Download 6-Methoxyflavone Inhibits NFAT Translocation into the Nucleus and

6-Methoxyflavone Inhibits NFAT
Translocation into the Nucleus and
Suppresses T Cell Activation
This information is current as
of August 3, 2017.
Jae-Seon So, Gi-Cheon Kim, Minkyung Song, Choong-Gu
Lee, Eunbee Park, Ho Jin Kim, Young Sup Kim, Chang-Duk
Jun and Sin-Hyeog Im
Supplementary
Material
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2014/08/09/jimmunol.140028
5.DCSupplemental
This article cites 49 articles, 16 of which you can access for free at:
http://www.jimmunol.org/content/193/6/2772.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2014 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
J Immunol 2014; 193:2772-2783; Prepublished online 11
August 2014;
doi: 10.4049/jimmunol.1400285
http://www.jimmunol.org/content/193/6/2772
The Journal of Immunology
6-Methoxyflavone Inhibits NFAT Translocation into the
Nucleus and Suppresses T Cell Activation
Jae-Seon So,* ,†,1 Gi-Cheon Kim,* ,‡,1 Minkyung Song,* ,x,1 Choong-Gu Lee,‡
Eunbee Park,* ,‡ Ho Jin Kim,{ Young Sup Kim,‖ Chang-Duk Jun,* and Sin-Hyeog Im ‡,#
N
uclear factor of activated T cells is a transcription factor
expressed in most immune cells that plays a critical role
in inducible gene transcription during immune responses
(1). The NFAT family consists of five members, as follows:
NFAT1 (NFATp, NFATc2), NFAT2 (NFATc, NFATc1), NFAT3
(NFATc4), NFAT4 (NFATx, NFATc3), and NFAT5 (TonEBP) (2).
All of the members contain a highly conserved DNA-binding
domain (2). The activation of NFAT1–4 is regulated by calcium
and the calcineurin-signaling pathway, whereas NFAT5 is responsive to hypertonic stress (3). The engagement of TCRs triggers calcium release from intracellular stores and calcium influx
across the plasma membrane and activates the calmodulin-de-
*School of Life Sciences, Gwangju Institute of Science and Technology, Gwangju
500-712, Republic of Korea; †Department of Pathology and Laboratory Medicine,
Weill Cornell Medical College, New York, NY 10021; ‡Academy of Immunology
and Microbiology, Institute for Basic Science, Pohang 790-784, Republic of Korea;
x
Graduate Program in Immunology and Microbial Pathogenesis, Weill Cornell Medical College, New York, NY 10021; {National Cancer Center, Korea, Goyang 410769, Republic of Korea; ‖Division of Drug Discovery Research, Korea Research
Institute of Chemical Technology, Daejeon 305-600, Republic of Korea; and #Division of Integrative Biosciences and Biotechnology, Pohang University of Science
and Technology, Pohang 790-784, Republic of Korea
1
J.-S.S., G.-C.K., and M.S. equally contributed to this work.
Received for publication February 20, 2014. Accepted for publication July 10, 2014.
This work was supported by the research program for Agricultural Science and
Technology Development (Project PJ907153), National Academy of Agricultural
Science, Rural Development Administration, Republic of Korea.
Address correspondence and reprint requests to Prof. Sin-Hyeog Im, Academy of
Immunology and Microbiology, Institute for Basic Science, and Division of Integrative Biosciences and Biotechnology, Pohang University of Science and Technology,
77 Cheongam-Ro, Nam-Gu, Pohang, 790-784, Republic of Korea. E-mail address:
[email protected]
The online version of this article contains supplemental material.
Abbreviations used in this article: AD, atopic dermatitis; CA-NFAT1, constitutively
active NFAT1; ChIP, chromatin immunoprecipitation; CNS, conserved noncoding
sequence; CsA, cyclosporin A; HEK, human embryonic kidney; IRF, IFN regulatory
factor; 6-MF, 6-methoxyflavone; qRT-PCR, quantitative real-time PCR.
Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00
www.jimmunol.org/cgi/doi/10.4049/jimmunol.1400285
pendent serine/threonine phosphatase, calcineurin (4). Dephosphorylation of NFAT proteins by calcineurin induces the rapid
translocation of NFAT into the nucleus, which leads to increased
transcription of NFAT target genes (5).
In T cells, NFAT proteins govern various cellular events by
controlling gene expression related to T cell development, activation, tolerance induction, and differentiation (6, 7). NFAT1, -2,
and -4 are present in T cells, and individual or combinatory NFATdeficient mice showed alteration in T cell responses, Th1/Th2 cell
differentiation, and cytokine expression profiles (8–11). In addition, the phenotype of SCID patients, which is characterized by
a defect in the T cell immune response, including multiple cytokine production, correlates with the impairment of NFAT activation and relatively short duration of residing NFAT in the nucleus
(12, 13). The importance of NFAT in the immune system was
strengthened by several studies showing the regulatory activity of
NFAT in the transcription of cytokine genes, such as IL-2, IFN-g,
and IL-4, which were induced during T cell lineage commitment
following antigenic stimulation (14–16). Cyclosporin A (CsA) or
FK506, an inhibitor of calcineurin, has been used as immunosuppressant in autoimmune diseases and transplantation rejection,
because of their ability to interrupt the calcium-mediated NFAT
signaling cascade (17, 18). However, this treatment has shown a
number of side effects, such as nephro- and neurotoxicities, thus
limiting their therapeutic use (19). Therefore, many attempts have
been made to develop new drugs from natural compounds that can
target NFAT function with less toxicity.
Flavonoids are phenolic compounds composed of a three-ring
structure with various substitutions and are found ubiquitously
in fruits and vegetables (20). Several recent studies have shown
that flavonoids have a variety of biological and pharmacological
activities such as antioxidative, antiviral, anti-inflammatory, anticancer, and cardiovascular protective effects (21, 22). Some flavonoid derivatives also have regulatory activity in immune responses, such as modulation of cell-signaling proteins, including
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
NFAT plays a crucial role in the immune system by regulating the transcription of inducible genes during immune responses. In
T cells, NFAT proteins govern various cellular events related to T cell development, activation, tolerance induction, and differentiation. We previously reported the NFAT1-dependent enhancer activity of conserved noncoding sequence (CNS)-9, a distal cisacting element, in the regulation of IL-10 transcription in T cells. In this study, we developed a T cell–based reporter system to
identify compounds that modulate the regulatory activity of CNS-9. Among the identified candidates, 6-methoxyflavone (6-MF)
significantly inhibited the enhancer activity of CNS-9, thereby reducing IL-10 expression in T cells without affecting cell viability.
6-MF also downregulated the transcription of NFAT1 target genes such as IL-4, IL-13, and IFN-g. Treatment of 6-MF inhibited
the translocation of NFAT1 into the nucleus, which consequently interrupted NFAT1 binding to the target loci, without affecting
the expression or dephosphorylation of NFAT1. Treatment of 6-MF to CD4+ T cells or B cells isolated from mice with atopic
dermatitis significantly reduced disease-associated cytokine production, as well as the levels of IgE. In addition, oral administration of 6-MF to atopic dermatitis mice ameliorated disease symptoms by reducing serum IgE levels and infiltrating lymphocytes.
Conclusively, our results suggest that 6-MF can be a potential candidate for the development of an effective immunomodulator via
the suppression of NFAT-mediated T cell activation. The Journal of Immunology, 2014, 193: 2772–2783.
The Journal of Immunology
using Hypoosmolar Electroporation Buffer (Eppendorf, Hamburg, Germany)
with a Multiporator system, in accordance with the manufacturer’s protocol.
In the reporter assay, pXPG vector was cotransfected with pRL-TK Renilla
vector. After 12 h of plating, cells were stimulated with PMA plus ionomycin
in the presence or absence of chemicals for 24 h, and then reporter activity
was measured using the dual luciferase assay system (Promega). Firefly
luciferase activity was normalized by the activity of Renilla luciferase.
Cell lines and T cell differentiation
EL4 mouse lymphoma and HEK 293T cells were purchased from Korean
Cell Line Bank (Seoul, Korea) and Invitrogen, respectively. T cells were
purified from the lymph nodes and spleen of 8- to 10-wk-old C57BL/6 mice
using CD4+ T cell isolation magnetic beads (L3T4; Miltenyi Biotec).
T cells were cultured in RPMI 1640 medium (Welgene) supplemented with
10% FBS, L-glutamine, penicillin/streptomycin, nonessential amino acids,
sodium pyruvate, HEPES, and 2-ME. For T cell differentiation, the cells
(5 3 106) were stimulated with 1 mg/ml plate-bound anti-CD3ε and 2 mg/ml
soluble anti-CD28 for 24 h under Th1-skewing (10 ng/ml IL-12 plus
10 mg/ml anti–IL-4) or Th2-skewing (10 ng/ml IL-4, 10 mg/ml anti–IFN-g
plus 10 mg/ml anti–IL-12) conditions. Then cells were expanded in
complete medium containing 100 U/ml human rIL-2 for 7 d. On day 7,
differentiated T cells were stimulated with PMA plus ionomycin in the
presence or absence of chemicals. For T cell blast preparation, the CD4+
T cells (1 3 106) were stimulated with 2 mg/ml plate-bound anti-CD3ε and
2 mg/ml soluble anti-CD28 for 24 h supplemented with 100 U/ml human
rIL-2 and expanded with IL-2 for 5 d.
Quantitative real-time PCR analysis
C57BL/6 and BALB/c mice were purchased from SLC (Shizuoka, Japan).
Mice were housed in a specific pathogen-free barrier facility and were used
in accordance with protocols approved by the Animal Care and Ethics
Committee of Gwangju Institute of Science and Technology.
Total RNA was extracted using TRIzol reagent (Molecular Research Center)
in accordance with the manufacturer’s protocol. cDNA was synthesized in
20 ml mixture containing 1 mg RNA using the Improm-II reverse transcription system (Promega). Quantitative real-time PCR (qRT-PCR) was
carried out using cDNA, SYBR Premix Ex Taq (Takara, Shiga, Japan),
primers shown in Table I, and DNA Engine with a Chromo-4 Detector
(MJ Research). The data were normalized using the expression level of
hypoxanthine-guanine phosphoribosyl transferase.
Vectors, reagents, and Abs
Flow cytometric analysis
pGL4.17 firefly and pRL-TK Renilla luciferase vectors were purchased
from Promega. Expression vectors for NFAT1 and constitutively active
NFAT1 (CA-NFAT1) were provided by Dr. Anjana Rao (La Jolla Institute
for Allergy & Immunology). The following reagents were used: PMA and
ionomycin from Calbiochem; DMSO, 6-MF, and IL-12 from SigmaAldrich; human IL-2 from the National Cancer Institute, Preclinical Repository; and murine IL-4 from PeproTech.
The following Abs were used: anti-CD3 (145.2C11), anti-CD28 (37.51),
anti–IFN-g (XMG1.2), anti–IL-12 (C17.8), FITC anti–IL-10 (JES5-16E3),
and FITC anti–IL-4 (11B11) from BD Pharmingen; anti–IL-4 (11B11)
from the National Cancer Institute, Preclinical Repository; anti-IRF4 from
Santa Cruz Biotechnology; anti-NFAT1 (ab2722), anti-NFAT2 (ab2796),
and anti–b-actin (ab3280) from Abcam (Cambridge, U.K.); anti-lamin B
from Cell Signaling; and anti–NFAT1-phospho Ser54 from GeneTex.
T cells were stimulated for 24 h, and 1 mg/ml brefeldin A (Sigma-Aldrich)
was added 14 h before the end of the culture. Cells were washed twice with
permeabilization buffer containing 0.5% saponin and 1% BSA. Then cells
were incubated with Ab for intracellular cytokine staining at 4˚C for
20 min. Cells were washed and resuspended in PBS. At least 20,000 events
were analyzed using EPICS XL and EXPO32 software (Beckman Coulter).
Materials and Methods
Animals
Computational analysis of the IL-10 locus
Genomic sequences spanning 120 kb of the IL-10 gene were analyzed using
web-based alignment software, VISTA browser 2.0 (http://pipeline.lbl.gov/
cgi-bin/gateway2), to identify CNS.
Development of stable cell line and screening of natural
compounds library
Reporter construct was generated by cloning the minimal promoter and the
CNS-9 region of the IL-10 locus into the pGL4.17 vector, which contains
luciferase and neomycin-resistant gene. EL4 cells were electroporated by
a Multiporator (Eppendorf, Hamburg, Germany), in accordance with the
manufacturer’s protocol. Then transfected cells were positively selected
using culture media containing 900 mg/ml G418 antibiotics (Invitrogen).
The chemical library containing 367 natural compounds was provided
by Korea Chemical Bank (Daejeon, Korea). To perform the screening, cells
(6 3 105) were plated in 96-well white microplates (Nunc, Rosklide,
Denmark) and were treated with 0.5 mg/ml chemical diluents for 4 h.
Luciferase activity was measured using Steady-Glo reagent (Promega) in
accordance with the manufacturer’s protocol.
Transient transfection and reporter assays
EL4 mouse lymphoma or human embryonic kidney (HEK) 293T cell lines
were transfected using Lipofectamine 2000 (Invitrogen) or electroporated
Preparation of cell lysates and nuclear extract
For total lysate preparation, Th2 cells were lysed in radioimmunoprecipitation
assay buffer (50 mM Tris-HCl [pH 7.6], 150 mM NaCl, and 1% Nonidet
P40) containing protease inhibitors mixture (Roche) and were incubated for
30 min on ice. For nuclear extraction, Th2 cells were stimulated for 1 h, and
nuclear extracts were prepared, as previously described (26). Briefly, T cells
were washed twice with ice-cold PBS and were resuspended in 500 ml
cold buffer A containing protease inhibitor mixture (Roche, Mannheim,
Germany) and 0.4% Nonidet P40. The cells were allowed to swell by incubation on ice for 15 min, and then homogenate was centrifuged for 3 min.
The nuclear pellet was resuspended in 150 ml cold buffer B. The tube was
thoroughly mixed and was placed on a rotatory shaker for 2 h. The nuclear
extracts were centrifuged for 5 min. The supernatant containing nuclear
proteins was used for experiments. Cytoplasmic and nuclear extract were
prepared by NE-PER nuclear and cytoplasmic extraction reagents
(Thermo), according to the manufacturer’s protocol.
Immunoblotting
Total lysates or nuclear extracts (20–40 mg) of T cells were subjected to
7.5–10% SDS-PAGE and were electrotransferred onto nitrocellulose membranes for immunoblot analysis. Each membrane was incubated with Abs
against NFAT1, NFAT2, NFAT1-phospho Ser54, b-actin, or lamin B. Blots
were developed using HRP-conjugated secondary Ab (Sigma-Aldrich) and
the ECL western blot detection kit (Amersham Pharmacia Biotech). Intensity
of individual bands was quantified using ImageJ densitometry software.
Immunocytochemistry
Round glasses were located in a 12-well plate and were coated with antiCD3 (1 mg/ml) or poly-L-lysine (Sigma-Aldrich) for 12 h at 4˚C. Glass was
washed with PBS for three times, and then 1 3 106 T cells were transferred
onto the glass. Cells were stimulated with anti-CD28 (2 mg/ml) in the
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
kinases and transcription factors (23, 24). Therefore, flavonoids
have been considered as potential target compounds for the development of new therapeutic agents. However, little information
is available concerning the exact molecular mechanism(s) underlying the regulatory effects of each flavonoid derivative.
Previously, we elucidated the role of enhancer elements in the
regulation of IL-10 transcription in T cells. A distal cis-acting element, conserved noncoding sequence (CNS)-9, showed an enhancer activity and the recruitment of NFAT1 and IFN regulatory
factor (IRF)4 to the site that synergistically increased IL-10 transcription in Th2 cells (25). Based on this result, we developed a
T cell–based reporter assay system to screen compounds that can
modulate the regulatory activity of CNS-9. We identified that
6-methoxyflavone (6-MF) inhibits the enhancer activity of CNS-9,
resulting in the downregulation of IL-10 expression in T cells.
This inhibitory effect of 6-MF is due to the inhibition of NFAT1
translocation into the nucleus that consequently interrupts the binding of NFAT1 to its target loci. Treatment of 6-MF also downregulated cytokine production by activated T cells in an atopic
dermatitis (AD) mice model. In addition, oral administration
of 6-MF ameliorated AD disease symptoms. Conclusively, our
results suggest that 6-MF could have effective immunomodulatory
activity by suppressing NFAT-mediated T cell activation.
2773
2774
presence or absence of 6-MF and were fixed by incubation with ice-cold
100% methanol for 10–15 min at room temperature. After washing with
PBS (0.25% Triton X-100), cells were blocked with PBST (PBS with 0.1%
Tween 20 and 3% BSA) for 30 min at 37˚C. Cells were incubated with
anti-NFAT1 Ab (Abcam, Cambridge, U.K.) for 12 h at 4˚C and then
stained with FITC- or tetramethylrhodamine isothiocyanate–conjugated
anti-mouse IgG Ab. For counterstaining, cells were incubated with 23
SSC solution (0.3 M NaOH, 0.03 M sodium citrate [pH 7.0]) containing
20 mg/ml RNase, and then nuclei were stained with propidium iodide or
DAPI (Invitrogen). Stained cells were examined using a FV1000 confocal
microscope (Olympus), and images were processed using Olympus
FLUOVIEW software.
Chromatin immunoprecipitation assay
EMSA
EMSA was performed as previously described with minor modifications
(28). Double-stranded probes were labeled with g-[32P]-ATP (PerkinElmer)
by T4 polynucleotide kinase (NEB) and then purified by G-50 micro
column (GE Healthcare). Nuclear extracts of T cells (10 mg) were incubated with 0.1 mg poly(dI-dC) in the binding buffer for 30 min and
were subsequently mixed with radiolabeled probes for 30 min. Probe
sequences are described in Table III. Unlabeled oligomers used as competitors were added to the mixtures 30 min before probe incubation. For
supershift assay, nuclear extracts were preincubated with Abs against
target protein. Samples were subjected to 6% nondenaturing PAGE in
0.53 Tris-borate-EDTA buffer.
Induction of experimental AD
Ear surface of BALB/c mice was stripped five times with surgical tape
(Nichiban) and was painted with 20 ml 4% 2,4-dinitrochlorobenzene (SigmaAldrich) dissolved in acetone/olive oil solution (acetone:olive oil = 1:3) for
sensitization. After 3 d, mice ears were challenged with 20 ml 2% dinitrochlorobenzene and 20 ml dust mite extracts (10 mg/ml; Yonsei University)
dissolved in PBS containing 0.5% Tween 20 once per week for 6 wk (29). AD
mice were treated by oral gavage with DMSO (control), CsA (5 mg/kg/day;
Sandimmune, Novartis, NY), or 6-MF (20 or 100 mg/kg/day) five times
per week for 6 wk. Ten microliters of each reagent (DMSO, 5 mg/kg/day;
CsA, 20 mg/kg/day; 6-MF, 100 mg/kg/day) was individually mixed with
90 ml 1% hydroxypropyl methylcellulose (Sigma-Aldrich) for drug delivery.
Proliferation assay
CD4+ T cells (2 3 105 cells/well) were stimulated and cultured for 72 h in
flat-bottom 96-well plates. After 56-h incubation, 0.5 mCi [3H]thymidine
(NEN) was added to each well, and the cells were labeled for additional
16 h. Cells were harvested onto glass filters and were counted using
a liquid scintillation counter (Beckman). The degree of proliferation was
presented as the stimulation index, which was calculated by dividing the
cpm of samples with that of unstimulated cells.
Measurement of IgE levels
Serum was obtained from mice 2 and 4 wk after AD induction. Concentration of IgE was measured using 200-fold diluted serum and IgE ELISA
kit (BD Biosciences) in accordance with the manufacturer’s protocol. To
analyze IgE levels in culture medium, 3 3 106 CD19+ B cells were
stimulated with LPS (10 mg/ml) and IL-4 (20 ng/ml) in the presence or
absence of 6-MF for 72 h.
Histological evaluation
Excised ears of each group were fixed in 4% paraformaldehyde for 16 h and
were embedded in paraffin wax. Six-micrometer sections were stained with
H&E (Sigma-Aldrich) and were observed by microscope.
Statistical analysis
All data are shown as mean values 6 SD. Statistical analyses were performed using Student t test in different groups, and p values ,0.05 were
considered to be significant.
Results
6-MF inhibits enhancer activity of CNS-9
We previously reported a crucial role of distal cis-regulatory element, CNS-9, in IL-10 gene transcription (25). Recruitment of
NFAT1 and IRF4 to the CNS-9 effectively increased the activity
of IL-10 minimal promoter (25). In this study, we established
a T cell–based IL-10 gene reporter assay system to identify compounds that have modulatory effects on IL-10 expression by altering
the enhancer function of CNS-9. CNS-9 and minimal promoter
region of IL-10 were cloned into the upstream of the luciferase gene
in pGL4.17 reporter vector (Fig 1A, 1B). After transfection of EL4
cells with this reporter construct, stable EL4 clones that continuously express luciferase under the control of CNS-9 were identified.
Establishment of stable cell line was confirmed by the presence of
neomycin-resistant gene, luciferase gene, and CNS-9 element in the
genomic DNA extracted from each clone (Fig. 1C). To evaluate
whether the stable cell line appropriately responds to stimuli, we
examined luciferase activity after stimulation with PMA and ionomycin in the presence or absence of CsA. Luciferase activity was
increased by ∼3- to 5-fold upon PMA and ionomycin stimulation;
however, this increase was disrupted by CsA (Fig. 1D). Next, we
assessed optimal cell number for screening in 96-well plate and
selected 6 3 105 cells/well that showed the highest ratio of luciferase activity upon stimulation as compared with that of unstimulated cells (Supplemental Fig. 1A, 1B).
Next, we screened chemical libraries of single compounds derived from natural sources that contain derivatives of several
structural analogs of compounds, such as flavone, stilbene, and
terpene (Supplemental Fig. 1C). The luciferase activity was
measured after 4 h of chemical treatment (Supplemental Fig. 1D).
All the screenings were repeated three times, and the compounds
that showed reproducibility were primarily selected. Among these
compounds, we selected four, namely 6-MF, 7-hydroxyflavone,
baicalein, and formononetin. These four compounds showed
.50% reduction of luciferase activity of stable cell line (Fig. 2A).
Interestingly, all compounds are flavone derivatives that have
flavonoid backbone with ∼250 kDa. The chemical information
and structures of the compounds are described in Fig. 2B, 2C,
respectively. Then we tested cytotoxicity of these compounds to
rule out the possibility that their inhibitory effect is derived from
the inhibition of cell viability. None of the selected compounds
induced any significant change in the viability of EL4 cells and
primary CD4+ T cells at the tested concentration (20 mM) (Fig.
2D, 2E). Among the candidates, we have focused on the activity of
6-MF because it showed the strongest effect in suppressing CNS9–mediated luciferase activity (Fig. 2A).
6-MF inhibits cytokine expression by activated T cells
We examined whether 6-MF treatment could suppress IL-10 expression in T cells, using the primers shown in Table I. Compared
with DMSO-treated EL4 cells, treatment of 6-MF significantly
suppressed the stimulation-dependent increase of IL-10 transcription (Fig. 3A, left panel). Furthermore, 6-MF treatment led to
almost 50% decrease of IL-10 mRNA level in primary Th2 cells
differentiated in vitro (Fig. 3A, right panel). Intracellular IL-10
analysis using flow cytometry confirmed that 6-MF treatment significantly reduced IL-10 production from Th2 cells by up to 60%
(Fig. 3B). These results indicate that 6-MF has an inhibitory effect
on IL-10 expression by suppressing the enhancer activity of CNS-9.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
Chromatin immunoprecipitation (ChIP) analysis was carried out as previously described with minor modifications (27). Briefly, Th2 cells were
stimulated for 1 h and were then cross-linked using 2% formaldehyde.
After incubation in lysis buffer, cell lysates were sonicated using Bioruptor
(Diagenode, Liege, Belgium) to fragment the DNA. The sheared chromatin
was immunoprecipitated using Abs against NFAT1 and rabbit IgG. Complexes of DNA and Abs were precipitated using protein G agarose
(Millipore) and then reverse cross-linked. The presence of selected DNA
sequences was assessed using real-time PCR with primers described in
Table II. As a control, the PCR was done directly on input DNA purified
before immunoprecipitation. Data are presented as the amount of DNA
recovered relative to the input control. Result of ChIP with isotype IgG was
confirmed as a background value and showed ,0.001 relative ratio to input.
6-METHOXYFLAVONE INHIBITS NFAT TRANSLOCATION
The Journal of Immunology
2775
To examine whether inhibitory effect of 6-MF is restricted to IL10 regulation, we analyzed the expression of other cytokines in
T cells. Similar extent of inhibition was observed on IL-4 and IL-13
expression in 6-MF–treated Th2 cells (Fig. 3C, 3D). Interestingly,
6-MF also reduced IFN-g transcription in Th1 cells (Fig. 3C, right
panel). These results suggest that 6-MF acts as a negative regulator of cytokine expressions in T cells.
6-MF suppresses nuclear translocation of NFAT1 in T cells
To investigate how 6-MF downregulates the transcription of several
cytokines in T cells, we analyzed the changes in the expression and
activation of transcription factors. As we previously demonstrated,
NFAT1 and IRF4 are crucial factors for the enhancer activity of
CNS-9 (25). Moreover, NFAT1 is one of the key transcription
factors in the regulation of multiple cytokine expression, such as
IL-2, IL-4, IL-10, and IFN-g, upon stimulation (25). First, we
analyzed the effects of 6-MF on NFAT1-mediated transactivation
using CNS-9 reporter system. As expected, NFAT1 overexpression
significantly increased luciferase activity in EL4 cells (Fig. 4A).
However, 6-MF treatment significantly suppressed the transactivity of NFAT1 in a dose-dependent manner, thereby decreasing CNS-9 activity to the basal level (Fig. 4A). Interestingly,
treatment of 6-MF also reduced IRF4-mediated luciferase activity
(Supplemental Fig. 2A). These results suggest that 6-MF may exert its inhibitory effects by modulating the activity or expression
levels of NFAT1 and IRF4. Next, we tested whether treatment of
6-MF affects the expression levels of these transcription factors.
The transcript and protein level of NFAT1 and IRF4 were measured in 6-MF–treated Th2 cells. The transcript level of NFAT1 or
IRF4 was maintained in similar level regardless of 6-MF treatment
(Fig. 4B, Supplemental Fig. 2B). Moreover, 6-MF treatment did
not change the protein level of NFAT1 or IRF4 in total cell lysates
(Fig. 4C, upper panel, and Supplemental Fig. 2C, left panel).
Therefore, we investigated whether 6-MF treatment affects nuclear translocation of NFAT1 or IRF4 without altering their expression levels. Interestingly, 6-MF treatment clearly reduced the
stimulation-dependent increase of nuclear NFAT1 protein level
(Fig. 4C, lower panel). However, no significant change in nuclear
level of IRF4 protein was observed in 6-MF–treated Th2 cells
(Supplemental Fig. 2C, right panel). Because NFAT1 nuclear
translocation is regulated by its phosphorylation status, we further
examined whether 6-MF inhibits NFAT1 dephosphorylation, thus
limiting nuclear translocation of NFAT1. For this purpose, we
detected both phosphorylated and dephosphorylated forms of
NFAT1 in the cytoplasmic and nuclear extracts of ex vivo CD4+
T cells and examined nuclear translocation status of NFAT1.
Unstimulated ex vivo CD4+ T cells showed both phosphorylated
and dephosphorylated forms of NFAT1 in cytoplasm, whereas any
form of NFAT1 was hardly detected in the nuclear fraction (Fig.
4D). In contrast, PMA plus ionomycin stimulation induced NFAT1
dephosphorylation and translocation into the nucleus. CsA is
known to disrupt calcineurin activity that consequently inhibits
NFAT1 dephosphorylation. Indeed, CsA treatment inhibited nuclear translocation of NFAT1, resulting in a relatively increased
amount of accumulated phosphorylated NFAT1 in cytoplasm.
Interestingly, 6-MF did not inhibit NFAT1 dephosphorylation;
however, its translocation was greatly reduced (Fig. 4D). Similar,
but with lesser extent of inhibitory activity of 6-MF on NFAT2
was detected. Because NFAT1-mediated transcriptional activity is
dependent on the phosphorylation of 53SSPS56 site of NFAT1
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 1. Development of a T cell–based reporter screening system targeting IL-10 expression. (A) Analysis of CNS in the mouse IL-10 genomic locus
was conducted. Mouse DNA sequences were compared with human DNA sequences by the VISTA Genome Browser to identify the CNS locus. A black
arrow marks the CNS-9 and IL-10 minimal promoter region. (B) IL-10 minimal promoter containing the CNS-9 region was cloned into the upstream of
luciferase gene in pGL 4.17 reporter vector. (C) PCR was performed with genomic DNA from stable EL4 cell clones. CNS-9 region, neomycin-resistant
gene, and luciferase gene were detected. PCR products are separated by 1% agarose gel, and their locations are indicated with black arrows. Genomic DNA
from EL4 T cells was used as a negative control. (D) EL4 cells stably expressing luciferase under the control of CNS-9 were left unstimulated or were
stimulated with PMA (50 ng/ml)/ionomycin (1 mM) in the presence or absence of CsA for 4 h, and luciferase activity was measured with the Steady-Glo
reagent. All data are representative of three independent experiments with similar results. **p , 0.01.
2776
6-METHOXYFLAVONE INHIBITS NFAT TRANSLOCATION
transactivation domain, we thus further assessed whether 6-MF
inhibits phosphorylation of this site by using Ab that detects 54phosphoserine (30). 6-MF treatment did not affect phosphorylaTable I. Primer sequences used for qRT-PCR
Gene
Sequences (59-39)
Tm (˚C)
HPRT
F: TTATGGACAGGACTGAAAGAC
R: GCTTTAATGTAATCCAGCAGGT
F: GAGCCAGATTATCTCTTTCTACC
R: GTTGTTGACCTCAAACTTGG
F: TGAGCAGGATGGAGAATTACAGG
R: GTCCAAGTTCATCTTCTAGGCAC
F: CAACGAAGAACACCACAGAG
R: GGACTTGGACTCATTCATGG
F: AGCACAGTGGTGAAAGAGAC
R: TCCAATGCATAGCTGGTGATTT
F: GAAGACAATAACTGCACCCA
R: CAACCCAAGTAACCCTTAAAGTC
F: GCAACATCACACAAGACCAGA
R: GTCAGGGAATCCAGGGCTAC
F: CATCTTCTCAAAATTCGAGTGACAA
R: TGGGAGTAGACAAGGTACAAC
F: TCCGACAGTGGTTGATCGAC
R: CCTCACGATTGTAGTCCTGCTT
F: ATCTGCAGCATCCCTGTGAC
R: CTGCCCTCCGTCTCATAGTG
59.42
61.04
60.10
59.55
64.08
63.18
61.19
60.42
62.37
62.73
60.27
61.43
63.21
64.22
61.94
61.17
64.33
64.39
64.78
64.22
IFN-g
IL-2
IL-4
IL-5
IL-10
IL-13
TNF-a
IRF4
NFAT1
F, forward; R, reverse; Tm, melting temperature.
tion state and level of NFATs (Fig. 4D). Collectively, these results
suggest that the suppression of cytokine expression upon 6-MF
treatment is mediated by the inhibition of nuclear translocation of
NFAT1 in T cells without affecting its expression and phosphorylation level.
To further confirm the inhibitory effect of 6-MF on NFAT1
nuclear translocation, we performed immunocytochemistry analysis in primary Th2 cells. In the absence of stimulation, NFAT1
(green) remained in the cytoplasm (Supplemental Fig. 3). However, stimulation with anti-CD3 and anti-CD28 led to NFAT1
activation, resulting in an increase of NFAT1 translocation (yellow) into the nucleus (red) (Supplemental Fig. 3). Then we analyzed nuclear translocation of NFAT1 after treatment of 6-MF.
Stimulation of ex vivo CD4+ T cells with either anti-CD3 and antiCD28 or PMA plus ionomycin induced evident increase of NFAT1
in nucleus, whereas 6-MF treatment significantly inhibited NFAT1
translocation as much as the effects of CsA in both stimulation
conditions (Fig. 4E). These results indicate that 6-MF suppresses
cytokine expression by inhibiting nuclear translocation of NFAT1
in primary CD4+ T cells.
6-MF inhibits NFAT1 binding to regulatory elements of
cytokine genes
We hypothesized that the decreased translocation of NFAT1 by
6-MF treatment may result in the reduction of its binding capacity
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 2. Screening of compounds inhibiting the enhancer activity of CNS-9. (A) EL4 cells (6 3 105) that stably express CNS-9–based luciferase
activity were treated with DMSO vehicle (0.5%) or with single-compound libraries derived from diverse plant extracts. After 4 h of treatment, luciferase
activity was measured, and the results are expressed as percentage of relative luciferase activity by a comparison with untreated cells. Four compounds
showing .50% of inhibitory activity are selected. Data are the means of triplicates with SD and are representative of three independent experiments with
similar results. **p , 0.01. (B) The information of selected four compounds and (C) their chemical structure. To examine the effects of the four compounds
on cell viability, (D) EL4 T cells (1 3 104) or (E) primary T cell blasts (3 3 105) were incubated in 96-well plate in 100 ml T cell medium for 24 h and then
were treated with 10 ml indicated compounds (20 mM) for additional 24 h. The tetrazolium salt, WST-1 solution (10 ml), was added, and the plate was
incubated for 1 h. The absorbance was measured at 450 nm. Results are presented as a percentage of relative cell viability by comparing with untreated
cells. Data are representative of three independent experiments with similar results.
The Journal of Immunology
2777
to the regulatory element region, thereby resulting in the downregulation of its target cytokines. To confirm this, we analyzed the effect
of 6-MF treatment on in vivo binding of NFAT1 in Th2 cells using
ChIP analysis with primer shown in Table II. NFAT1 binding to CNS-9
was increased by ∼5-fold upon PMA/ionomycin stimulation, which
was significantly inhibited by 6-MF treatment (Fig. 5A). Similarly,
binding of NFAT1 to IL-4 promoter region was also decreased in
6-MF–treated Th2 cells (Fig. 5B). As a control for NFAT1 specificity,
we confirmed that 6-MF treatment did not affect the NFAT1 binding
to the GATA3 binding site in IL-4 promoter (Fig. 5B). We also examined the effect of 6-MF treatment on in vitro binding of NFAT1
to the CNS-9 element by performing EMSA using the primer
shown in Table III. Nuclear extracts of stimulated Th2 cells showed
an increased binding to DNA probes containing NFAT consensus or
NFAT binding sites from the CNS-9 sequences, as compared with
nonstimulated cells (Fig. 5C, lanes 1, 2, 7, and 8). However, treatment of 6-MF decreased the extent of NFAT1 binding to these DNA
probes (Fig. 5C, lanes 3 and 9). This NFAT1 binding was inhibited by
the presence of competitor probes (Fig. 5C, lanes 4, 5, 10, and 11).
Although anti-NFAT1 Ab did not induce a supershift of DNA probes
and nuclear extract complex, it decreased the intensity of the complex
in comparison with the PMA plus ionomycin–treated nuclear extract
(Fig. 5C, lanes 6 and 12). Treatment of 6-MF decreased the extent of
NFAT1 binding to these DNA probes (Fig. 5C, lanes 3 and 9). Collectively, these results suggest that 6-MF treatment inhibits NFAT1
binding to the NFAT-responsive regulatory region of cytokine genes.
6-MF inhibits NFAT1 activity regardless of its phosphorylation
status
NFAT activation is mediated by sequential events. Stimulation
activates calcineurin-dependent dephosphorylation of NFATs that
results in their translocation into the nucleus. Therefore, we investigated whether 6-MF inhibits nuclear translocation of NFAT
by disruption of the dephosphorylation process. To analyze this
possibility, we performed reporter analysis in EL4 cells in the
presence of CA-NFAT1 that has multiple serine to alanine mutations in the NFAT1 regulatory domain. Hence, the activity of CANFAT1 is independent of its phosphorylation status (30). We
reasoned that if 6-MF regulates NFAT1 activation by preventing
its dephosphorylation, it would not inhibit the transactivity of CANFAT1. Although overexpression of CA-NFAT1 induced much
higher increase of luciferase activity than NFAT1 in the absence of
stimulation, it showed similar levels of enhancer activity of CNS-9
after stimulation (Fig. 6A). Interestingly, 6-MF treatment still
inhibited luciferase activity of CNS-9 even in the presence of
CA-NFAT1 (Fig. 6A). This result indicates that inhibition of nuclear translocation of NFAT1 by 6-MF is not mediated by affecting dephosphorylation of NFAT1. To confirm this result, we
analyzed 6-MF activity on the IL-2 promoter reporter construct,
which contains three tandem repeats of NFAT-binding sequence.
Similar to the result of CNS-9 reporter system, 6-MF reduced
the luciferase activity of IL-2 promoter even in the presence of
CA-NFAT1 (Fig. 6B). To minimize the effect of endogenously
expressed NFAT1, we performed the same experiments in HEK
293T cells. Overexpression of CA-NFAT1 effectively increased
the luciferase activity in HEK 293T cells (Fig. 6C, 6D), which was
significantly inhibited by 6-MF treatment. As expected, CsA
greatly reduced luciferase activity of IL-2 promoter in the presence of NFAT1 in both cell lines; however, it failed to inhibit the
activity of CA-NFAT1, which was more evidently observed in
HEK 293T cells (Fig. 6C, 6D, black bar). These results imply that
the regulatory mechanism of 6-MF on NFAT1 activity might be
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 3. 6-MF inhibits cytokine expression by activated T cells. (A and C) EL4 T cells and in vitro differentiated Th1 or Th2 cells (2 3 106) were pretreated
with medium and DMSO vehicle (0.5%) or 6-MF (20 mM) for 1 h, and then the cells were left unstimulated or were stimulated with PMA (50 ng/ml) plus
ionomycin (1 mM) for 2 h. Cytokine mRNA level was analyzed using qRT-PCR and was normalized using the expression level of HPRT. Data are presented as
a percentage of relative mRNA levels by comparison with vehicle-treated cells. The results are the means of triplicates with SD. All data are representative of three
independent experiments with similar results. *p , 0.05, **p , 0.01. (B and D) In vitro differentiated Th2 cells (1 3 106) were pretreated with medium and
DMSO vehicle or 6-MF for 1 h, and then the cells were left unstimulated or were stimulated with PMA plus ionomycin for 24 h. Intracellular levels of IL-10 and
IL-4 were analyzed using flow cytometry. Isotype IgG was used as a control. All data are representative of three independent experiments with similar results.
2778
6-METHOXYFLAVONE INHIBITS NFAT TRANSLOCATION
different from that of CsA, which inhibits calcineurin activity. We
have further confirmed this possibility by immunocytochemistry
analysis. HEK 293T cells were transfected with either NFAT1- or
CA-NFAT1–expressing constructs in the absence or presence of
6-MF. Similar to our finding with ex vivo CD4+ T cells (Fig. 4E), we
also found that overexpressed NFAT1 was localized in the nucleus
Table II. Primer sequences used for chromatin immunoprecipitation
Gene
CNS-9
IL-4 promoter (NFAT binding)
IL-4 promoter (GATA3 binding)
Sequences (59-39)
Tm (˚C)
Size (bp)
F: CTTGAGGAAAAGCCAGCATC
R: TCTGGAAGTGCCATTCTGTA
F: AGGCCGATTATGGTGTAATTT
R: GAGTTAAAGTTGCTGAAACCA
F: ACTCATTTTCCCTTGGTTTCAGC
R: GATTTTTGTCGCATCCGTGG
61.63
60.87
59.83
59.01
63.86
62.58
200
F, forward; R, reverse; Tm, melting temperature.
227
209
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 4. Treatment of 6-MF reduces nuclear translocation of NFAT1 in T cells. (A) EL4 T cells (3 3 106) were transfected with the indicated CNS-9
reporter construct together with the NFAT1 expression vector. After 12 h of transfection, the cells were pretreated with DMSO vehicle (0.5%) or 6-MF
(5, 10, or 20 mM) for 1 h and then were left unstimulated or were stimulated with PMA (50 ng/ml) plus ionomycin (1 mM) for 24 h. Luciferase activity is
expressed relative to the expression of a cotransfected Renilla luciferase plasmid (pRL-TK) as a control for transfection efficiency. Results are expressed as
fold differences relative to luciferase activity of CNS-9 reporter in unstimulated cells. The results are the means of triplicates with SD. All data are
representative of three independent experiments with similar results. *p , 0.05, **p , 0.01. (B) Relative NFAT1 mRNA level was analyzed in in vitro
differentiated Th2 cells (2 3 106) stimulated with PMA plus ionomycin for 2 h in the presence or absence of 6-MF. Data are presented as a percentage of
relative mRNA level by comparing with DMSO vehicle-treated cells. The results are the means of triplicates with SD. All data are representative of three
independent experiments with similar results. (C) Th2 cells were stimulated with PMA plus ionomycin for 2 h for total cell lysate extraction or for 1 h for
nuclear extraction in the presence or absence of 6-MF. b-actin or lamin B was analyzed as a control for protein loading and nuclear extraction. (D) Ex vivo
CD4+ T cells were stimulated with PMA plus ionomycin for 20 min for cytoplasmic and nuclear extracts in the presence or absence of CsA or 6-MF.
Intensity of individual bands was quantified, normalized, and expressed relative to the quantity of their respective loading control. (E) CD4+ T cells were left
unstimulated or stimulated with anti-CD3 Ab (1 mg/ml) and anti-CD28 Ab (2 mg/ml) for 2 h or PMA plus ionomycin for 20 min in the presence or absence
of 6-MF or CsA, as indicated. NFAT localization was analyzed using immunocytochemistry and confocal microscopy (original magnification 31000). All
images shown are representative of three independent experiments with similar results.
The Journal of Immunology
2779
upon stimulation, which was inhibited by CsA or 6-MF treatment
(Fig. 6E, left panel). In contrast, overexpressed CA-NFAT1 was
mainly detected in the nucleus regardless of stimulation. CsA
treatment did not prevent the translocation of CA-NFAT1 into
nucleus. Interestingly, however, 6-MF treatment inhibited the
translocation of CA-NFAT1 into nucleus. These results collectively suggest that 6-MF treatment could inhibit NFAT1-mediated
transactivity in diverse target genes.
6-MF inhibits effector function of T and B cells in AD-induced
mice
Next, we evaluated the therapeutic potential of 6-MF as an immunomodulatory agent by inhibiting NFAT1 translocation. AD is
known as a chronic inflammatory skin disease mediated by Th2type immune responses, thereby showing increased levels of IgE
and Th2-type cytokines such as IL-4, IL-5, and IL-13 (31).
Moreover, the chronic stage of skin inflammation shows production of proinflammatory cytokines such as IFN-g and TNF-a (32).
We tested whether 6-MF treatment could suppress the expression
of those cytokines produced by lymphocytes of AD mice (29).
CD4+ T cells and CD19+ B cells isolated from AD mice were
Table III. Probe sequences used for EMSA
Gene
Sequences (59-39)
NFAT
F: GATCGCGGAAAGAGGAAAATTTGTTTCATACAG
R: CTGTATGAAACAAATTTTCCACTTTGGGCGATC
F: AGGACGGCGAGAAGGAAACACAGGTGAACACGC
R: GCGTGTTCACCTGTGTTTCCTTCTCGCCGTCCT
CNS-9
F, forward; R, reverse.
stimulated in the presence or absence of 6-MF, and then the
effects of 6-MF treatment on lymphocyte proliferation and cytokine and IgE production were analyzed. qRT-PCR analysis was
performed using the primers shown in Table I. As shown in Fig.
7A, 6-MF treatment significantly downregulated the expressions
of Th1- and Th2-type cytokines from CD4+ T cells stimulated
with PMA plus ionomycin. Moreover, 6-MF treatment inhibited
proliferation of T cells and B cells by up to ∼55 and 40%, respectively (Fig. 7B).
Elevated IgE level in serum is a diagnostic marker of AD.
Consistent with this, experimental mice model showed increased
IgE level after 2 wk of disease induction (data not shown).
Therefore, we assessed whether 6-MF has a regulatory activity on
IgE production by B cells. B cells isolated from mice with AD
produced considerable amounts of IgE. This was further increased by stimulation with LPS and IL-4 (Fig. 7C). Interestingly,
6-MF treatment on B cells effectively decreased IgE production
(Fig. 7C). Because T cells are important for activation, differentiation, and immune responses of B cells, we examined the
effect of 6-MF on IgE production from B cells after coculturing
with T cells. T cells isolated from AD mice were activated
by stimulation with anti-CD3 and anti-CD28 in the presence
or absence of 6-MF for 24 h and were washed with T cell media
three times. Then B cells were cocultured with these T cells
in the presence of LPS and IL-4 for 72 h. Coculturing of
B cells with activated T cells increased IgE production by
∼2-fold as compared with unstimulated T cells (Fig. 7D).
However, 6-MF–treated T cells could not induce an increase in
IgE production by B cells (Fig. 7D). These data indicate that
6-MF acts as an immunomodulator by inhibiting NFAT-mediated
lymphocyte activation.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 5. 6-MF inhibits NFAT1 binding to the regulatory elements of cytokine genes. (A and B) Th2 cells (1 3 107) were left unstimulated or were
stimulated with PMA plus ionomycin for 1 h in the absence or presence of 6-MF. ChIP assay was performed using anti-NFAT1 Ab or isotype IgG Ab. The
levels of precipitated DNA normalized by input DNA were measured using qRT-PCR with specific primers of IL-10 CNS-9 region (A) and IL-4 promoter region
(B). Results were presented as a relative level by comparing with quantitative level of target locus in IgG sample. IgG was used as a control for the specificity of
the Ab. Data are the means of triplicates with SD. All the data shown are representative of three independent experiments with similar results. *p , 0.05. (C)
EMSA was performed using specific probes, as indicated in the figure. Th2 cells (1 3 107) were left unstimulated or were stimulated with PMA plus ionomycin
for 1 h in the presence or absence of 6-MF. Nuclear extracts were prepared, as explained in Materials and Methods. Competitor oligomer or Abs were added, as
indicated. Protein binding to the probe was marked with black arrow. CNS-9 probe was designed to contain NFAT binding sites. Probe containing NFAT
consensus sequences was used as a positive control. All the data shown are representative of three independent experiments with similar results.
2780
6-METHOXYFLAVONE INHIBITS NFAT TRANSLOCATION
Oral administration of 6-MF ameliorates AD
Immunosuppressive effects of 6-MF on lymphocytes led us to test
whether 6-MF can suppress the disease onset and progression of
AD. The induction of experimental AD and its treatment strategy
are depicted in Fig. 8A. CsA was employed as a positive control to
compare the therapeutic effects of 6-MF. CsA or 6-MF treatment
significantly reduced AD symptoms, including erythema, horny
substance, dryness, and scaling (data not shown). We also performed H&E staining on atopic ears excised from different treatment groups (Fig. 8B). In comparison with control mice, 6-MF
treatment significantly reduced the infiltration of lymphocytes
and granulocytes, which was well reflected by decreased thickness of the epidermis (Fig. 8B). 6-MF treatment also significantly
decreased the IgE levels with comparable efficacy to CsA treatment (Fig. 8C). These results indicate that 6-MF has a therapeutic
potential to ameliorate AD progression.
Discussion
In this study, we developed a novel screening system that targeted
NFAT-mediated transactivation of CNS-9 and identified a novel
function of 6-MF as an inhibitor of the nuclear translocation of
NFAT1. Treatment of 6-MF suppressed the expression of known
NFAT1 target genes, such as IL-10, IL-4, and IFN-g, by inhibiting
NFAT1 nuclear translocation without altering its expression level.
Furthermore, 6-MF treatment inhibited the effector function of
T and B cells isolated from AD-induced mice. Oral administration
of 6-MF significantly ameliorated AD progression and disease
severity.
Previous studies showed that natural phenolic compounds possess a variety of biological properties, such as antioxidant, antiinflammation, and anticancer activities (21, 22). Recent studies
also indicated that natural polyphenols can act as modulators of
signal transduction by inhibiting the activity of various enzymes and
transcription factors (23, 24). However, the action mechanisms,
including identification of the molecular target(s) underlying these
biological activities, are not yet fully understood. In this study, we
have identified a small, novel natural product inhibitor of NFAT.
Previously, we elucidated the molecular mechanism of IL-10 transcription in T cells (25, 33, 34). A distal cis-acting element, CNS-9,
acts as an enhancer by recruiting NFAT1 and IRF4, thus increasing
IL-10 transcription in Th2 cells (25). Based on this information, we
have developed a genetically modified cell-based screening system
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 6. 6-MF inhibits NFAT1 activity regardless of its phosphorylation status. EL4 (A and B) or HEK 293T (C and D) cells were transfected with the
indicated plasmid, such as vector alone (pXPG), IL-10 minimal promoter, CNS-9 reporter construct (A and C), or IL-2 promoter luciferase reporter vector
(B and D) together with mock and NFAT1 and CA-NFAT1 expression vectors, as indicated. After 12-h rest, cells were left unstimulated or were stimulated with
PMA plus ionomycin in the presence or absence of 6-MF or CsA for 24 h. Results are expressed as relative luciferase units by comparison with the luciferase
activity of vector alone in unstimulated cells. All data are the means of triplicates with SD and are representative of three independent experiments that
produced similar results. *p , 0.05, ** p , 0.01. (E) HEK 293T cells were transfected with NFAT1 or CA-NFAT1 expression vectors and then were
stimulated with PMA plus ionomycin for 20 min in the presence or absence of CsA or 6-MF. NFAT1 localization was analyzed using immunocytochemistry
and confocal microscopy (original magnification 3300). All images shown are representative of three independent experiments with similar results.
The Journal of Immunology
2781
that targets CNS-9 regulatory factors and have performed screening of a chemical library derived from plant extracts. We identified
four compounds that efficiently inhibited IL-10 reporter activity
(Fig. 2A) as well as IL-10 expression, namely 6-MF, 7-hydroxyflavone, baicalein, and formononetin. Interestingly, all the hit
compounds possess a common flavone moiety (Fig. 2C). Among
these hit compounds, 6-MF was the most effective in suppressing
CNS-9–mediated luciferase activity and IL-10 expression in EL4
T cells and primary Th2 cells (Fig. 3A, 3B) without inducing cytotoxicity (Fig. 2D, 2E). Interestingly, the inhibitory effect of 6-MF
on cytokine expression was not restricted to IL-10. Treatment of
6-MF effectively inhibited the expression of IL-4, IL-13, and IFN-g
to a similar extent as inhibition of IL-10 expression (Fig. 3).
Therefore, we hypothesized that 6-MF does not interact directly
with CNS-9 itself; rather, it may modulate regulatory molecules,
including enzymes involved in the signaling pathways or transcription factors that affect both the enhancer activity of CNS-9 and
the expression of multiple cytokines. In light of the evidences from
our previous studies (25, 34) and the finding that NFAT1 and IRF4
play diverse roles in regulating multiple cytokine expressions (25,
35–37), we examined the possibility that 6-MF inhibits the activation of NFAT1 and IRF4 by affecting their expression level or nuclear translocation. Our results indicate that 6-MF regulates NFAT1
activity by inhibiting the translocation of NFAT1 into the nucleus
(Fig. 4C–E) and, consequently, its binding to its target gene loci.
6-MF also inhibited IRF4-mediated transcriptional activity without
interfering with its nuclear translocation and expression level
(Supplemental Fig. 2). Although the underlying mechanism of the
inhibition of IRF4 transcriptional activity by 6-MF treatment is still
unclear, there are several possibilities. 6-MF treatment may inhibit
the functional synergism between NFAT1 and IRF4 in upregulating
the enhancer activity of CNS-9. IRF4 often functions as a contextdependent transcription factor depending on its binding partner.
Indeed, the IRF4 alone showed a weak transactivity, whereas its
transactivity was synergized when it was coupled with NFAT1 (25).
In addition, the finding that 6-MF can inhibit the activity of
CA-NFAT1 further suggests that 6-MF may not interrupt the dephosphorylation of NFAT1, but somehow regulates the translocation
of NFAT1 via another mechanism (Fig. 6). The inhibitory effect of
6-MF may not be limited to NFAT1 because 6-MF treatment also
inhibited nuclear translocation of NFAT2 (Fig. 4D. Although the
dose-dependent inhibitory effect of 6-MF on the nuclear translocation of NFAT was observed (Figs. 4, 6), modification of its
chemical structure is needed to improve its activity. In addition,
further studies are needed to delineate the precise molecular mechanism of 6-MF that interferes with the nuclear translocation of NFAT,
but we believe that this type of detailed investigation lies beyond
the scope of current study.
Flavonoids have been reported to exert beneficial effects in many
diseases, including cancer, cardiovascular disease, and neurode-
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 7. 6-MF inhibits the effector function of T and B cells isolated from atopic mice. Experimental AD was induced in BALB/c, as described in
Materials and Methods. CD4+ T cells and CD19+ B cells were isolated from AD mice. CD4+ T cells were stimulated with PMA (50 ng/ml) plus ionomycin
(1 mM) or anti-CD3 Ab (1 mg/ml) and anti-CD28 Ab (2 mg/ml), as indicated. CD19+ B cells were stimulated with PMA (50 ng/ml) plus ionomycin (2 mM)
or LPS (50 mg/ml) and IL-4 (25 ng/ml), as indicated. DMSO (0.5%) or 6-MF (20 mM) was pretreated 1 h before stimulation. (A) After 2-h stimulation,
cytokine mRNA level was analyzed using qRT-PCR and was normalized by the expression level of HPRT. Results are expressed as a percentage of relative
mRNA level by comparison with the mRNA level of DMSO-treated T cells. (B) Proliferation of T cells (left panel) and B cells (right panel) isolated from
AD mice was measured. Cells were stimulated as indicated, and thymidine incorporation was measured at the end of the 72-h culture. (C) B cells were
stimulated for 48 h, and IgE level in the culture supernatants was measured using ELISA. (D) T cell–dependent IgE production by B cells was measured.
Preactivated T cells by anti-CD3/anti-CD28 stimulation in the presence or absence of 6-MF were cocultured with B cells in the presence of LPS and IL-4.
IgE level in the culture supernatants was measured using ELISA. All the data are the means of triplicates with SD. All the data are representative of three
independent experiments that produced similar results. *p , 0.05, **p , 0.01.
2782
6-METHOXYFLAVONE INHIBITS NFAT TRANSLOCATION
generative disorders (21, 22, 38). Their biological potential is
mainly dependent on their antioxidant properties associated with
free hydroxyl groups (39). A flavone subclass, in which all hydroxyl groups are capped by methylation, showed higher metabolic stability and membrane transport in the intestine and liver,
thus improving oral bioavailability (40, 41). Recent studies have
suggested the potential of methoxyflavone as a therapeutic agent.
7-Methoxyflavone showed a greater inhibitory effect on PGE2
production from LPS-stimulated RAW cells, with the highest
membrane permeability when compared with similar flavones
possessing hydroxyl groups or multiple methoxyl groups (42).
Another group reported that 5-methoxyflavone enhanced TRAILinduced apoptosis in human leukemic cells by upregulating the expression of cell death receptors and mitochondrial pathways (43).
The biological activity of 6-MF and its regulatory mechanism
have not been reported. The inhibitory effects of 6-MF on the
nuclear translocation of NFAT1 without altering its phosphorylation status have a great potential as an immunomodulator in
controlling NFAT-mediated T cell responses. In fact, the potential
of NFAT as a therapeutic target has been supported by the findings
that SCID is related to the impairment in NFAT activation and to
a relatively short duration of nuclear residence (12, 13). Patients
with the SCID phenotype are characterized by a defect in the
T cell immune response, such as altered cytokine production.
Thus, in a retrospective point of view, NFAT could be an effective
target for ameliorating graft rejection in transplanted hosts and
autoimmune diseases caused by inappropriate T cell immunity
(19). Calcineurin is the phosphatase known to activate NFAT in
the immune system; therefore, calcineurin inhibitors, such as CsA
and FK506, have been widely used for this purpose (17, 18).
Despite their clinical significances, the application of these drugs
is restricted only to serious clinical situations due to their severe
side effects (19). Several groups have reported selective inhibitors
as alternatives to CsA (44–47). Because NFAT1 is not the only
transcription factor regulated by calcineurin, these inhibitors were
demonstrated as selective inhibitors of the calcineurin-NFAT
signaling pathway without disrupting general calcineurin phosphatase activity. In addition, some natural compounds, such as
quercetin and kaempferol, have been reported to have calcineurininhibitory activity with less toxicity and relatively reduced doses
(48, 49). Considering the common characteristics of newly reported inhibitors of the calcineurin–NFAT signaling pathway,
6-MF may have several advantages over classical calcineurin
inhibitors, as follows: 1) it could inhibit translocation of NFAT1
without affecting dephosphorylation, which implies that it may
not inhibit the enzymatic activity of calcineurin; 2) it is a natural
compound with low cytotoxicity; and 3) it has a relatively small
size. Our study applying 6-MF in T cells and B cells isolated from
an AD model also suggests that 6-MF suppresses the proliferation
of activated T cells, reduces cytokine production from T cells, and
possibly regulates B cell activity indirectly, via inhibition of T cell
activity (Fig. 7). Furthermore, oral administration of 6-MF to AD
mice shows beneficial effects, such as reduction in the general
symptoms of AD and serum IgE levels (Fig. 8).
In conclusion, in this study, we describe that 6-MF inhibits
NFAT-mediated T cell activation via the inhibition of NFAT1
translocation into the nucleus that consequently interrupts NFAT1
binding to its target genes. The therapeutic potency of 6-MF was
also assessed using the AD mice model by ameliorating a range of
AD symptoms. Thus, our results show that 6-MF could be a potentially effective immunomodulatory agent against diseases involving NFAT-mediated T cell dysregulation.
Acknowledgments
We thank laboratory colleagues for valuable comments on the work and
Dr. Darren Williams of Gwangju Institute of Science and Technology for
critical review of the manuscript.
Disclosures
The authors have no financial conflicts of interest.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
FIGURE 8. Oral administration of 6-MF ameliorates AD. (A) Experimental AD was induced on both ears of BALB/c mice by alternate painting of
dinitrochlorobenzene and mite extract for 6 wk. After the initial dinitrochlorobenzene sensitization, control (DMSO), CsA (5 mg/kg), and 6-MF (20 or 100
mg/kg) delivered with 1% DMSO were administered orally five times per week for 6 wk. (B) Infiltrating lymphocytes into the ears were observed by H&E
staining. Infiltrating lymphocytes and thickness of epidermis were observed under the microscope (original magnification 3100 and 3200). (C) After 6 wk
of AD induction, sera were obtained from each group, and the levels of total IgE were measured using ELISA. All the data are the means of triplicates with
SD. All the data are representative of three independent experiments that produced similar results. **p , 0.01.
The Journal of Immunology
References
26. So, J.-S., H.-K. Kwon, C.-G. Lee, H.-J. Yi, J.-A. Park, S.-Y. Lim, K.-C. Hwang,
Y. H. Jeon, and S.-H. Im. 2008. Lactobacillus casei suppresses experimental
arthritis by down-regulating T helper 1 effector functions. Mol. Immunol. 45:
2690–2699.
27. Nelson, J. D., O. Denisenko, and K. Bomsztyk. 2006. Protocol for the fast
chromatin immunoprecipitation (ChIP) method. Nat. Protoc. 1: 179–185.
28. Hellman, L. M., and M. G. Fried. 2007. Electrophoretic mobility shift assay
(EMSA) for detecting protein-nucleic acid interactions. Nat. Protoc. 2: 1849–1861.
29. Kwon, H.-K., C.-G. Lee, J.-S. So, C.-S. Chae, J.-S. Hwang, A. Sahoo, J. H. Nam,
J. H. Rhee, K.-C. Hwang, and S.-H. Im. 2010. Generation of regulatory dendritic
cells and CD4+Foxp3+ T cells by probiotics administration suppresses immune
disorders. Proc. Natl. Acad. Sci. USA 107: 2159–2164.
30. Okamura, H., J. Aramburu, C. Garcı́a-Rodrı́guez, J. P. B. Viola, A. Raghavan,
M. Tahiliani, X. Zhang, J. Qin, P. G. Hogan, and A. Rao. 2000. Concerted dephosphorylation of the transcription factor NFAT1 induces a conformational
switch that regulates transcriptional activity. Mol. Cell 6: 539–550.
31. Grewe, M., C. A. Bruijnzeel-Koomen, E. Schöpf, T. Thepen, A. G. LangeveldWildschut, T. Ruzicka, and J. Krutmann. 1998. A role for Th1 and Th2 cells in
the immunopathogenesis of atopic dermatitis. Immunol. Today 19: 359–361.
32. Leung, D. Y., M. Boguniewicz, M. D. Howell, I. Nomura, and Q. A. Hamid.
2004. New insights into atopic dermatitis. J. Clin. Invest. 113: 651–657.
33. Lee, C.-G., H.-K. Kwon, A. Sahoo, W. Hwang, J.-S. So, J.-S. Hwang, C.-S. Chae,
G.-C. Kim, J.-E. Kim, H.-S. So, et al. 2012. Interaction of Ets-1 with HDAC1
represses IL-10 expression in Th1 cells. J. Immunol. 188: 2244–2253.
34. Lee, C.-G., W. Hwang, K.-E. Maeng, H.-K. Kwon, J.-S. So, A. Sahoo, S. H. Lee,
Z. Y. Park, and S.-H. Im. 2011. IRF4 regulates IL-10 gene expression in CD4(+)
T cells through differential nuclear translocation. Cell. Immunol. 268: 97–104.
35. Lohoff, M., H.-W. Mittr€ucker, S. Prechtl, S. Bischof, F. Sommer, S. Kock,
D. A. Ferrick, G. S. Duncan, A. Gessner, and T. W. Mak. 2002. Dysregulated T
helper cell differentiation in the absence of interferon regulatory factor 4. Proc.
Natl. Acad. Sci. USA 99: 11808–11812.
36. Ahyi, A.-N. N., H.-C. Chang, A. L. Dent, S. L. Nutt, and M. H. Kaplan. 2009.
IFN regulatory factor 4 regulates the expression of a subset of Th2 cytokines. J.
Immunol. 183: 1598–1606.
37. Savignac, M., B. Mellström, and J. R. Naranjo. 2007. Calcium-dependent
transcription of cytokine genes in T lymphocytes. Pflugers Arch. 454: 523–533.
38. Spencer, J. P. E., K. Vafeiadou, R. J. Williams, and D. Vauzour. 2012. Neuroinflammation: modulation by flavonoids and mechanisms of action. Mol. Aspects
Med. 33: 83–97.
39. Heim, K. E., A. R. Tagliaferro, and D. J. Bobilya. 2002. Flavonoid antioxidants:
chemistry, metabolism and structure-activity relationships. J. Nutr. Biochem. 13:
572–584.
40. Walle, T. 2007. Methoxylated flavones, a superior cancer chemopreventive flavonoid subclass? Semin. Cancer Biol. 17: 354–362.
41. Walle, T., N. Ta, T. Kawamori, X. Wen, P. A. Tsuji, and U. K. Walle. 2007.
Cancer chemopreventive properties of orally bioavailable flavonoids—methylated versus unmethylated flavones. Biochem. Pharmacol. 73: 1288–1296.
42. Kaneko, T., H. Chiba, N. Horie, T. Kato, M. Kobayashi, K. Hashimoto,
K. Kusama, and H. Sakagami. 2010. Inhibition of prostaglandin E2 production
by flavone and its related compounds. In Vivo 24: 55–58.
43. Wudtiwai, B., B. Sripanidkulchai, P. Kongtawelert, and R. Banjerdpongchai.
2011. Methoxyflavone derivatives modulate the effect of TRAIL-induced apoptosis in human leukemic cell lines. J. Hematol. Oncol. 4: 52–62.
44. Roehrl, M. H. A., S. Kang, J. Aramburu, G. Wagner, A. Rao, and P. G. Hogan.
2004. Selective inhibition of calcineurin-NFAT signaling by blocking proteinprotein interaction with small organic molecules. Proc. Natl. Acad. Sci. USA
101: 7554–7559.
45. Mulero, M. C., A. Aubareda, M. Orzáez, J. Messeguer, E. Serrano-Candelas,
S. Martı́nez-Hoyer, A. Messeguer, E. Pérez-Payá, and M. Pérez-Riba. 2009.
Inhibiting the calcineurin-NFAT (nuclear factor of activated T cells) signaling
pathway with a regulator of calcineurin-derived peptide without affecting general calcineurin phosphatase activity. J. Biol. Chem. 284: 9394–9401.
46. Trevillyan, J. M., X. G. Chiou, Y.-W. Chen, S. J. Ballaron, M. P. Sheets,
M. L. Smith, P. E. Wiedeman, U. Warrior, J. Wilkins, E. J. Gubbins, et al. 2001.
Potent inhibition of NFAT activation and T cell cytokine production by novel low
molecular weight pyrazole compounds. J. Biol. Chem. 276: 48118–48126.
47. Aramburu, J., M. B. Yaffe, C. López-Rodrı́guez, L. C. Cantley, P. G. Hogan, and
A. Rao. 1999. Affinity-driven peptide selection of an NFAT inhibitor more selective than cyclosporin A. Science 285: 2129–2133.
48. Wang, H., C.-L. Zhou, H. Lei, and Q. Wei. 2010. Inhibition of calcineurin by
quercetin in vitro and in Jurkat cells. J. Biochem. 147: 185–190.
49. Wang, H., C. L. Zhou, H. Lei, S. D. Zhang, J. Zheng, and Q. Wei. 2008.
Kaempferol: a new immunosuppressant of calcineurin. IUBMB Life 60: 549–554.
Downloaded from http://www.jimmunol.org/ by guest on August 3, 2017
1. Rao, A., C. Luo, and P. G. Hogan. 1997. Transcription factors of the NFAT
family: regulation and function. Annu. Rev. Immunol. 15: 707–747.
2. Chen, L., J. N. Glover, P. G. Hogan, A. Rao, and S. C. Harrison. 1998. Structure
of the DNA-binding domains from NFAT, Fos and Jun bound specifically to
DNA. Nature 392: 42–48.
3. Feske, S., H. Okamura, P. G. Hogan, and A. Rao. 2003. Ca2+/calcineurin signalling in cells of the immune system. Biochem. Biophys. Res. Commun. 311:
1117–1132.
4. Gwack, Y., S. Feske, S. Srikanth, P. G. Hogan, and A. Rao. 2007. Signalling to
transcription: store-operated Ca2+ entry and NFAT activation in lymphocytes.
Cell Calcium 42: 145–156.
5. Hogan, P. G., L. Chen, J. Nardone, and A. Rao. 2003. Transcriptional regulation
by calcium, calcineurin, and NFAT. Genes Dev. 17: 2205–2232.
6. Macian, F. 2005. NFAT proteins: key regulators of T-cell development and
function. Nat. Rev. Immunol. 5: 472–484.
7. Fathman, C. G., and N. B. Lineberry. 2007. Molecular mechanisms of CD4+ Tcell anergy. Nat. Rev. Immunol. 7: 599–609.
8. Ranger, A. M., M. Oukka, J. Rengarajan, and L. H. Glimcher. 1998. Inhibitory
function of two NFAT family members in lymphoid homeostasis and Th2 development. Immunity 9: 627–635.
9. Kiani, A., J. P. Viola, A. H. Lichtman, and A. Rao. 1997. Down-regulation of
IL-4 gene transcription and control of Th2 cell differentiation by a mechanism
involving NFAT1. Immunity 7: 849–860.
10. Yoshida, H., H. Nishina, H. Takimoto, L. E. Marengère, A. C. Wakeham,
D. Bouchard, Y. Y. Kong, T. Ohteki, A. Shahinian, M. Bachmann, et al. 1998.
The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2
cytokine production. Immunity 8: 115–124.
11. Hodge, M. R., A. M. Ranger, F. Charles de la Brousse, T. Hoey, M. J. Grusby,
and L. H. Glimcher. 1996. Hyperproliferation and dysregulation of IL-4 expression in NF-ATp-deficient mice. Immunity 4: 397–405.
12. Feske, S., R. Draeger, H. H. Peter, K. Eichmann, and A. Rao. 2000. The duration
of nuclear residence of NFAT determines the pattern of cytokine expression in
human SCID T cells. J. Immunol. 165: 297–305.
13. Feske, S., J. M. M€
uller, D. Graf, R. A. Kroczek, R. Dräger, C. Niemeyer,
P. A. Baeuerle, H. H. Peter, and M. Schlesier. 1996. Severe combined immunodeficiency due to defective binding of the nuclear factor of activated T cells in
T lymphocytes of two male siblings. Eur. J. Immunol. 26: 2119–2126.
14. Kiani, A., F. J. Garcı́a-Cózar, I. Habermann, S. Laforsch, T. Aebischer,
G. Ehninger, and A. Rao. 2001. Regulation of interferon-g gene expression by
nuclear factor of activated T cells. Blood 98: 1480–1488.
15. Chow, C. W., M. Rincón, and R. J. Davis. 1999. Requirement for transcription
factor NFAT in interleukin-2 expression. Mol. Cell. Biol. 19: 2300–2307.
16. Agarwal, S., O. Avni, and A. Rao. 2000. Cell-type-restricted binding of the transcription factor NFAT to a distal IL-4 enhancer in vivo. Immunity 12: 643–652.
17. Schreiber, S. L., and G. R. Crabtree. 1992. The mechanism of action of cyclosporin A and FK506. Immunol. Today 13: 136–142.
18. Bierer, B. E., G. Holländer, D. Fruman, and S. J. Burakoff. 1993. Cyclosporin A
and FK506: molecular mechanisms of immunosuppression and probes for
transplantation biology. Curr. Opin. Immunol. 5: 763–773.
19. Kiani, A., A. Rao, and J. Aramburu. 2000. Manipulating immune responses with
immunosuppressive agents that target NFAT. Immunity 12: 359–372.
20. Havsteen, B. H. 2002. The biochemistry and medical significance of the flavonoids. Pharmacol. Ther. 96: 67–202.
21. Middleton, E., Jr., C. Kandaswami, and T. C. Theoharides. 2000. The effects of
plant flavonoids on mammalian cells: implications for inflammation, heart disease, and cancer. Pharmacol. Rev. 52: 673–751.
22. Garcı́a-Lafuente, A., E. Guillamón, A. Villares, M. A. Rostagno, and
J. A. Martı́nez. 2009. Flavonoids as anti-inflammatory agents: implications in
cancer and cardiovascular disease. Inflamm. Res. 58: 537–552.
23. Cortes, J. R., M. Perez-G, M. D. Rivas, and J. Zamorano. 2007. Kaempferol
inhibits IL-4-induced STAT6 activation by specifically targeting JAK3. J.
Immunol. 179: 3881–3887.
24. Nicholas, C., S. Batra, M. A. Vargo, O. H. Voss, M. A. Gavrilin, M. D. Wewers,
D. C. Guttridge, E. Grotewold, and A. I. Doseff. 2007. Apigenin blocks
lipopolysaccharide-induced lethality in vivo and proinflammatory cytokines
expression by inactivating NF-kappaB through the suppression of p65 phosphorylation. J. Immunol. 179: 7121–7127.
25. Lee, C.-G., K.-H. Kang, J.-S. So, H.-K. Kwon, J.-S. Son, M.-K. Song, A. Sahoo,
H.-J. Yi, K.-C. Hwang, T. Matsuyama, et al. 2009. A distal cis-regulatory element, CNS-9, controls NFAT1 and IRF4-mediated IL-10 gene activation in T
helper cells. Mol. Immunol. 46: 613–621.
2783