DNA purification kit such as Thermo Scientific GeneJET PCR Purification Kit (#KO701) or phenol/chloroform extraction and subsequent ethanol precipitation. DNA polymerases may alter the ends of cleaved PCR products. • PCR product damaged by exposure to UV light. Use a long wavelength UV (360 nm) light-box when analyzing and excising PCR products from the agarose gel. When using a short wavelength UV (254-312 nm) light-box, limit exposure to UV to a few seconds. Keep the gel on a glass or plastic plate during illumination with UV. Alternatively, use dyes visible in ambient light to visualize PCR products in standard agarose gels1, 2. Sequencing error. To verify the reliability of sequencing results, sequence both DNA strands. Ensure sequencing primers are located at a distance of at least 20 nucleotides from the insertion site of the cloning vector. 84 www.thermoscientific.com/pcr Restriction enzyme is sensitive to PCR mixture components. For efficient digestion of PCR products by conventional restriction enzymes or FastDigest restriction enzymes, follow the instructions at www.thermoscientific.com/fermentas. DNA sequence errors at the end of the PCR product can only be identified after subsequent cloning of the PCR product, therefore please also refer to troubleshooting for molecular cloning at www.thermoscientific.com/fermentas. Faulty primer design. Avoid direct repeats in primers as multiple repeats may appear at the ends of the PCR product. PROTOCOLS AND TECHNICAL GUIDELINES PROTOCOLS AND TECHNICAL GUIDELINES 2. Non-specific PCR products POSSIBLE ACTIONS CAUSES 5.3 Inefficient dA-tailing of PCR product for TA cloning. Final extension step is too short. This step can be prolonged to 20-30 minutes in the PCR cycling protocol to ensure a high efficiency of dA-tailing of PCR product, which can result in higher numbers of recombinant clones up to 3-fold or 4-fold.. 5.4 Nuclease contamination. DNA nucleases present during extraction procedures or in the digestion or ligation reaction mixture may alter the ends of the PCR product. Incorrect primer design. The terminal transferase (3’-end extension) activity of Taq DNA polymerase exhibits template specificity with respect to the 3’-terminal nucleotide. Therefore, for efficient TA cloning of PCR products it is important to consider the 5’-end nucleotide of the primers. 5’-end nucleotides can be listed in the following order (according to dA-tailing efficiency): G > C > T > A4. 1. Rand KN. “Crystal Violet can be used to visualize DNA bands during gel electrophoresis and to improve cloning efficiency.” Elsevier Trends Journals Technical Tips, online T40022 (1996). 2. Adkins S, Burmeister M. “Visualization of DNA in agarose gels and educational demonstrations.” Anal Biochem. 240 (1):17-23 (1996). 3. Longo MC. et al. “Use of uracil DNA glycosylase to control carry-over contamination in Polymerase Chain Reactions.” Gene 93: 125-8 (1990). 4. Hu G. “DNA polymerase-catalyzed addition of nontemplated extra nucleotides to the 3’-end of a DNA fragment.” DNA Cell Biol., 12:763-770 (1993). www.thermoscientific.com/pcr 85 PROBLEM POSSIBLE CAUSES ACTIONS No amplification or very high Cq Enzyme not fully activated Ensure the initial activation step is carried out for the correct length of time. Poor primer design Check the PCR product by melt curve analysis or on an agarose gel. It is good practice to try at least 2 primer pairs. PROBLEM POSSIBLE CAUSES ACTIONS Non-specific amplification and / or primerdimers Annealing temperature too low Increase annealing temperature in 2°C increments - use a thermal gradient if possible. Poor primer design Redesign primers using Primer3 or another qPCR primer design tool. It is good practice to try at least 2 primer pairs. RNA template contaminated with genomic DNA Remove genomic DNA from RNA template with DNase I or use RT Enhancer with Verso RT-qPCR kits. Design primers to span exon-exon boundaries. RT step too short Extend the RT step in 5 minute increments up to 60 minutes. RT temperature too low Increase RT reaction temperature in 5°C increments up to 65°C. PCR reaction set up at room temperature Set up the PCR reactions on ice and transfer the PCR reactions from ice to the reaction block, starting the RT protocol immediately. Inhibition by excess volume of the RT reaction Volume of RT reaction added to the qPCR reaction should not exceed 10% of the total qPCR reaction volume. Primers degraded Check the integrity of the PCR primers by denaturing polyacrylamide gel electrophoresis. Annealing step too short Increase annealing step in 3 s increments up to 30 s. Template amount too low Increase template amount. Primer concentration too high Optimize primer concentration. Follow reagent-specific instructions. Annealing temperature too high Decrease the annealing temperature in 2°C increments. Perform UNG treatment before PCR cycling. Extension time too short Increase the extension time in 5 s increments, up to 30 s for amplicons of up to 500 bp. Primer-dimers or PCR products from previous runs contaminating the reaction Amplicon too long Amplicons should ideally be 100-150 bp long and should not exceed 500 bp. Follow reagent-specific instructions. Extension time too long Decrease extension time. Reagents contaminated Discard reagents and repeat assay with fresh reaction components. Contamination occurred during reaction set up Use barrier tips, screw-cap tubes and set up qPCR reaction in a DNA-free zone before adding the template in a separate location. Primer-dimers Redesign primers (and probe). Fluorescence in 'no RT control' RNA template contaminated with genomic DNA Remove genomic DNA from RNA template with DNase I or use RT Enhancer with Verso RT-qPCR kits. Design primers to span exon-exon boundaries. Poor linearity of Cq values across dilution series (R value ≤ 0.998) Too much nucleic acid in ‘high copy number’ assays Reduce the template amount. Too little nucleic acid present in ‘low copy number’ assays Increase the amount of template or increase PCR reaction efficiency by optimizing thermal protocol / re-designing primers. Fluorescence in ‘no template control' (NTC) Poor template quality Check the quality of the template preparation using spectrophotometry, microfluidics or PAGE. Insufficient template Increase amount of template to ensure enough copies of target are included. Template contains inhibitors Purify template or repeat the assay using a 1:10 or a 1:100 dilution of the template. Insufficient cycles Increase the number of PCR cycles to 40. Wrong dye/channels used Check that machine settings correspond with the intercalating dye (e.g., SYBR Green) or the dye conjugated to the fluorescent probe and that the ROX / fluorescein levels are correct. Error in cycle setup Make sure that the instrument settings are correct for the experiment and that you are using the recommended protocol. Error in reaction set up Check concentrations and storage conditions of the reaction components and then repeat the reaction. Insufficient activation of the hot start DNA polymerase Make sure that the recommended temperature and time were used for the initial denaturation and the reactivation step in qPCR. Reaction components not mixed thoroughly Repeat assay ensuring serial dilutions are vortexed for at least 15 s and that the reaction components are mixed together thoroughly. Perform a second data acquisition at an elevated temperature to minimize the interference of primer-dimers. Primers degraded Check the integrity of the PCR primers by denaturing polyacrylamide gel electrophoresis. Co-amplification of primerdimers with the specific product Primer concentration not optimal Start with primer concentration recommended in protocol and increase in 25 nM increments if necessary. Annealing temperature too low Increase the annealing temperature in 2°C increments - use a thermal gradient if possible. Fluorescence data collected at wrong step Ensure fluorescence data is collected at the appropriate step and in the correct channel. Reaction components not mixed thoroughly Repeat assay ensuring all serial dilutions are vortexed for 15 s and reaction components are mixed properly. Fluorescent reporter not being released from probe Validate performance of PCR primers using SYBR Green. Redesign probe or optimize probe-binding step if primers are performing well. Poor template quality Check the quality of the template preparation using spectrophotometry, microfluidics or PAGE. Probe exposed to light and has been bleached Once reaction set up is complete return your probe to the product packaging as soon as possible to mimimize exposure to light. Inhibition by excess volume of the RT reaction Volume of RT reaction added to the qPCR reaction should not exceed 10% of the total qPCR reaction volume. Primer-dimers bound to SYBR Green Optimize thermal protocol (e.g., increase the annealing temperature in 2°C increments and use a thermal gradient if possible). Serial dilutions not calculated properly Repeat serial dilution using fresh sample material and calculate concentrations accurately. Reaction not reproducible Improve reproducibility by improving technique / optimizing thermal protocol / redesigning primers. PCR efficiency is too high (>105%) 86 www.thermoscientific.com/pcr www.thermoscientific.com/pcr PROTOCOLS AND TECHNICAL GUIDELINES PROTOCOLS AND TECHNICAL GUIDELINES qPCR Troubleshooting Guide 87 POSSIBLE CAUSES ACTIONS Technical Data PCR efficiency is too low (<90%) Poor primer design Redesign primers using primer design software. It is good practice to try at least 2 primer pairs. DNA Base Pairs Annealing step too short Increase annealing step in 3 s increments up to 30 s. Fluorescent signal climbs and then falls sharply Cytosine ---------------------------------------------------------- Guanine Annealing temperature too high Decrease the annealing temperature in 2°C increments. Extension time too short Increase the extension time in 5 s increments, up to 30 s for amplicons of up to 500 bp. Template contains inhibitors Purify template or use different template extraction method and repeat the assay. Serial dilutions not calculated properly Repeat serial dilution using fresh sample material and calculate concentrations accurately. Amplicon too long Amplicon should ideally be 100-150 bp long and should not exceed 500 bp. Follow reagent specific instructions for amplicon length. Fluorescence increased so rapidly that baseline correction tilted curve forward Adjust baseline correction e.g., from cycles 3-15 to 3-10 or dilute template between 1:100 and 1:1000 and repeat. Circular DNA pmol ends = pmol DNA x number of cuts x 2 Linear DNA pmol ends = pmol DNA x (number of cuts x 2 + 2) Phage/Plasmid DNA 1000 bp DNA linear pUC18/19 DNA linear pBR322 DNA linear SV40 DNA linear ΦX174 DNA linear M13mp18/19 DNA λ phage DNA Codons and Assigned Amino Acids Amplification plot goes up and down Baseline has been set so that, when software applies data correction, curves are distorted Adjust baseline correction e.g.,from cycles 3-15 to 3-10 or dilute template between 1:100 and 1:1000 and repeat. Amplification plot doesn’t reach threshold Baseline fluorescence is very high in ‘high template’ reactions Manually adjust threshold so it crosses log-linear phase of each amplification plot or dilute template between 1:100 and 1:1000 and repeat. Amplification plot not exponential Template contains inhibitors Purify template or repeat assay using a 1:10 or a 1:100 dilution of template. Data plots are very jagged Data being collected at lowest detection limits of cycler Smooth data by applying a moving average data correction algorithm or redesign assay. First (5’) U C Quality Control The performance of all DNA polymerase lots, in terms of repeatability, specificity and sensitivity, for both conventional PCR and qPCR products is assayed by the amplification of DNA fragments of various lengths. Repeatability, specificity, and sensitivity of all conventional PCR and qPCR master mix lots are tested in replicate PCR reactions, across a broad dilution range of starting nucleic acid templates. The absence of endonucleases, exonucleases, and ribonucleases from all DNA polymerase lots is confirmed by appropriate enzymatic assays. All inventoried and made-to-order Solaris assay lots are analyzed by Liquid Chromatography-Mass Spectrometry (LC-MS) to ensure the primer pair and probe are of the correct length, molecular mass, and yield. www.thermoscientific.com/pcr Estimation of Ends (3’ or 5’) Concentration Thymine ------------------------------------------------------- Adenine A G 88 Common Conversions of Nucleic Acids Spectrophotometric Conversions Second U Phe Phe Leu Leu Leu Leu Leu Leu Ile Ile Ile Met** Val Val Val Val** C Ser Ser Ser Ser Pro Pro Pro Pro Thr Thr Thr Thr Ala Ala Ala Ala A Tyr Tyr Ter* Ter* His His Gln Gln Asn Asn Lys Lys Asp Asp Glu Glu * Translation termination codon. ** Codes for fMet if in the initiator position. Useful webtools for PCR and qPCR www.thermoscientific.com/ reviewer www.thermoscientific.com/ pcrwebtools • • • • • Tm-calculator Multiple primer analyzer Reaction set up calculators qPCR efficiency calculator DNA copy number calculator • • • Oligonucleotide properties thermodynamic calculations Duplex analysis dimer formation probability PCR primer design tool pmol ends (1 µg) 3.04 1.14 0.7 0.58 0.56 0.42 0.06 Third (3’) G Cys Cys Ter* Trp Arg Arg Arg Arg Ser Ser Arg Arg Gly Gly Gly Gly U C A G U C A G U C A G U C A G NA A260 µg/ml mM (in nucleotides) dsDNA 1 50 0.15 ssDNA ssRNA dsDNA 1 1 6.7 33 40 335 0.1 0.12 1 ssDNA 10.0 330 1 ssRNA 8.3 332 1 The average MW of a deoxyribonucleotide base = 333 Da The average MW of a ribonucleotide base = 340 Da The average MW of a deoxyribonucleotide base pair = 650 Da PROTOCOLS AND TECHNICAL GUIDELINES PROTOCOLS AND TECHNICAL GUIDELINES PROBLEM Molar Conversions Phage/Plasmid DNA Quantity bp DNA 1000 pUC18/19 DNA 2686 pBR322 DNA 4361 SV40 DNA 5243 ΦX174 DNA 5386 M13mp18/19 DNA 7250 λ phage DNA 48502 µg 1 0.66 1 1.77 1 2.88 1 3.46 1 3.54 1 4.78 1 32.01 pmol 1.52 1 0.57 1 0.35 1 0.29 1 0.28 1 0.21 1 0.03 11 DNA/Protein Conversions 1 kb of DNA= 333 amino acid ≅ 37 kDa 10 kDa protein ≅ 0.27 kb DNA 30 kDa protein ≅ 0.81 kb DNA 50 kDa protein ≅ 1.32 kb DNA 100 kDa protein ≅ 2.70 kb DNA www.thermoscientific.com/pcr 89 Thermo Scientific PCR Consumables Our industry-leading manufacturing process does not include any shortcuts and is carried out in a world-class facility run by qualified experts. Our PCR plastics manufacturing facility is solely focused on the production of high quality molecular grade plastics. Our teams of engineers, molecular biologists, and QC/QA managers have the years of experience needed to deliver reliable products that generate accurate and reproducible PCR data. Thermo Scientific PCR plastics are designed, manufactured, and tested to ensure optimal PCR performance. 90 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 91 Not All PCR Plastics Are Created Equal Barcoding Virgin Medical Grade Polypropylene The polymer we use is a select medical grade polypropylene chosen for its exceptional biocompatibility. This polymer is inert and will not interfere with or adsorb PCR reaction components. To ensure purity, only virgin pellets are used – plastic waste from our manufacturing is recycled, but is not used in our products. Precision Mold Design & Maintenance Mold design and maintenance dramatically affect the quality of the PCR plastic – unpolished well surfaces can bind reaction components, and the presence of trace chemicals can inhibit amplification. Our tools are designed and maintained with this in mind. Our tools are specially designed to ensure that no lubricants or releasing agents are used in any part of the production process, and molds are cleaned and inspected after each production run. The mold cavities are also extensively polished to produce ultra-smooth PCR well surfaces. This precision design and maintenance ensures that our plastics are chemical free and ultra-smooth to prevent PCR inhibition and maximize sample recovery. White Plastics for Enhanced qPCR Detection As with any fluorescence-based assay, quantitative PCR requires specialized plastics to achieve optimal results. Thermo Scientific white qPCR plastics are designed to enable sensitive and accurate fluorescence detection. When used together with Thermo Scientific Ultra-Clear caps or optical seals, these products will increase sensitivity and reduce 92 www.thermoscientific.com/pcr Evaporation Protection Raised rim design around each well enables secure sealing and safeguards against evaporation. High Efficiency, Reduced Variability Uniform, thin well walls deliver maximum and consistent heat transfer for equally high performance from every sample. Barcode locations Numeric Consistent Results from A1 to H12 Reinforced plate decks and ultra-rigid options prevent plate warping and keep heat transfer consistent across the entire plate. Alpha Ultra Thin Wall Technology for Fast PCR Thermo Scientific UTW tubes and plates represent the new generation of PCR consumables, bringing significantly improved performance in fast PCR and qPCR assays. Each well wall is approximately 50% thinner than standard thin-walled tubes and plates. This further reduces the thermal barrier to heat flow into and out of the PCR sample, resulting in faster and more robust reactions. variability within the qPCR assay. Our white plates reflect significantly more signal back to the instrument’s detector than traditional clear plates. The improved signal reflection ensures that even the lowest levels of fluorescence are detected. White well walls also prevent signal from passing through to the cycler block where it can be inconsistently reflected or absorbed. This keeps variations in the cycler block from affecting your qPCR data. 37.5 mm 4 mm 48 mm 37.5 mm Custom barcoding is also available, see www.thermoscientific.com/ custombarcodes for further details. A 1000 plate minimum order requirement applies for all custom requests. White White Fluor PCR Focused Manufacturing Cleanroom Production To avoid contaminants that can interfere with molecular biology applications, our entire production process, from molding to final packaging, is carried out in a Class 100,000 cleanroom under ISO 9001 guidelines. All of our PCR plastics are certified free from RNases, DNases and human DNA. In contrast, during typical non-cleanroom production, plastics are exposed to many contaminants including dust, bacterial cells, and DNA. The plastics are then sterilized to kill bacteria and inactivate RNases and DNases, but sterilization does not remove dust or DNA contamination. The dust particles left behind can inhibit PCR, and the damaged DNA fragments can still act as templates leading to non-specific amplification. For reliable sample tracking all Thermo Scientific semi- and full-skirted PCR plates are available with random, off-the-shelf barcoding. The barcode has been carefully designed and positioned for compatibility with all major barcode readers. Each barcode includes a human readable format as a back up to the standard 128 barcode to ensure valuable samples can always be identified. The barcode labels themselves are scratch resistant and able to withstand chemical exposure and wide temperature extremes from -196°C to +120°C. Secure, Easy Sealing Specially designed caps create a tight seal that is still easy to open and close. Strip tubes are available with individually attached caps. CONSUMABLES High Performance Product Design Clear Clear Increased signal reflection leads to lower Cq values qPCR amplification of GAPDH using 100 ng, 10 ng, 1 ng and 100 pg of human genomic DNA. Red amplification plots representing the white plates show earlier Cq values and higher end-point fluorescence compared to the blue plots for the natural plates. Reduced well-to-well variability produces more consistent qPCR data Melting profiles of GAPDH amplicons in white plates (red) and clear plates (blue) across four 10-fold dilutions of human genomic DNA. Signal refraction has introduced increased variability in clear plates. www.thermoscientific.com/pcr 93 Description • • • Ordering Information Compatible with standard 0.2 ml or 0.5 ml thermal cycler blocks Caps form a secure seal, yet are easy to open and close Ultra Thin Wall (UTW) low profile for fast PCR applications, compatible with the Piko Thermal Cycler TUC0010 AB-0337, AB-0620 Description 0.1 ml Individual Tubes TUC0010 UTW w/Flat Caps Clear TUC0011 UTW w/Flat Caps White Pack Size: 960 Tubes • • qPC R 0.2 ml Individual Tubes AB-0620 w/Flat Caps AB-0622 w/Flat Caps AB-0337 w/Domed Caps AB-0491 w/Domed Caps Pack Size: 1000 Tubes Clear Assorted Colors Clear Assorted Colors 0.5 ml Individual Tubes AB-0350 w/Flat Caps AB-0533 w/Flat Caps AB-0489 w/Domed Caps AB-0535 w/Domed Caps Pack Size: 1000 Tubes Clear Assorted Colors Clear Assorted Colors • • Ideal strip for reaction volumes below 20 μl Compatible with 0.2 ml thermal cycler blocks and Piko 24 thermal cyclers Low profile to reduce dead space and increase PCR efficiency Labeled A-H end tabs Ordering Information Low Profile Strip Tubes AB-0776 w/Flat Caps Clear AB-0778 w/Flat Caps Assorted Colors AB-0775 w/Domed Caps Clear AB-0777 w/Domed Caps Assorted Colors AB-1770 w/Ultra Clear Caps Clear qPC R AB-1771 w/Ultra Clear Caps White Pack Size: 250 Tube Strips / Cap Strips Low Profile Strip Tubes Tubes Tubes B Bar Heading ctrl Individual shift alt Tubes 4 heading AB-0489, AB-0350 Description 0.2 ml Strip Tubes • • • • Compatible with 0.2 ml thermal cycler blocks Ultra-clear cap options ideal for use in qPCR assays Caps form a secure seal, yet are easy to apply and remove 8 tubes per strip From top to bottom: AB-0776, AB-0775 Ordering Information 0.2 ml Strip Tubes AB-1182 w/Flat Caps Clear AB-0496 w/Flat Caps Assorted Colors Pack Size: 250 Tube Strips/Cap Strips AB-0266 w/Domed Caps Clear AB-0490 w/Domed Caps Assorted Colors Pack Size: 250 Tube Strips/Cap Strips AB-1183 w/Ultra-Clear CapsClear AB-1191 w/Ultra-Clear CapsWhite Pack Size: 120 Tube Strips/Cap Strips Description qPC • R • • • • PCR strip tubes with individually attached caps for easy sample access Compatible with Piko thermal cyclers Ultra Thin Wall (UTW) for fast PCR applications Low profile to reduce dead space and increase PCR efficiency Ultra-Clear flat caps ideal for use in qPCR assays Ordering Information Low Profile Attached Cap Strip Tubes TUC0080 w/Ultra-Clear Flat Caps Clear Tubes qP CR TUC0081 w/ Ultra-Clear Flat Caps White Tubes Pack Size: 120 Strips Not available in US. Low Profile Attached Cap Strip Tubes From top to bottom: AB-1182, AB-0266, AB-1183 Description EasyStrips Attached Cap Strip Tubes • • • PCR strip tubes with individually attached caps for easy sample access Compatible with 0.2 ml thermal cycler blocks Ultra-Clear cap options ideal for use in qPCR assays Ordering Information EasyStrips - Attached Cap Strip Tubes AB-1504 w/Domed Caps Clear AB-1502 w/Ultra-Clear CapsClear AB-1502/W w/Ultra-Clear CapsWhite Pack Size: 250 Strips Not available in US. qPC R TUC0080 AB-1504 TUC0081 AB-1502 AB-1502/W 94 www.thermoscientific.com/pcr qPCR Recommended for qPCR www.thermoscientific.com/pcr 95 Choosing a Plate Tip Low profile versions minimize the air- space above the PCR reaction, further reducing evaporation effects. We recommend that you choose the low profile options where available. See page Plates Please refer to the following compatibility tables to find the Thermo Scientific PCR plate suitable for your instrument. Plate model recommendations are based on optimal PCR performance and ease of handling. Most recommended plates are either fully skirted or semi-skirted as these plates offer increased rigidity, which reduces plate warping during thermal cycling, facilitates multi-channel pipetting, and improves overall ease of use. 38 • Recommended Plate • Alternative Option for the qPCR Reagents Selection Guide Additional Instruments MJ Transg. MegaBACE™ 1000 mark II BaseStation™ Wave MegaBACE™ 4000 Amersham MegaBACE™ 500 Omn-E Omnigene MultiBlock System & MBS® Touchdown Thermo Scientific PCR Express, Px2, PxE TC-Plus Genius, Touchgene, TC-512, TC-5000 Techne Flexigene, TC-412, TC-4000 Takara TP 3000 TheQ Lifecycler™ Primus 384 Gene Technologies GS1/GS4/GSX Sequencing MWG Primus 96 Corbett Research Palm Cycler™ TProfessional TRobot TGradient T1 Thermocycler Uno II Biometra Uno Mastercycler® ep realplex Mx3000P®, Mx3005P™ Mx4000® M384 MasterCycler EP Gradient/Pro Mastercycler® Gradient Gradient Cycler Robocycler PCR Real-Time PCR PCR MiniOpticon Opticon™, Opticon 2™, Chromo4™ CFX384 CFX96 iqtm4 / iqtm5, MyiQ, MyiQ2 iCycler™ Real-Time PCR PTC-100™ with 96-well block PTC-2(xx) C1000, S1000 PCR iCycler™ / MyCycler 3730/3730XL DNA Analyzer 3700 DNA Analyzer 3130 Genetic Analyzer StepOne Plus™ 7900HT 384 well block, ViiA7 7900HTstandard 96-well block, ViiA7 7000, 7300, 7500, 7700, 7900 GeneAmp® 9800 Fast Block Bio-Rad/MJ Sequencers Real-Time PCR GeneAmp® 9700 GeneAmp® 2700/2720/9600 Veriti 0.2ml 96-well Block Veriti 0.1ml 96-well Block PCR Veriti 384-well Block PikoReal 96 Arktik Piko 96 PikoReal 24 RealTime PCR PCR Piko 24 Applied Biosystems (Life Technologies) 7500 Fast, 7900HTFast 96-well block, ViiA7 Thermo Scientific Stratagene (Agilent) & Eppendorf 96-Well Plates Fully Skirted SemiSkirted Non-Skirted Low Profile* AB-0800, AB-2800 Fast Block AB-1900 Flat Deck AB-1400, AB-2400 Raised Skirt AB-1100, AB-2100 Segmented AB-0900 (AB-0624, AB-0648) Standard AB-0600 Low Profile AB-0700 • • • 1 • • • • • • • • • • • • • • • • • • • • • • • • • 3 • 2 • • • • • • • 4 • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 5 5 • • • • • • • • • • • • • • • • • • 6 6 • • • • • • • • • • • • • • • • • • • • 8 • • • • • • • • • • • • • • • • • • • • • • • • • 8 • • • • • • • • • • • • • • • • • • • • 7 • • • • • • • • • • • • • • • • • • • Ultra-Thin Wall Ultra-thin wall 24-Well SPL0240 24-Well white SPL0241 96-Well SPL0960 96-Well white SPL0961 Diamond Ultra AB-2150 Standard AB-1384 Extra Volume AB-0937 • • • • • • 384-Well Robotic Standard • • • • • • • • • • • • • • • • • • • • • • • • • • • 1.Requires Skirted Plate ABI3100 Adapter, Cat No. AB-1069 2.Requires Skirted Plate ABI3700 Adapter, Cat No. AB-0980 3.Requires Semi-Skirted plate ABI3100 Adapter, Cat No. AB-1070 4.Requires Semi-Skirted plate ABI3700 Adapter, Cat No. AB-0888 96 www.thermoscientific.com/pcr • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • • 5.Mx4000® instruments made after 2003 are also compatible with AB-1100 6.Compatible with "Perfect Fit Frames" available from Stratagene 7.For MegaBACETM 1000 purchased before July 2000, use ABgene CYCLEPLATE® (AB-1243) 8.Plates compatible with fully skirted block ONLY www.thermoscientific.com/pcr 97 Description 96-Well Fully Skirted, Low Profile • • H1 SA • 96-Well Fully Skirted, Low Profile AB-0800 Clear AB-0800-L Clear w/blk letters BC-0800 Clear w/Barcode qPC R AB-0800/W White AB-0800/W-L White w/blk letters BC-0800/W White w/Barcode AB-0800/B Blue AB-0800/G Green AB-0800/P Purple AB-0800/R Red AB-0800/Y Yellow Pack size: 25 plates Description • SuperPlate Version: AB-2800 Clear BC-2800 Clear w/Barcode qPC AB-2800/W White R BC-2800/W White w/Barcode AB-2800/B Blue AB-2800/G Green AB-2800/P Purple AB-2800/R Red AB-2800/Y Yellow Pack size: 25 plates • • Ordering Information Patented segmented plate design allows plates to be cut into 24 and 48 well sections Semi-skirt adds rigidity and allows for labeling or barcoding Cut corner: H1 96-Well Semi-Skirted Segmented AB-0900 Clear BC-0900 Clear w/Barcode qPC R AB-0900/W White BC-0900/W White w/Barcode AB-0900/B Blue AB-0900/G Green AB-0900/P Purple AB-0900/R Red AB-0900/Y Yellow Pack size: 25 plates 96-Well Semi-Skirted, Segmented Plates Plates • Ordering Information ANSI footprint and stackable for use in automated systems Low profile to reduce dead space and increase PCR efficiency Available as SuperPlate providing 4x more rigidity for superior robotic handling Cut corner: H1 H1 SA AB-0900 AB-0800 Description 96-Well SemiSkirted, Fast Block • • • Ordering Information Directly compatible with all ABI thermal cycler fast blocks with no adapters necessary Raised plate deck to aid in spill prevention Cut corner: A1 SA A1 AB-1900 96-Well Semi-Skirted, Fast Block AB-1900 Clear BC-1900 Clear w/Barcode qPC R AB-1900/W White BC-1900/W White w/Barcode AB-1900/B Blue AB-1900/G Green AB-1900/P Purple AB-1900/R Red AB-1900/Y Yellow Pack size: 25 plates Description • • • • • Ordering Information Low profile to reduce dead space and increase PCR efficiency Available with black alpha-numeric lettering Improved access for liquid handling Maximum fill volume of 0.2 ml Cut corner: H12 96-Well Non-Skirted, Low Profile AB-0700 Clear AB-0700-LClear w/blk letters qPC AB-0700/W White R AB-0700/B Blue AB-0700/G Green AB-0700/P Purple AB-0700/R Red AB-0700/Y Yellow Pack size: 25 plates 96-Well Non-Skirted, Low Profile H12 A S AB-0700 Description 96-Well SemiSkirted, Flat Deck • • • • Ordering Information Directly compatible with all ABI platforms including sequencers with no adapters necessary Flat plate deck facilitates sealing and handling Available as SuperPlate providing 4x more rigidity for superior robotic handling Cut corner: A12 SA A12 96-Well Semi-Skirted, Flat Deck AB-1400 Clear AB-1400-L Clear w/blk letters BC-1400 Clear w/Barcode qPC R AB-1400/W White AB-1400/W-L White w/blk letters BC-1400/W White w/Barcode AB-1400/B Blue AB-1400/G Green AB-1400/P Purple AB-1400/R Red AB-1400/Y Yellow Pack size: 25 plates Description SuperPlate Version: AB-2400 Clear BC-2400 Clear w/Barcode qPC AB-2400/W White R BC-2400/W White w/Barcode AB-2400/B Blue AB-2400/G Green AB-2400/P Purple AB-2400/R Red AB-2400/Y Yellow Pack size: 25 plates • • • Ordering Information Non-skirted format compatible with most thermal cyclers Available with black alpha-numeric lettering Cut corner: H1 AB-0600 96-Well Non-Skirted, Standard AB-0600 Clear AB-0600-LClear w/blk letters qPC AB-0600/W White R AB-0600/W-L White w/blk letters AB-0600/B Blue AB-0600/G Green AB-0600/P Purple AB-0600/R Red AB-0600/Y Yellow Pack size: 25 plates 96-Well Non-Skirted, Standard 48-Well Semi-Skirted (Pre-Cut) AB-0648 Clear AB-0648/W White AB-0648/B Blue AB-0648/G Green AB-0648/P Purple AB-0648/R Red AB-0648/Y Yellow Pack size: 50 plates 24 and 48-Well Semi-Skirted H1 SA AB-1400 Description 96-Well SemiSkirted, Raised Deck • • • Ordering Information Directly compatible with all ABI platforms including sequencers with no adapters necessary Available as SuperPlate providing 4x more rigidity for superior robotic handling Cut corner: A12 SA A12 96-Well Semi-Skirted, Raised Deck AB-1100 Clear BC-1100 Clear w/Barcode qPC R AB-1100/W White BC-1100/W White w/Barcode AB-1100/B Blue AB-1100/G Green AB-1100/P Purple AB-1100/R Red AB-1100/Y Yellow Pack size: 25 plates Description SuperPlate Version: AB-2100 Clear BC-2100 Clear w/Barcode qPC AB-2100/W White R BC-2100/W White w/Barcode AB-2100/B Blue AB-2100/G Green AB-2100/P Purple AB-2100/R Red AB-2100/Y Yellow Pack size: 25 plates • • qPCR Recommended for qPCR SA www.thermoscientific.com/pcr 24-Well Semi-Skirted (Pre-Cut) AB-0624 Clear AB-0624/W White AB-0624/B Blue AB-0624/G Green AB-0624/P Purple AB-0624/R Red AB-0624/Y Yellow Pack size: 50 plates qPC R qPC R AB-0624 AB-1100 98 Ordering Information Conveniently pre-cut into 24 or 48 well segments Semi-skirt adds rigidity and allows for labeling or barcoding Cut corner www.thermoscientific.com/pcr 99 • • Ordering Information Piko 24-Well PCR Plate SPL0240 Clear SPL0241 White Pack size: 200 plates Description qPC R • • • • Ordering Information Ultra rigid plate for high throughput robotic applications Proprietary inert polymer will not bind reaction components Working well volume: 25 µl Cut corner: A24 Piko 24-Well PCR Frame SFR0241 White Pack size: 50 frames 384-Well Full Skirted, Diamond Ultra Plate AB-2150 Clear BC-3150 Clear w/Barcode qPC AB-2150/W White R BC-3151 White w/Barcode Colors Please enquire Pack size: 50 plates Bar Heading 384-Well Full Skirted, ctrl shift alt 4 Diamond Ultra Plate heading A24 100 Supplier B Rigid Plate 80 1 Polypropylene A Plate 70 Force (N) 2.5 Diamond Ultra Plate 90 AB-2150 Polypropylene B Plate 60 40 20 • • Piko 96-Well PCR Plate SPL0960 Clear SPL0961 White Pack size: 200 plates • • qPC R Piko 96-Well PCR Frame SFR0961 White Pack size: 50 frames *Frames are now only available in white. • • 96-well and 384well Support Racks for Heat Sealing and Automated Dispensing • • • • V-shaped wells give optimal support for ultra-thin walls for applying and removing sealers Industry-standard footprint fits in robotic workstations, enabling automated pipetting with Piko PCR Plates Pre-chill metal block to keep sample temperature sub-ambient during reaction setup Precision-tooled metal support block delivers higher quality heatsealing over all wells, enabling low volume (<5 μl) reactions 3 2.8 2.6 2 2.4 2.2 1.8 1.6 1 1.4 1.2 0.8 0.6 0.4 0 0.2 heading 384-Well Full Skirted, Standard Plate AB-1384 Clear BC-1384 Clear w/Barcode qPC R AB-1384/W White BC-1384/W White w/Barcode AB-1384/B Blue AB-1384/G Green AB-1384/P Purple AB-1384/R Red AB-1384/Y Yellow Pack size: 50 plates SFR0961*, SPL0960 Description Industry leading rigidity for Bar Heading reliable performance in robotic ctrl shift alt 4 systems Ordering Information Fully skirted for use with automated systems Compatible with all leading 384 block thermal cyclers Working well volume: 25 µl Cut corner: A24 Bar Heading 384-Well Full Skirted, ctrl shift alt 4 Standard Plate heading A24 AB-1384 Ordering Information PRK1963 96-well support rack for heat sealing and automated dispensing, blue aluminum, for all 0.2 ml PCR tubes and plates, including 24-well Piko PCR Plates and Plate/Frame assemblies Pack size: 1 rack PRK1383 384-well support rack for heat sealing and automated dispensing, blue aluminum, for all 384-well PCR plates as well as 96-well Piko PCR Plates and Plate/ Frame assemblies Pack size: 1 rack Description • • • • Ordering Information Tall Chimney well design Increased well volume accommodates sequencing and wash steps Working well volume: 40 µl Cut corner: A24 PRK1963, PRK1383 384-Well Full Skirted, Extra Volume Plate AB-0937 Clear BC-0937* Clear w/Barcode qPC AB-0937/W White R BC-0937/W* White w/Barcode AB-0937/B Blue AB-0937/G Green AB-0937/P Purple AB-0937/R Red AB-0937/Y Yellow Pack Size: 100 plates *Pack size: 50 plates Bar Heading ctrl shift Full alt 4Skirted, 384-Well heading Extra Volume Plate A24 AB-0937 www.thermoscientific.com/pcr qPCR Recommended for qPCR SA 100 Cut corner www.thermoscientific.com/pcr H Sealing Metho Superior resistance to warping during thermal cycling Optically clear wells and skirt allow for quick and easy visual plate checks Ultra-strong seal integrity with either heat or adhesive seals to safeguard against evaporation Decreased splash-back during pipetting for seamless liquid handling Description • • • • Adhesive Seal SA • Ultra Thin Wall (UTW) for fast PCR/qPCR applications Low profile Designed for use with the Piko and PikoReal 96-well thermal cyclers Plates can be snapped into plate frame to create a standard 384-well plate Compatible with standard multi-channel pipettes and liquid handling platforms Well spacing and footprint conform to industry (ANSI) dimensions 0 Deflection (mm) SA Piko UTW 96-Well PCR Plates and Frames • • • 0 The Thermo Scientific Diamond Ultra PCR plate offers ultimate rigidity for reliable performance in high-throughput robotic handling systems. By minimizing warping during thermal cycling and heat sealing, plate dimensions remain consistent and seal integrity remains strong, delivering unparalleled performance in automated PCR and sequencing applications. Ordering Information 1 0.5 10 The Ultimate Plate for Robotic Platforms Description Diamond Ultra Plate Supplier B Rigid Plate 1.5 50 30 SFR0241, SPL0240 Plates Plates • Ultra Thin Wall (UTW) for fast PCR/qPCR applications Low profile Designed for use with the Piko and PikoReal 24-well thermal cyclers Plates can be snapped into plate frame to create a standard 96-well plate Compatible with standard multi-channel pipettes and liquid handling platforms Well spacing and footprint conform to industry (ANSI) dimensions Weight Loss (g) Piko UTW 24-Well PCR Plates and Frames • • • SA Description 101 Sealing Options PCR Cap Strips Applications Mechanical Properties Not recommended Adhesive Seals Storage Plate Sealing Flat Cap Strips 2 Domed 2 Cap Strips Ultra-Clear qPCR Cap Strips Ultra-Clear Flat Cap Strips for UTW Plates PCR Foil Seal PCR Film Seal Piko PCR/qPCR Film Seal ABsolute qPCR Seal Crystallography Seal Gas Permeable Seal Plate Seal Part No. AB-0784 (8 Caps per Strip) AB-0265 (8 Caps per Strip) AB-0866 (8 Caps per Strip) TCS1080 (8 Caps per Strip) AB-0626 AB-0558 ASF0020 AB-1170 AB-1450 AB-0718 AB-0580 AB-1179 AB-0981 Pack Size 250 Strips 250 Strips 120 Strips 120 Strips 100 Sheets 100 Sheets 400 Sheets 50 Sheets 50 Sheets 50 Sheets 100 Sheets 960 Caps 120 Strips of 8 Caps • • • • • • • • • • • • PCR (including waterbath) • • qPCR Sealing Temp Range -20°C to +120°C -20°C to +120°C -20°C to +120°C -20°C to +120°C -40°C to +120°C -20°C to +120°C -80°C to +110°C -80°C to +110°C Tubes/Plates AB-0536 AB-0536 AB-0536 8-Strip PCR Tubes 96-Well PCR Plates 8-Strip PCR Tubes 96-Well PCR Plates SPL0240 SPL0241 8.1 N 6N <0.5 N • • • • • • • • • • • • • • • • • • • 75 µm 255 µm 100 µm 100 µm 100 µm 170 µm 55 µm • • • • • • • • • • • • • • • • • • Storage Plates • • 8-Strip PCR Tubes 96-Well PCR Plates • • • • Applicator Tools • • • Gamma Irradiation • • • UV Irradiation • Autoclavable 50 Mats • Isopropanol (100%) 50 Mats -20°C to +120°C Ethanol (100%) 50 Mats -20°C to +130°C • • • • • • AB-1171 -20°C to +55°C Pierceable • • • • • • AB-0675 (Square Well) -20°C to +55°C • • • • • • • AB-0674 (Round Well) -40°C to +80°C • • • • • • • AB-0662 (Square Well) 384 Multisip Septum Cap Mat • Resealable AB-0566 (Round Well) Sealing Mat (Autoclavable) • Peelable Sealing Mat (Pierceable) • All Plates3 All Plates3 SPL0240 SPL0241 SPL0960 SPL0961 -70°C to +110°C -20°C to +80°C Storage Plate Caps and Cap Strips Long Term Storage DMSO (100%) Compatible Products Adhesive Seals Thickness1 Resistance • Successfully tested Sealing We offer a wide range of robust sealing options to suit any application. All our sealing products are designed to provide the ultimate in sample protection while also being easy to use. Thermo Scientific qPCR sealing options are optically clear to deliver maximum and consistent signal transmission, critical for accurate qPCR results. AB-1391 AB-1391 All Plates All Plates3 All Plates3 All Plates3 • • • • • • • • • • • Storage Plates Storage Plates Storage Plates 1.Does not include release liner. 2.Choose cap shape according to the instrument manufacturer's recommendation. 3.Except Diamond Ultra. 102 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 103 Storage Plates Well Shape 48-Well Plate U-bottomed • Ideally suited for sample resuspension Square Wells • Angled well corners reduce the capillary action of liquids, preventing cross-contamination between wells • Square shape maximizes well volume within ANSI footprint design Conical/Pyramidal • Improved sample recovery and decreased dead volume V-bottomed • Virtually eliminates dead volume in tubes during liquid handling Tip Polypropylene Resistance DMSO (100%); Ethanol (100%); Isopropanol (100%); Autoclavable (15 min at 121°C); Gamma Irradiation. 96-Well Plate 96-Well Plate 384-Well Plate Plate Model AB-0988 AB-1058 AB-0796 AB-0765 AB-0564 AB-1127 AB-0661 AB-0932 AB-0862 AB-1178 AB-0781 AB-1055 AB-1056 Pack Size 50 Plates 100 Plates 100 Plates 50 Plates 50 Plates 50 Plates 50 Plates 50 Plates 50 Plates 50 Plates 50 Plates 50 Plates 50 Plates Max Vol (Film Seal) 6 ml 200 µl 330 µl 0.8 ml 1.2 ml 1.2 ml 2.2 ml 2.2 ml 300 µl 250 µl 120 µl 70 µl 55 µl Max Vol (Cap Seal) - 150 µl 250 µl 0.70 ml 1.1 ml - - - - - - - - Max Vol (Mat Seal) - - 130 µl 0.55 ml 0.85 ml 1 ml 1.8 ml 1.8 ml - - - 30 µl 25 µl not suitable for centrifugation 5000 g 5000 g 2000 g 2000 g 2000 g 5000 g 5000 g 5000 g 5000 g 5000 g 5000 g 5000 g - PCR Cap Strips AB-1179 AB-0981 AB-1179 AB-0981 AB-1179 AB-0981 - - - - - - - - Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat Adhesive Heat - - - AB-0566 AB-0674 AB-0566 AB-0674 AB-0662 AB-0675 AB-0662 AB-0675 AB-0662 AB-0675 - - - AB-1171 AB-1171 Max Centrifugal Force storage Streamline your molecular biology applications with Thermo Scientific storage and assay plates. All plates are manufactured in our cleanroom facility to ensure molecular biology grade quality. Our wide range of polypropylene plates provides excellent solutions for sample storage and assay set up, allowing dilutions and aliquots to be handled, stored or transported easily. All plates are ANSI-format for compatibility with automated systems. To further assist in storage and tracking, all plates can be supplied with custom barcoding. Well Bottom Round Wells • Designed for optimal sample recovery • Each well specifically designed with an independent sealing rim to prevent cross-contamination • Ideally suited for use with the widest range of sealing options Shape of Well Compatible Caps Compatible Sealing Film Compatible Mats 104 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 105 Thermo Scientific PCR and qPCR Instruments Thermo Scientific thermal cyclers are on the forefront of innovation. We offer instruments for standard and fast PCR and for qPCR. Our innovative Piko format in PCR and qPCR instruments results in minimal footprint and fast cycling times. The Piko format leads the path toward sustainability by requiring significantly less power and consumables than other standard thermal cyclers. Upgrade your research by choosing the next generation of thermal cycler technology. Thermo Scientific PCR and qPCR instruments are designed, manufactured, and tested to ensure optimal performance. 106 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 107 The Evolution of PCR Thermal Cyclers “Many routine and advanced molecular applications such as cloning, sequencing and DNA fingerprinting continue to be the ‘work horses’ of molecular biology labs.” Faster sample handling, faster protocols Three major technical developments have driven the design of thermal cyclers towards offering faster processing and protocols. Firstly, the utilization of Peltier elements enabled both heating and cooling of an aluminium block with cavities for large numbers of samples simply by reversing the electrical current. The latest Peltiers can heat samples at rates in excess of 5°C per second compared to the early cyclers of less than 1°C per second. This reduces the time to complete a PCR run and therefore increases the number of samples that can be run in a day. Secondly, the introduction of the heated lid significantly improved the processing of samples by removing the requirement for a mineral oil overlay. This had the added benefit of allowing access to the entire sample for downstream applications – previously some material had to be left behind to prevent carryover of the oil. A flat lid in contact with the sample vessels, heated to at least 5°C above the highest reaction temperature, ensures the sample does not condense on the underside of the sample vessel lid. Finally, advances in thin-wall consumables have provided flexibility in the handling of samples, from the original individual 0.5 ml tube to the multi-well 108 www.thermoscientific.com/pcr options such as the 96 and 384-well plates that are now ubiquitous. Thinner walled vessels maximize the efficiency of heat transfer from the thermal cycler to the liquid sample, further reducing incubation times for each step of the PCR cycle. PCR is now performed in reaction volumes between 2 and 100 μl, with routine DNA amplifications achievable in 5 μl or less. The Peltier block, heated lid and specialized consumables, combined with developments in enzyme technology such as hot start functionality have facilitated great improvements in PCR. The products detailed in this product guide utilize all of these advances, and enable PCR protocols to be completed in less than 15 minutes. However, despite all of these advances in thermal cycling technology, analysis of a PCR run still requires an additional gel electrophoresis step, and is only semi-quantitative in nature. Faster optimization The rate-limiting step of primer optimization was likely a driving force behind the development of the gradient sample block feature on thermal cyclers. Faster primer optimization can be achieved by setting a range of temperatures across the block around the theoretical primer annealing point. The different temperatures (normally 6-12 different settings) can be tested simultaneously along with a number of primer and magnesium concentrations, thus allowing an entire assay to be optimized in a single PCR run. The growing need to quantify – Real-Time In the 1990s Russell Higuchi invented a technique for monitoring the exponential increase in DNA molecules during the PCR reaction. Users limited by sample throughput were gaining interest in quantifying the number of copies of their target DNA fragment in each sample. The instrumentation was introduced in 1997 and over the next 10 years it would open up many other applications to the power of PCR. The introduction of a real-time or quantitative PCR (qPCR) thermal cycler enabled both high and low copy samples to be accurately quantified within the same experiment. With each cycle of PCR the fluorescent signal, which originates from a fluorescent label or dye incorporated into the reaction, increases exponentially. By comparison to standards of a known copy number it is possible to determine the number of copies within each starting sample. Various chemistries allow quantification of DNA in the sample PCR products are generally detected either by dyes which bind to double-stranded DNA, such as SYBR Green I, or fluorescently labelled sequence-specific analysis simple. The PikoReal Real-Time PCR System detailed in this product guide, for instance, was developed for low to medium-throughput laboratories and contains software features to aid in experimental design. Despite the advanced features available on both the 24 and 96-well options, the instrument has been designed to be simple to use, with an incredibly small footprint, making it ideal for use in situations that require portability. Standard cyclers with an optical system for the detection of fluorescence signal Real-Time thermal cyclers are typically based on a standard cycler with an optical system for the excitation of the fluorophores and detection of the emitted fluorescence. There are four main components: the light source to excite the fluorescent dye, the thermal cycling sample block, a means to control the wavelengths of light reaching each sample and finally the fluorescence detection system. The two original systems, the 7700 Sequence Detection System from Applied Biosystems and the LightCycler 1.0 from Roche, worked in very different ways with the former being a 96-well system with all reactions being detected at the same time, and the latter a 32-sample centrifugal rotor system with the samples moved over the detector for individual detection. The 7700 used a blue laser to excite the dyes and a CCD camera to detect the fluorescence, whereas the LightCycler used LEDs and photodiodes. The technology favored among many recent instruments is colored LEDs, which limit the wavelengths of light available to excite the dyes and improve the ability to multiplex, and a CCD camera for the simultaneous analysis of many samples. All systems need to use filters to ensure only the correct wavelength of light reaches the sample and more advanced qPCR thermal cyclers will also have emission filters to ensure specific detection of the signal. Real-time PCR allows wide variety of applications The use of qPCR has expanded into many fields with applications in food testing, detection of geneticallymodified organisms, genotyping, mutation scanning and methylation analysis. Developments in qPCR thermal cycler software has helped facilitate these expansions. In 1997, singleplex (FAM) or SYBR Green I experiments utilizing either absolute or relative gene expression analysis were the main types of experiments performed by research scientists. Today, the number of experiments using Single Nucleotide Polymorphism (SNP) genotyping and High Resolution Melt (HRM) curve analysis are increasing significantly, and digital PCR is now beginning to gain momentum. By eliminating the agarose gel electrophoresis required with standard PCR and automating the software analysis of the data, qPCR provides additional information and is much more accurate, sensitive and faster. However, while qPCR has replaced standard PCR in applications such as relative gene expression analysis and diagnostic copy number determination, many routine and advanced molecular applications such as cloning, sequencing and DNA fingerprinting continue to be the ‘work horses’ of molecular biology labs, and still require DNA amplification using PCR. REVIEW Prior to the introduction of thermal cyclers, PCR was a laborious process involving the transfer of samples between three water baths of varying temperatures, and requiring the manual addition of DNA polymerase at the annealing step of each cycle. An initial breakthrough came with the realization that Thermus aquaticus DNA polymerase (Taq) enabled automation of the PCR cycles. However, the basic features of this enzyme meant that it had to be added during a manual hot start step to prevent the amplification of non-specific products. Samples also had to be overlaid with mineral oil or wax to prevent erroneous results associated with evaporation. 2011 sees the 25th anniversary of the introduction of the thermal cycler for DNA amplification. Synergies between application development and innovations in instrument design have not only fuelled improvements in PCR but have created the entirely new field of realtime PCR. So what have been the driving forces in the evolution of PCR? Man probes. Probe probes, for example Solaris or chemistries provide the opportunity to multiplex, where multiple different DNA sequences can be detected in each sample during the same qPCR run. While probes are sometimes difficult to design and optimize, multiplexing does improve the comparative data as pipetting errors between wells are avoided. It is worthwhile noting that not all qPCR instruments on the market have the ability to multiplex. Emerging systems are meeting demand for niche formats Numerous sample formats are available in today’s market place, from the 16 individual samples of the Cepheid SmartCycler to the 9216 samples of the Fluidigm BioMark. However, the 96-well plate format is still favored by the majority of scientists as it provides the required sample throughput and utilizes the standard format of 12 x 8 samples. Increasing instrument usage, demand for additional qPCR data and the desire to reduce sample volumes has led many laboratories to upstream automation. The introduction of liquid handling automation for qPCR reaction set up is often associated with high throughput laboratories but qPCR is reducing in cost rapidly and many more labs have instruments than in the past. Low to medium-throughput laboratories may integrate liquid handling systems as much to reduce manual pipetting errors and gain the corresponding improvement in reproducibility than to process large numbers of samples. Many users are still relatively new to qPCR, and consequently the aim of modern instruments is to make experimental set up and data www.thermoscientific.com/pcr 109 Piko Thermal Cyclers TCP0024 Piko 24-well Thermal Cycler TCP0096 Piko 96-well Thermal Cycler Features and benefits • • • • • • Superior thermal performance: consistent results from well-to-well due to extremely short settling times and high temperature uniformity across the block Time savings: PCR in as little as 15 minutes enabled by fast ramp rates and quick settling times Reagent savings: repeatable yields from as little as 5 μl when using UTW vessels and heat seals Space savings: one of the smallest footprints available - fits onto a tiny bench space Energy saving: short protocols and low wattage requires only 25% of the power consumption of typical thermal cyclers Repeatable sealing prevents sample evaporation: automatic heated lid provides consistent and tight sealing from run-to-run Two formats: 24- and 96-well blocks Piko Thermal Cyclers are available in two different block configurations: 24-well and 96-well. 24-well cyclers accept all standard low profile single tubes, and 8-tube strips with flat caps as well as 24-well Piko PCR Plates. The 96-well instrument utilizes 96-well Piko PCR Plates, which are only 25% of the size of a conventional microplate. Despite the small size, all Piko PCR Plates maintain industry standard well spacing and sample capacity. The 24-well and 96-well Piko PCR Plates are compatible with standard multi-channel pipettes, reagent dispensers, and automated liquid handling systems. Power Requirements: Thermal Accuracy: Thermal Range: Typical Thermal Uniformity: Number of Programs: Fully automated and motorized function Two years Semi-graphical and list mode programming 16 × 17 × 23 cm 4 kg (with external power supply) >5°C heating and >4.5°C cooling 24-well (well volume 0.225 ml, sample volume max. 50 μl) 96-well (well volume 0.05 ml, sample volume max. 20 μl) 100-240V, 50-60Hz ±0.2°C 4-99.9°C ±0.3°C at 95°C 3861 Green PCR: Reduced consumption – Enhanced performance The unique design of the heating block and small plate format allow significant savings both in energy and plastics consumption. This helps reduce the environmental impact of your PCR. A. Total energy consumption (KWh/Y) running power + idle power B. Plastic consumption (kg/y) 8 600 7 500 6 400 300 Bar Heading Piko Thermal ctrl shift alt 4 Cyclers heading 81% less 200 100 0 5 4 3 75% less 2 1 Conventional cycler INSTRUMENTS Ordering Information Technical specifications Heated Lid: Warranty: User Interface: Dimensions (W × D × H) : Weight: Max. Ramp Rate: Block Configurations: INSTRUMENTS www.thermoscientific.com/piko Thermo Scientific Piko Thermal Cyclers deliver high performance in a compact package. At just half the size of other PCR instruments, the Piko Thermal Cycler meets the highest criteria in thermal performance and can complete a PCR protocol in less than 15 minutes. This is achieved using unique technical advances in block and consumable design that allow significant reduction in PCR run times and overall size of the instrument. The Piko Thermal Cycler is an ideal solution for both conventional and fast PCR applications. Due to its small size and low power consumption, the Piko Thermal Cycler is also conveniently portable for field use. Piko Thermal Cyclers are available with two different block configurations: 24-well and 96-well. Conventional cycler Description B Bar Heading Piko Thermal ctrl shift alt 4 Cyclers heading 0 Piko Thermal Cycler Piko Thermal Cycler Significant savings in energy and plastics consumption A) Total estimated annual energy consumption of the 96-well Piko Thermal Cycler vs. conventional 96-well cycler. B) Estimated annual plastics consumption using 96-well Piko PCR Plates vs. conventional 96-well microplates. Both calculations are based on 400 PCR runs per year. 24-well and 96-well block formats maintain industry standards for well volumes and well spacing. 110 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 111 Description Ease-of-use Thermo Scientific Arktik Thermal Cycler is a reliable and flexible PCR instrument for the everyday requirements of any laboratory. The Arktik Thermal Cycler is suitable for a wide range of applications, from individual reactions to high throughput projects. It offers flexibility with three different interchangeable blocks: 96-well block, 384-well block and a dual block with two 48-well units. A broad temperature gradient in 96 and 384 blocks simplifies temperature optimization. Ease-of-use is the key feature of the Arktik Thermal Cycler’s user interface. The protocol is displayed graphically, and the programming is simple with intuitive menus. Ease-of-use is the key feature of the Arktik Thermal Cycler’s user interface. The protocol is displayed graphically, and the programming is simple with intuitive menus. Bar Heading Arktik Thermal ctrl shift alt 4 Cycler heading INSTRUMENTS INSTRUMENTS B Bar Heading Arktik Thermal ctrl shift alt 4 Cycler heading www.thermoscientific.com/arktik Ordering Information Arktik Thermal Cyclers TCA0001*Arktik Thermal Cycler base unit, with gradient TCA0002Arktik Thermal Cycler base unit, without gradient TCA0096 96-well block TCA0384 384-well block TCA4848 Dual block (2 x 48 wells) *Not available in the U.S., Germany and Japan. Features and benefits • • • • • • Interchangeable blocks with excellent thermal precision Dual 48-well block for multi-user option Broad (up to 30°C) and accurate temperature gradient* Reliable and easy to use Low noise level Accepts virtually all standard PCR plastics Technical specifications Heated Lid: Warranty: User Interface: Dimensions (W × D × H): Weight: Max. Ramp Rate: Block Configurations: Power Requirements: Block Thermal Uniformity: Thermal Range: Gradient Range:* Block Thermal Accuracy: Number of Programs: Manually adjustable. Over-tightening protection system. Two years Semi-graphical 29 × 38 × 29 cm 10.5 kg Up to 3°C/s 96 × 0.2 ml, 384 × 0.03 ml, 2 × 48 × 0.2 ml (dual block). Interchangeable 100-240V, 50-60Hz ±0.4°C at 90°C 4 to 99.9°C Max. 30°C ±0.3°C 99 96-well block format *In 96- and 384-well blocks. Gradient feature not available in the U.S., Germany and Japan. 112 www.thermoscientific.com/pcr 2 x 48-well block format 384-well block format www.thermoscientific.com/pcr 113 Description www.thermoscientific.com/pikoreal Ordering Information The Thermo Scientific PikoReal Real-Time PCR System is a highly flexible gene quantification and genotyping platform in 24- and 96-well block formats. The system is designed with a minimal footprint, making it ideal for personal benchtop use and field applications. The PikoReal Real-Time PCR System incorporates innovative, energy-saving technologies to achieve fast performance while meeting the highest thermal requirements – all with reduced energy, plastics, and reagent consumption for real cost savings. It also uses Ultra Thin Wall (UTW) Piko PCR plates that are 25% the size of conventional plates, yet compatible with multi-channel pipettes, reagent dispensers, and automated liquid handling systems. There is unlimited access to the PikoReal Software, which introduces the Virtual Pipetting Tool™ for conveniently creating and editing the plate layouts. The PikoReal software offers extensive analysis options within multiple analysis modules while still being extremely easy-to-use. PikoReal Real-Time PCR System TCR0024 P ikoReal 24-well Real-Time PCR System TCR0096 P ikoReal 96-well Real-Time PCR System Not available before May 2012 in Canada, Brazil, UK, Germany, Austria, Switzerland, Italy, Spain, France, Belgium, The Netherlands, Liechtenstein, Denmark and Sweden Features and benefits • • • • • • Minimal footprint for personal benchtop use Five detection channels enable up to four target multiplexing High temperature uniformity across the wells throughout the temperature range Unrestricted access and easy-to-use software Piko format design for significant savings in plate and reagent consumption Remote control and monitoring over Ethernet connection or stand-alone control using USB flash drives Technical specifications Thermal Block Formats: Sample Volume, Thermal Block: Consumables, Thermal Block: 24-well, 96-well (not interchangeable) 10 – 50 μl (PikoReal 24), 5 – 20 μl (PikoReal 96) 24-well or 96-well Piko PCR Plate; for 24-well block also low profile strip tubes and PCR tubes Max Heating Rate, Thermal Block: >5°C/s Max Cooling Rate: 4.5°C/s Temperature Range, Thermal Block: 4 – 99.9°C Temperature Accuracy, Thermal Block: ± 0.2°C Temperature Uniformity, Thermal Block: ± 0.3°C at 95°C, ± 0.15°C at 60°C, ± 0.2°C at 72°C Temperature Range, Heated Lid: 30 to 110°C Control, Heated Lid: Automatic temperature and pressure setting Excitation: 5 LEDs Excitation Range: 475 to 640 nm Pre-Calibrated Dyes: FAM, HEX, Yakima Yellow, ROX, Texas Red, Cy 5, SYBR Green Multiplex: Up to 4 targets Dynamic Range: 11 orders of magnitude Sensitivity: 1 copy Scan Time for Four Multiplexing Channels: <10 s Software Analysis Modes: Absolute quantification, Relative quantification, Melt curve analysis, Allelic discrimination, High Resolution Melting will be available as a separately sold module in 2011 Operating Systems: Windows XP, Windows 7 Communication: Ethernet (up to 10 instruments can be operated from a single PC) or USB Power Usage: 200 W maximum Dimensions (W x D x H): 30 x 23 x 31 cm Weight: 10 kg Bar Heading PikoReal Real-Time ctrl shift alt 4 PCR System heading INSTRUMENTS INSTRUMENTS B Bar Heading PikoReal Real-Time ctrl shift alt 4 PCR System heading 24-well and 96-well block formats maintain industry standards for well volumes and well spacing. 114 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 115 Description INSTRUMENTS B Bar Heading Piko ctrl shift PlatealtIlluminator 4 heading 116 www.thermoscientific.com/pcr Ordering Information Piko Plate Illuminator PIP2496 Piko Plate Illuminator www.thermoscientific.com/pcr Thermo Scientific Piko Plate Illuminator is a state-of-the-art plate rack that provides a simple way to track the loading of samples by illuminating the target well(s) from below with white LED lights. Features and benefits • • • Compatibility – works with all standard single channel, 8-channel and 16-channel pipettors Ease of use – compact and simple instrument with pre-programmed loading patterns 2-in-1 design – both 24-well and 96-well Piko PCR Plates fit into the rack Technical specifications Dimensions (W x D x H) Weight Vessel Types Programs Power Requirements 16 x 9 x 3 cm 0.1 kg 24-well and 96-well Piko PCR Plates 10 preset and user-selectable loading patterns 100-240 V, 50-60 Hz 117 Index By Product Number 118 By Product Name A AB-1133........................... 54 AB-4167........................... 54 EP0402............................. 30 F-456XL............................ 48 K0192............................... 35 R0581............................... 76 0.2 ml Strip Tubes....................................................................94 G Piko UTW 24-Well PCR Plates and Frames...........................100 AB-0265......................... 102 AB-1138........................... 54 AB-4219........................... 54 EP0405............................. 30 F-470S.............................. 70 K0221............................... 53 R0582............................... 76 384-Well Full Skirted, Diamond Ultra Plate...........................101 GeneRuler and O’GeneRuler DNA Ladders ............................73 Piko UTW 96-Well PCR Plates and Frames...........................100 AB-0266........................... 94 AB-1139........................... 54 AB-4220........................... 54 EP0406............................. 30 F-470L............................... 70 K0222............................... 53 R0971............................... 76 384-Well Full Skirted, Extra Volume Plate . ..........................101 AB-0301........................... 34 AB-1158........................... 54 AB-4318........................... 54 EP0441............................. 64 F-480S.............................. 50 K0223............................... 53 R1121............................... 74 384-Well Full Skirted, Standard Plate ..................................101 H AB-0337........................... 94 AB-1159........................... 54 AB-4319........................... 54 EP0442............................. 64 F-480L............................... 50 K0231............................... 49 R1122............................... 74 96-Well Fully Skirted, Low Profile............................................98 Harris Uni-Core and Cutting Mat for Direct PCR.....................77 R AB-0350........................... 94 AB-1162........................... 54 AB-4322........................... 54 EP0451............................. 62 F-501S.............................. 33 K0232............................... 49 96-Well Non-Skirted, Low Profile............................................99 High Fidelity Enzyme Mix.........................................................35 Random Hexamer Primer.........................................................76 AB-0406........................... 35 AB-1163........................... 54 AB-4323........................... 54 EP0452............................. 62 F-501L............................... 33 K0233............................... 49 S 96-Well Non-Skirted, Standard...............................................99 AB-0489........................... 94 AB-1166........................... 54 AB-4350........................... 45 EP0501............................. 35 F-503L . ............................ 33 K0241............................... 53 SFR0241......................... 100 96-Well Semi-Skirted, Fast Block ...........................................98 I-K RevertAid First Strand cDNA Synthesis Kit.............................65 AB-0490........................... 94 AB-1167........................... 54 AB-4351........................... 45 EP0502............................. 35 F-505S.............................. 33 K0242............................... 53 SFR0961......................... 100 96-Well Semi-Skirted, Flat Deck..............................................98 Individual Tubes.......................................................................94 RevertAid H Minus First Strand cDNA Synthesis Kit..............63 AB-0491........................... 94 AB-1170......................... 103 AB-4352........................... 45 EP0571............................. 35 F-505L . ............................ 33 K0243............................... 53 SM0321............................ 73 96-Well Semi-Skirted, Raised Deck.........................................98 AB-0496........................... 94 AB-1171................. 103, 104 ASF0020......................... 102 EP0572............................. 35 F-510S.............................. 71 K0251............................... 53 SM0322............................ 73 96-Well Semi-Skirted, Segmented..........................................99 L RevertAid Premium First Strand cDNA Synthesis Kit..............61 AB-0533........................... 94 AB-1179................. 103, 105 AX-003451....................... 44 EP0601............................. 26 F-510L............................... 71 K0252............................... 53 SM0323............................ 73 96-Well Semi-Skirted, Segmented (Pre-Cut)...........................99 Long PCR Enzyme Mix..............................................................31 RevertAid Premium Reverse Transcriptase..............................60 AB-0535........................... 94 AB-1182........................... 94 AX-003941....................... 44 EP0602............................. 26 F-511S.............................. 71 K0253............................... 53 SM0324............................ 73 Low Profile Attached Cap Strip Tubes.....................................95 RevertAid Reverse Transcriptase.............................................64 AB-0536......................... 102 AB-1183........................... 94 AX-004253....................... 44 EP0603............................. 26 F-511L............................... 71 K0261............................... 49 SM0371............................ 73 A-C Low Profile Strip Tubes............................................................95 RiboLock RNase Inhibitor.........................................................75 AB-0558......................... 102 AB-1191........................... 94 AX-004366....................... 44 EP0701............................. 28 F-516S.............................. 71 K0262............................... 49 SM0372............................ 73 ABsolute Blue qPCR Mixes .....................................................54 PikoReal Real-Time PCR System............................................114 Red Hot Taq DNA Polymerase.................................................35 RevertAid H Minus Reverse Transcriptase..............................62 AB-0564......................... 104 AB-1219........................... 54 AX-004606....................... 44 EP0702............................. 28 F-516L............................... 71 K0263............................... 49 SM0373............................ 73 ABsolute Blue qPCR SYBR Green Mixes.................................54 M-N S AB-0566................. 103, 104 AB-1220........................... 54 AX-004979....................... 44 EP0703............................. 28 F-517S.............................. 71 K1051............................... 26 SM1103............................ 72 ABsolute qPCR Mixes..............................................................54 Maxima First Strand cDNA Synthesis Kit . .............................59 Solaris qPCR Gene Expression Assays –gene-specific primers AB-0575........................... 34 AB-1283........................... 54 AX-006767....................... 44 EP0704............................. 28 F-517L............................... 71 K1052............................... 26 SM1113............................ 72 ABsolute qPCR SYBR Green Mixes.........................................54 Maxima Hot Start Green PCR Master Mix..............................27 and MGB-probe........................................................................44 AB-0580......................... 103 AB-1285........................... 54 AX-008735....................... 44 EP0711............................. 29 F-518S.............................. 71 K1061............................... 27 SM1123............................ 72 Arktik Thermal Cycler.............................................................112 Maxima Hot Start Taq DNA Polymerases................................26 Solaris qPCR Gene Expression Master Mixes.........................45 AB-0600........................... 99 AB-1301........................... 34 AX-010864....................... 44 EP0712............................. 29 F-518L............................... 71 K1062............................... 27 SM1133............................ 73 Maxima Probe qPCR Master Mixes.........................................49 Solaris RNA Spike Control Kit ................................................46 AB-0620........................... 94 AB-1318........................... 54 AX-011790....................... 44 EP0713............................. 29 F-519S.............................. 71 K1071............................... 28 SM1153............................ 73 D Maxima Reverse Transcriptase................................................58 Strip Tubes 0.2ml.....................................................................94 AB-0622........................... 94 AB-1319........................... 54 AX-011890....................... 44 EP0714............................. 29 F-519L............................... 71 K1072............................... 28 SM1233............................ 72 Deoxyribonucleotide Triphosphates (dNTPs)...........................74 Maxima SYBR Green qPCR Master Mixes..............................53 AB-0624........................... 99 AB-1322........................... 54 AX-012541....................... 44 EP0731............................. 60 F-520S.............................. 71 K1081............................... 29 SM1331............................ 73 DreamTaq DNA Polymerases...................................................28 MgCl2, 25 mM .........................................................................76 AB-0626......................... 102 AB-1323........................... 54 EP0732............................. 60 F-520L............................... 71 K1082............................... 29 SM1332............................ 73 DreamTaq Green DNA Polymerases........................................29 AB-0648........................... 99 AB-1384......................... 101 B-D EP0733............................. 60 F-521S.............................. 71 K1621............................... 65 SM1333............................ 73 DyNAmo cDNA Synthesis Kit..................................................70 O ThermoPrime Taq DNA Polymerase.........................................34 AB-0662................. 103, 104 AB-1391......................... 103 B16................................... 71 EP0741............................. 58 F-521L............................... 71 K1622............................... 65 SM1334............................ 73 DyNAmo ColorFlash Probe qPCR Kit........................................48 Oligo(dT)18 Primer.....................................................................76 ThermoPrime Taq DNA Polymerase in ReddyMix format........34 AB-0674................. 103, 104 AB-1400........................... 98 B33................................... 71 EP0742............................. 58 F-524S.............................. 71 K1631............................... 63 SM1343............................ 73 DyNAmo ColorFlash SYBR Green qPCR Kit.............................52 AB-0675................. 103, 104 AB-1450......................... 103 B34................................... 71 EP0743............................. 58 F-524L............................... 71 K1632............................... 63 SM1551............................ 73 DyNAmo Flash Probe qPCR Kit................................................47 P-Q Thermo-Start Taq DNA Polymerase in ReddyMix format........34 AB-0700........................... 99 AB-1453........................... 70 B38................................... 71 F-525S.............................. 71 K1641............................... 59 SM1552............................ 73 DyNAmo Flash SYBR Green qPCR Kit......................................51 PCR Buffers..............................................................................71 Tubes........................................................................................94 AB-0718......................... 103 AB-1454........................... 67 B55................................... 71 F-J F-525L............................... 71 K1642............................... 59 SM1553............................ 73 DyNAmo HS SYBR Green qPCR Kit.........................................55 PCR Tubes.................................................................................94 AB-0720/B........................ 35 AB-1455........................... 67 B65................................... 71 F-122S.............................. 25 F-530S.............................. 22 K1651............................... 61 SM1563............................ 73 DyNAmo Probe qPCR Kit..........................................................55 Pfu DNA Polymerase................................................................35 U AB-0765......................... 104 AB-1502........................... 94 BC-0800............................ 98 F-122L............................... 25 F-530L............................... 22 K1652............................... 61 SO131............................... 76 DyNAmo SNP Genotyping Master Mix .................................50 Phire Animal Tissue Direct PCR Kit..........................................17 Uracil-DNA Glycosylase (UDG, UNG)......................................75 AB-0775........................... 95 AB-1504........................... 94 BC-0900............................ 99 F-130................................ 16 F-531S.............................. 22 K1661............................... 59 SO132............................... 76 DyNAmo SYBR Green 2-Step RT-qPCR Kit..............................70 Phire Hot Start II DNA Polymerase..........................................25 AB-0776........................... 95 AB-1770........................... 95 BC-0937.......................... 101 F-140................................ 17 F-531L............................... 22 K-002200-C1.................... 46 SO142............................... 76 DyNAzyme EXT DNA Polymerase............................................33 Phire Plant Direct PCR Kit.......................................................16 V AB-0777........................... 95 AB-1771........................... 95 BC-1100............................ 98 F-150................................ 18 F-532S.............................. 22 SPL0240................. 100, 102 DyNAzyme I DNA Polymerase.................................................33 Phusion Blood Direct PCR Kit...................................................19 Verso 1-Step RT-PCR Kits.........................................................67 AB-0778........................... 95 AB-1900........................... 98 BC-1384.......................... 101 F-180S.............................. 77 F-532L............................... 22 P-Q SPL0241................. 100, 102 DyNAzyme II DNA Polymerase................................................33 Phusion Flash High-Fidelity PCR Master Mix..........................23 Verso 1-Step RT-qPCR Kits for probe chemistry......................69 AB-0784......................... 103 AB-1908........................... 34 BC-1400............................ 98 F-180L............................... 77 F-541................................ 32 PIP2496.......................... 116 SPL0960................. 100, 102 Phusion High-Fidelity DNA Polymerases ................................22 Verso 1-Step RT-qPCR Kits for SYBR Green chemistry............68 AB-0785........................... 34 AB-2100........................... 98 BC-1900............................ 98 F-185S.............................. 77 F-546S.............................. 66 PRK1383......................... 100 SPL0961................. 100, 102 E Phusion Hot Start II High-Fidelity DNA Polymerase . .............23 Verso cDNA Synthesis Kit........................................................70 AB-0790........................... 34 AB-2150......................... 101 BC-2100............................ 98 F-185L............................... 77 F-546L............................... 66 PRK1963......................... 100 EasyStrips - Attached Cap Strip Tubes....................................94 Phusion Human Specimen Direct PCR Kit ..............................18 AB-0792........................... 35 AB-2400........................... 98 BC-2400............................ 98 F-190S.............................. 77 F-547S.............................. 19 Extensor Long Range Enzyme Blend........................................35 Phusion RT-PCR Kit...................................................................66 W-Z AB-0794........................... 35 AB-2800........................... 98 BC-2800............................ 98 F-410L............................... 55 F-547L............................... 19 R TCA0001......................... 112 Phusion Site-Directed Mutagenesis Kit..................................32 Water, nuclease-free...............................................................76 AB-0796......................... 104 AB-4100........................... 69 BC-3150.......................... 101 F-415S.............................. 51 F-548S ............................. 23 R0133............................... 74 TCA0002......................... 112 F Piko Plate Illuminator ............................................................116 AB-0800........................... 98 AB-4101........................... 69 BC-3151.......................... 101 F-415L............................... 51 F-548L............................... 23 R0141............................... 74 TCA0096......................... 112 FastRuler DNA Ladders, ready-to-use.....................................72 Piko Thermal Cyclers..............................................................110 AB-0866......................... 103 AB-4102........................... 69 F-415XL............................ 51 F-549S.............................. 23 R0151............................... 74 TCA0384......................... 112 AB-0900........................... 99 AB-4104........................... 68 E F-416S.............................. 52 F-549L............................... 23 R0161............................... 74 TCA4848......................... 112 AB-0908........................... 34 AB-4105........................... 68 EN0361............................. 75 F-416L............................... 52 F-550L............................... 33 R0171............................... 74 TCP0024......................... 110 AB-0937......................... 101 AB-4106........................... 68 EN0362............................. 75 F-416XL............................ 52 F-553S.............................. 22 R0181............................... 74 TCP0096......................... 110 AB-0938........................... 34 AB-4107........................... 68 EO0381............................. 75 F-430S.............................. 70 F-553L............................... 22 R0182............................... 74 TCR0024......................... 114 T-Z AB-0981................. 103, 104 AB-4136........................... 54 EO0382............................. 75 F-430L............................... 70 R0186............................... 74 TCR0096......................... 114 AB-0988......................... 104 AB-4137........................... 54 EO0384............................. 75 F-450L............................... 55 K-O R0191............................... 74 TCS1080......................... 102 AB-1057........................... 34 AB-4138........................... 54 EP0071............................. 30 F-455S.............................. 47 K0171............................... 30 R0192............................... 74 TUC0010........................... 94 AB-1058......................... 104 AB-4139........................... 54 EP0072............................. 30 F-455L............................... 47 K0172............................... 30 R0193............................... 74 TUC0011........................... 94 AB-1100........................... 98 AB-4162........................... 54 EP0281............................. 30 F-455XL............................ 47 K0181............................... 31 R0241............................... 74 TUC0080........................... 95 AB-1127......................... 104 AB-4163........................... 54 EP0282............................. 30 F-456S.............................. 48 K0182............................... 31 R0242............................... 74 TUC0081........................... 95 AB-1132........................... 54 AB-4166........................... 54 EP0401............................. 30 F-456L............................... 48 K0191............................... 35 R0251............................... 74 www.thermoscientific.com/pcr T Taq DNA Polymerase...............................................................30 Thermo-Start Taq DNA Polymerase.........................................34 www.thermoscientific.com/pcr 119 Appendix Notes Trademarks © 2011 Thermo Fisher Scientific Inc. All rights reserved. Affibody is a registered trademark of Affibody AB, Sweden. Quick Ligation is a trademark of New England Biolabs. TaqMan is a registered trademark of Roche Molecular Systems, Inc. Harris Uni-Core and Harris Cutting Mat are trademarks of Shunderson Communications. 903 and FTA are trademarks of Whatman Group. StepOne, StepOne Plus, SYBR, and ROX are trademarks or registered trademarks of Life Technologies. Mx3000P, Mx3005P, and Mx4000 are registered trademarks of Agilent Technologies, Inc. Opticon, Chromo4, MiniOpticon, MyiQ, iQ5 and DNA Engine Tetrad are trademarks or registered trademarks of Bio-Rad Laboratories, Inc. Mastercycler is a registered trademark of Eppendorf. Rotor-Gene is a registered trademark of Qiagen. SmartCycler is a registered trademark of Cepheid. LightCycler is a registered trademark of Roche Diagnostics. MGB is a trademark of Elitech Group. Tween is a registered trademark of Uniqema Americas LLC. Elugent is a trademark of EMD, owned by E Merck. BioMark is a trademark of Fluidigm. The trademarks used on pages 96 and 97 are owned by the manufacturers of the respective instruments, as indicated on those pages. All other trademarks are the property of Thermo Fisher Scientific Inc. and its subsidiaries. License Information Label license information for the Thermo Scientific products in this catalog can be found at www.thermoscientific.com/pcr under the Support Center tab or for some products on the product ordering page or package insert. 120 www.thermoscientific.com/pcr www.thermoscientific.com/pcr 121 Notes 122 www.thermoscientific.com/pcr Notes www.thermoscientific.com/pcr 123 Notes 124 www.thermoscientific.com/pcr Notes www.thermoscientific.com/pcr 125 Notes 126 www.thermoscientific.com/pcr Contact Details North America Technical support: [email protected] Ordering information: Tel: (800) 235-9880 To fax an order: (303) 604-9680 Order online: www.thermoscientific.com/pcr Europe and Asia Technical support: [email protected] Customer service: [email protected] More information on how to place order: www.thermoscientific.com/pcrordering