Download Supplementary Information

Hypoxia and acidosis induced extracellular lipid uptake promotes
metastasis through proteoglycan-dependent endocytosis
Julien A. Menard1, Helena C. Christianson1, Paulina Kucharzewska1, Erika BourseauGuilmain1, Katrin J. Svensson2, Eva Lindqvist1, Vineesh Indira Chandran1, Lena Kjellén3,
Charlotte Welinder1, Johan Bengzon4,5, Maria C. Johansson1, Mattias Belting1,6*
Materials and Methods
Confocal fluorescence microscopy
Lipoprotein uptake: Cells were seeded in 4 or 8-well chamber slides (Labtek,
Thermo Scientific), and DiI-labelled lipoproteins at the indicated concentrations were
incubated with normoxic or hypoxic cells for 30 min. Cells were washed in ice-cold PBS,
fixed and counterstained with Hoechst33342 (Sigma Aldrich 14533).
LD staining: Cells were grown in chamber slides at the various conditions of hypoxia and
acidosis as indicated in serum-free medium with no supplements or supplemented with FBS
(10%) or the indicated concentration of native LDL or VLDL (Intracel). Patient GBM tumor
cryosections or cells were fixed in 4% paraformaldehyde (PFA), rinsed with 60%
isopropanol, and stained with a pre-filtered 3:1 ratio of Oil-red-O stock (0.5% w/v in
isopropanol) : H2O, for 20 min in the dark, followed by extensive rinsing with H2O.
Alternatively, LDs were stained using HCS LipidToxTM green neutral lipid stain (Life
Technologies) or Nile Red (Sigma Aldrich 19123) according to the manufacturer’s
instructions. Nuclei were counterstained with Hoechst33342 or DAPI, as indicated. For the
quantification of LD accumulation, cells were fixed and stained with HCS LipidTox TM and
Hoechst33342, and the intensity of the LipidToxTM signal from LDs was measured using the
CellProfiler software (Broad Institute, MIT) on images acquired by confocal fluorescence
1
microscopy using a x40 objective (see below). Imaging analysis data of n ≥ 64 cells from each
condition was obtained from three independent experiments.
HS and HSPG core protein stainings: Cells were pre-treated or not with 8
mIU/mL Heparinase III (Sigma Aldrich H8891) and 60 mU/mL Chondroitinase ABC (Sigma
Aldrich C2905) lyase for 1 h at 37°C, followed by re-addition of the enzymes for another 1 h
at 37 °C, in digestion buffer (DMEM, 0.5% w/v BSA, 20 mM HEPES-HCl, pH 7.4). Then,
cells were stained with AO4BO8 anti-HS (1:20), mouse anti-vsv (1:200) and goat anti-mouse
IgG AF-488 (1:500) antibodies, or mouse 3G10 anti-HSPG neo-epitope antibody (1:1000; US
biological H1890-75) and goat anti-mouse IgG AF-488 antibody (1:500). Confocal images
were acquired on a Zeiss LSM710 confocal fluorescence microscope system using Plan
Apochromat 20x/0.8M27, EC Plan-Neofluar 40x/1.30 Oil DIC M27, and C-Apochromat
63X/1.20W korr M27 objectives, and integrated with the Zen software (Zeiss).
Electron microscopy
U87-MG cells were grown in hypoxia in full medium for 48 h on polycarbonate
cell culture inserts (0.4 µm pore size) in 12 well plates (Nunc, Thermo Scientific), washed in
0.1 M Sorensen buffer and fixed with 1.5% PFA/2.5% glutaraldehyde for 1 h. Membranes
were then washed in modified Sorensen buffer (0.1 M Na2HPO4, 0.1 M KH2PO4, pH 7.2) and
fixed in OsO4, dehydrated in increasing concentrations of acetone before embedding in Epon
resin. Sixty nanometer sections were transferred onto TEM copper grids, negatively stained
with uranyl acetate, and then then analyzed on a FEI Tecnai Spirit G2 transmission electron
microscope, using the TIA software (FEI) and a Veleta TEM camera (Olympus).
Laser capture microdissection
Normoxic and hypoxic areas from human GBM tumor sections were isolated by
LCM as previously described [1]. Briefly, cryosections were fixed with RNase free ice-cold
70% (vol/vol) ethanol, stained in hematoxylin supplemented with RNase inhibitor
2
SUPERaseIn (Ambion), washed with RNase free PBS and increasing ice-cold ethanol
concentrations (70%, 95%, and 100%) and areas of interest (approximately 2 μm2) were
excised using the PALM LCM system (Zeiss). Hypoxic tumor regions were identified by
GLUT1 staining present on the neighboring tumor sections. Total RNA from dissected
material was isolated with the RNAqueous-Micro kit (Ambion), treated with DNase I
(Ambion), and equal amounts of RNA from normoxic and hypoxic samples, as determined
with RiboGreen RNA Quantification kit (Life Technologies), were used for cDNA synthesis
for further analyses.
Gene microarray and qRT-PCR
Lipoprotein receptor gene expression analyses were performed as described
previously [1] at Swegene Center for Integrative Biology, Lund University, Sweden using the
Illumina HumanHT-12 v3 Expression BeadChip. Data filtration and normalization were
performed with BASE2 [2], and subsequent analyses using the R statistical programming
environment (www.r-project.org). The data reported in this paper have been deposited in the
Gene Expression Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no.
GSE45301).
For qRT-PCR, RNA was isolated for cDNA synthesis followed by qRT-PCR as described
previously [1]. The primers used were: VLDLR (very low density lipoprotein receptor),
forward
5′-
CCGATGGAAGTGTGATGGA
-3′
and
reverse
5′-
CTGGAGCAGGTGAACTCGTC-3′; LDLR (low density lipoprotein receptor), forward 5′AAGGACACAGCACACAACCA-3′ and reverse 5′-AGGCAAAGGAAGACGAGGAG-3′;
EDF1
(endothelial
differentiation-related
factor
1),
forward
5′-
TTCCAAGAAATGGGCTGCT-3′ and reverse 5′-CCGTCCGCTCTCATAGTCC-3′; SR-B1
(Scavenger receptor class B member 1), forward 5′- AACTCCGACTCTGGGCTCTT -3′ and
reverse 5′-GAAGCGATAGGTGGGGATG -3′; LRP1 (Low density lipoprotein receptor-
3
related protein 1), forward 5′- CAAAGGTGGAACGCTGTGAC -3′ and reverse 5′CCGAGTTGGTGGCATAGAGA-3′;. EDF1, which was stable between normoxic and
hypoxic conditions, was used as reference gene. All reactions were run in triplicate, and the
relative expression was calculated using the comparative Ct method (2-Δ (ΔCt)).
HS composition
U87-MG cells were grown in 175 cm2 flasks to sub-confluency, and then incubated in
normoxia or hypoxia for 2, 6, or 24 h in serum-free medium. The cells were scraped into 5
mL ice-cold PBS (14 x 106 cells per condition) and freeze-dried for HS disaccharide
compositional analysis [3], modified as previously described [4]. Triplicate samples from
each condition were analyzed.
LDL aggregation
LDL aggregation/fusion in cell-conditioned medium was assayed by turbidity at
680 nm using a Nanodrop-1000 spectrophotometer (Thermo Scientific). LDL (2.5 mg/mL)
was incubated with U87-MG cell-conditioned medium collected from 24 of hypoxia, and the
evolution of the turbidity at 680 nm was measured over time for up to 48 h. As positive
control, fresh LDL preparations (Alfa Aesar) were aggregated by vortexing for different time
periods, as previously described [5].
Lipid quantitation
U87-MG cells were seeded in full-medium overnight, the medium was changed
to serum-free DMEM +/- 50 µg/mL LDL and incubated in normoxia or hypoxia for 96 h.
Cholesterol and triglyceride levels were measured by homogenizing 20 x 106 cells with a
sonicator, followed by lipid extraction in chloroform/isopropanol/IGEPAL-CA630 (7:11:0.1)
for 1 h with vortexing every 10 min. After centrifugation of the homogenate for 10 min at
15.000 g, the bottom organic phase was collected and evaporated at 50°C. The extracted
4
lipids were resuspended in 200 µL 1 X Cholesterol assay diluent (Total cholesterol assay kit
(Fluorometric) STA-390, Cell Biolabs) prior to analysis.
To measure the cholesterol content in lipid droplets (LDs), 30 x 106 cells treated as described
above were processed using the LD Isolation kit (MET-5011, Cell Biolabs) according to the
instructions. LD-associated lipids from the isolations were extracted as detailed above and
resuspended in 40 µL 1X Cholesterol assay diluent (Total cholesterol assay kit (Fluorometric)
STA-390, Cell Biolabs) prior to analysis. The amounts of cholesterol/cholesteryl esters and
triglycerides in cells and LDs were measured using the Total cholesterol assay kit
(Fluorometric) STA-390 and Serum Triglyceride Quantification kit (Fluorometric) STA-397,
Cell Biolabs according to the instructions.
Label free lipoprotein receptor quantification by LC-MS/MS
U87-MG cells were incubated at normoxia or hypoxia for 6 h and approximately
50 µg of protein from lysates was precipitated in ice-cold acetone for 90 min at -20oC. The
protein precipitate obtained by centrifugation at 14.000 rpm for 15 min at 4oC was dissolved
in 50 mM ammonium bicarbonate buffer containing 6 M Urea, reduced with 10 mM
dithiothreitol (DTT) for 1 h at 56ºC, and alkylated using 50 mM iodoacetamide (IAA) for 30
min in the dark. Protein samples were digested with sequencing grade trypsin (Promega,
Madison) overnight at 37ºC. The digestion was stopped by adding 0.1% TFA and samples
were dried using a speed vacuum, and then dissolved in 0.1% TFA and desalted by stagetipping using UltraMicroSpin Columns (SUM SSI8V, Silica C18, The Nest group, Inc). The
peptides were concentrated (on-line) by reverse phase chromatography using a 20 mm x 0.75
mm, 3 µm C18 RP precolumn (Acclaim PepMap® 100, nanoViper, Thermo Scientific), and
then separated using a 250 mm x 0.075 mm, 2 µm column (Acclaim PepMap® 100 RSLC,
nanoViper, Thermo Scientific) eluted using a nonlinear gradient (5% to 35% B in 90 min,
followed by 90% B at 95 min which was maintained for 10 min; solvent A: 0.1% formic acid;
5
solvent B: 0.1% formic acid in acetonitrile). Peptides were detected using the top 15 datadependent approach. Full MS scans were acquired in the Orbitrap mass analyzer over m/z
400–1600 range with resolution 70.000 and target value of 1.00E+06. Peaks selected from the
inclusion list with charge state ≥ 2 were fragmented in the HCD collision cell with normalized
collision energy of 30%, and tandem mass spectra were acquired in the Orbitrap mass
analyzer with resolution 17.500 at m/z 200 and target value of 1.00E+06. The ion selection
threshold was 3.30E+04 counts, and the maximum allowed ion accumulation times were 100
ms for full MS scans and 60 ms for tandem mass spectra. For all the experiments, dynamic
exclusion was set to 30 s. Raw files were analysed with Proteome Discoverer v 1.4 (Thermo
Scientific, San José, CA). Peptides were identified using SEQUEST HT against UniProtKB
human database integrated into Proteome Discoverer. The search was performed with the
following parameters applied: Carbamidomethylation as static modification, oxidation of
methionine as dynamic modification, 10 ppm precursor tolerance and 0.02 Da fragment
tolerance. No missed cleavage for tryptic peptides was allowed. Filters, ‘high confidence’
were applied (FDR ≤ 0.01). The peptide sequences, unique for VLDLR (Uniprot Ass No
P98155), LRP1 (Uniprot Ass No Q07954) SR-B1 (Uniprot Ass No Q8WTV0) and EDF1
(Uniprot Ass No O60869) were identified using Skyline software (Skyline version 3.1,
http://proteome.gs.washington.edu/software/skyline) [6]. The peptide sequences were
evaluated for their uniqueness using Basic Local Alignment Search Tool (BLAST) [7]. The
samples were subjected to new scheduled LC-MS/MS runs with an isolation list with the
precursors and a retention time window of 4 min. Two biological replicates were run in
duplicates. The data set was again imported into Skyline and the three highest intensity
fragment y-ions (transitions) were selected for each peptide. The peak areas for the selected
transitions for each peptide were integrated. By comparing the peptide peak intensity for each
sample a relative quantitation was performed between hypoxia and normoxia treated samples.
6
Western blotting and phospho-kinase array
Cells from the different treatment conditions were washed in ice-cold PBS and lysed in RIPA
buffer (10 mM Tris·HCl, pH 7.4, 150 mM NaCl, 1 mM EDTA, 0.1% SDS, 1% Triton X-100,
1% sodium deoxycholate) supplemented with protease Complete Protease Inhibitor Cocktail
(Roche) and phosphatase inhibitors (PhosSTOP, Roche). The Pierce BCA protein assay kit
(Thermo Scientific) was used for quantification and similar amount of cell proteins, and
SeeBlue Plus2 protein standard (Life Technologies) were loaded onto NuPAGE Novex 4-12%
Bis-Tris Protein Gels (Life Technologies) in reducing conditions. Proteins were transferred
onto PVDF membranes (Immobilon-FL, Millipore), which were blocked in 5 % BSA for 1 h
at RT in TBST buffer, and probed with primary antibody (anti–phospho-ERK1/2, antiERK1/2 MAPK, and anti-α-tubulin, from Cell Signaling; anti-LRP1 (ab92544) and antiVLDLR (ab92943) from Abcam; anti-SR-B1 (NB400-104) from Novus biologicals)
overnight at 4 °C in blocking buffer, followed by washing and incubation with secondary
HRP-conjugated antibodies (Sigma Aldrich) for 1 h at RT. After incubation with Pierce ECL
Western blotting substrate (Thermo Scientific), protein bands reacting with the antibodies
were quantified with ImageJ software (National Institutes of Health) using the GelAnalysis
method.
For phospho-kinase arrays, 6 x 105 U87-MG cells were incubated in serum-free medium with
our without VLDL or LDL (50 µg/mL) for 10 min, and then lysed in buffer provided with the
ProteomeProfiler™ Human Phospho-kinase Array Kit (R&D Systems) and processed as
indicated by the manufacturer. The spot intensity was analyzed using the Protein Array
analyzer for ImageJ and fold change of relative protein levels (normalized to array reference)
was calculated.
7
References
1.
Kucharzewska P, Christianson HC, Welch JE, Svensson KJ, Fredlund E, Ringner M,
et al. Exosomes reflect the hypoxic status of glioma cells and mediate hypoxiadependent activation of vascular cells during tumor development. Proceedings of the
National Academy of Sciences of the United States of America 2013;110(18):7312-7.
2.
Vallon-Christersson J, Nordborg N, Svensson M, Hakkinen J. BASE--2nd generation
software for microarray data management and analysis. BMC bioinformatics
2009;10:330.
3.
Ledin J, Staatz W, Li JP, Gotte M, Selleck S, Kjellen L, et al. Heparan sulfate
structure in mice with genetically modified heparan sulfate production. The Journal of
biological chemistry 2004;279(41):42732-41.
4.
Dagälv A, Holmborn k, Kjellén L, Abrink M. Lowered expression of heparan
sulfate/heparin biosynthesis enzyme N-deacetylase/N-sulfotransferase 1 results in
increased sulfation of mast cell heparin. The Journal of biological chemistry
2011;286(52): 44433–40.
5.
Pentikäinen MO, Lehtonen EM, Kovanen PT. Aggregation and fusion of modified
low density lipoprotein. Journal of lipid research 1996;37(12):2638-49.
6.
Prakash A, Tomazela DM, Frewen B, Maclean B, Merrihew G, Peterman S, et al.
Expediting the development of targeted SRM assays: using data from shotgun
proteomics to automate method development. Journal of proteome research.
2009;8(6):2733-9.
7.
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search
tool. Journal of molecular biology. 1990;215(3):403-10.
8