Download PCR of Scallop/pGEM Ligated DNA I. Introduction: A PCR reaction is

PCR of Scallop/pGEM Ligated DNA
I.
Introduction:
A PCR reaction is performed to evaluate the success of the Nhe I digested Scallop/SNX
DNA ligation into the 2,743 bp pGEM -3Z vector DNA. To analyze this a PCR reaction
is performed with the pUC/M13 forward sequencing primer, which binds at positions
2677 - 2700, and the pUC/M13 reverse sequencing primer, which binds at positions 128 144. (See the Promega pGEM -3Z Vector technical bulletin 033). For pGEM -3Z vector
containing no inserts, the expected PCR product is 192 bp. However, if the Scallop/SNX
DNA was successfully ligated into the pGEM -3Z vector DNA, then multiple PCR
products in the range of 100 to 1000 bps greater than the 192 bp control should be seen.
The following week a small sample is subjected to electrophoresis on a 2% TBE agarose
gel to verify the ligation and estimate the range (size) of the inserts.
II.
Materials:
1. REN/MBN/CIP/SNX/Oligo/pGEM scallop DNA, ? ng/µL
2. Promega pGEM -3Z vector, 10 ng/µL
3. NEB 10X Thermopol buffer w/o MgSO4
4. NEB 100 mM MgSO4
5. 2 U/µL NEB Vent (exo-) DNA polymerase
6. dNTP mixture: 2 mM each dNTP
7. 20 µM pUC/M13 forward sequencing primer (24-mer)
5’- CGCCAGGGTTTTCCCAGTCACGAC
8. 20 µM pUC/M13 reverse sequencing primer (22-mer)
5’- TCACACAGGAAACAGCTATGAC
9. molecular biology grade sterile water
10. 200 µL PCR tubes
11. National Labnet Co Model C-120 mini centrifuge and adapters
12. Eppendorf Mastercycler gradient thermocycler
13. Microliter digital pipets and tips
14. Horizontal gel electrophoresis apparatus and power supply
15. 10,000 GelStar stain, Cambrex Bio Science Rockland, Inc.
16. 1X TBE buffer
17. Agarose; FMC BioProducts SeaKem LE agarose
18. 10X Sample dilutor
19. Sterile 1.5 mL microfuge tubes
20. NEB 100 bp step ladder
21. Fotodyne photodocumentation system
III.
Methods:
1. Thaw and place on ice your REN/MBN/CIP/SNX/Oligo/pGEM scallop DNA.
2. Prepare a PCR master mix as follows:
NEB 10X Thermopol buffer:
2 U/ µL NEB Vent (exo-) DNA polymerase:
100 mM MgSO4:
2 mM dNTPs
20 µM pUC/M13 forward sequencing primer:
20 µM pUC/M13 reverse sequencing primer:
sterile water
6.0 µL
1.2 µL
1.2 µL
6.0 µL
2.4 µL
2.4 µL
38.4 µL
57.6 µL
3. Into two separate PCR tubes place 24.0 µL of the PCR master mix. To one of
these tubes add 1 µL of REN/MBN/CIP/SNX/Oligo/pGEM scallop DNA. To a
second PCR tube add 1 µL of 10 ng/µL Promega pGEM -3Z vector. Mix gently
and spin down briefly with the nanofuge.
4. Perform the PCR reaction in the following manner:
94oC for 5 minutes followed by 35 cycles of:
1 minute at 94oC
30 seconds at 60oC
2 minute at 72oC
o
This is then followed by a 72 C extension for 7 minutes and storage in the freezer
until the following week.
5. The following week, come to lab first, and prepare a 2% TBE agarose gel with a
12-tooth comb as previously described.
6. To the two PCR samples add 2.5 µL of the 10X sample dilutor. Mix gently and
spin down briefly in the nanofuge.
7. To lanes 4 and 5, add 10 µL of the REN/MBN/CIP/SNX/Oligo/pGEM scallop
DNA PCR mixture, 10 µL of Promega pGEM -3Z vector PCR mixture,
respectively. To lane 6 add 3 µL of the NEB 100 bp step ladder.
8. Run the electrophoresis at 100 V for approximately 1 h 15 min.
9. After the electrophoresis is completed, remove the gel and examine with the
Fotodyne photodocumentation system.
10. Comment on the results for the PCR reactions.
11. Retain and freeze the REN/MBN/CIP/SNX/Oligo/pGEM scallop DNA for
subsequent cell transformation reactions.
IV.
Points for discussion:
Estimate the concentration REN/MBN/CIP/SNX/Oligo/pGEM scallop DNA prior to the
PCR reaction? (Review the pGEM ligation protocol to make this estimate) How much (in
ng) of this DNA was used as template for the PCR reaction? How much of the uncut
pGEM -3Z vector was used as template for the PCR reaction. Explain fully how the gel
results support that the REN/MBN/CIP/SNX/Oligo scallop DNA was successfully ligated
into the vector or not. Estimate the size of the inserts in the vector.
V.
References:
Hamiliton, M.B., Pincus, E.L., Di Fiore A., and Fleischer. R.C. (1999) BioTechniques, 27
(3), 500-507.
Promega pGEM -3Z Vector Technical Bulletin No. 033.