Download NAC Transcription Factor SPEEDY HYPONASTIC

The Plant Cell, Vol. 25: 4941–4955, December 2013, www.plantcell.org ã 2013 American Society of Plant Biologists. All rights reserved.
NAC Transcription Factor SPEEDY HYPONASTIC GROWTH
Regulates Flooding-Induced Leaf Movement in Arabidopsis
W
Mamoona Rauf,a,b,1 Muhammad Arif,a,b,1 Joachim Fisahn,b Gang-Ping Xue,c Salma Balazadeh,a,b
and Bernd Mueller-Roebera,b,2
a University
of Potsdam, Institute of Biochemistry and Biology, 14476 Potsdam, Germany
Institute of Molecular Plant Physiology, 14476 Potsdam, Germany
c Commonwealth Scientific and Industrial Research Organization Plant Industry, St. Lucia, Queensland 4067, Australia
b Max-Planck
ORCID ID: 0000-0002-1410-464X (B.M-R.).
In rosette plants, root flooding (waterlogging) triggers rapid upward (hyponastic) leaf movement representing an important
architectural stress response that critically determines plant performance in natural habitats. The directional growth is based
on localized longitudinal cell expansion at the lower (abaxial) side of the leaf petiole and involves the volatile phytohormone
ethylene (ET). We report the existence of a transcriptional core unit underlying directional petiole growth in Arabidopsis
thaliana, governed by the NAC transcription factor SPEEDY HYPONASTIC GROWTH (SHYG). Overexpression of SHYG in
transgenic Arabidopsis thaliana enhances waterlogging-triggered hyponastic leaf movement and cell expansion in abaxial
cells of the basal petiole region, while both responses are largely diminished in shyg knockout mutants. Expression of several
EXPANSIN and XYLOGLUCAN ENDOTRANSGLYCOSYLASE/HYDROLASE genes encoding cell wall–loosening proteins was
enhanced in SHYG overexpressors but lowered in shyg. We identified ACC OXIDASE5 (ACO5), encoding a key enzyme of ET
biosynthesis, as a direct transcriptional output gene of SHYG and found a significantly reduced leaf movement in response to
root flooding in aco5 T-DNA insertion mutants. Expression of SHYG in shoot tissue is triggered by root flooding and treatment
with ET, constituting an intrinsic ET-SHYG-ACO5 activator loop for rapid petiole cell expansion upon waterlogging.
INTRODUCTION
Root flooding (waterlogging) in rosette plants like Arabidopsis
thaliana causes an upward leaf movement, called hyponastic
growth, to reestablish contact with air and photosynthetic gas
exchange (Pierik et al., 2005; Jackson, 2008; Vashisht et al., 2011).
The upward leaf movement is triggered by unequal cell elongation
at the basal (proximal to the shoot) petiole region, where abaxial
cells extend more than adaxial cells, resulting in increased petiole
angle. The gaseous phytohormone ethylene (ET; C2H4), which
regulates many plant developmental processes (Schaller and
Kieber, 2002; Lin et al., 2009; Stepanova and Alonso, 2009;
Schaller, 2012), has been indicated as the primary trigger of several
waterlogging or whole-plant submergence-induced physiological
and morphological acclimations in plants, including hyponastic
growth (Cox et al., 2003; Millenaar et al., 2005; Voesenek et al.,
2003, 2006; Bailey-Serres and Voesenek, 2008; Jackson, 2008). In
the semiaquatic dicot Rumex palustris, the ET level increases
20-fold within the first hour of waterlogging (Banga et al., 1996).
The hyponastic growth response to waterlogging is notably fast in
R. palustris with a lag phase of only 1.5 to 3 h and the response
being completed after 7 h, depending on the initial leaf angle (Cox
et al., 2003). A comparably fast hyponastic growth response to
1 These
authors contributed equally to this work.
correspondence to [email protected].
The author responsible for distribution of materials integral to the findings
presented in this article in accordance with the policy described in the
Instructions for Authors (www.plantcell.org) is: Bernd Mueller-Roeber
([email protected]).
W
Online version contains Web-only data.
www.plantcell.org/cgi/doi/10.1105/tpc.113.117861
2 Address
flooding was observed in the Columbia-0 (Col-0) accession of
Arabidopsis (Millenaar et al., 2005). Recently, a study by Polko et al.
(2012) showed that ET-mediated hyponasty in Arabidopsis involves
the reorientation of cortical microtubules at the abaxial side of the
petiole from longitudinal to transverse; thus, ET is associated with
tissue-specific changes in the arrangement of cortical microtubules
along the petiole and most likely ET also triggers local stimulation
of cell expansion upon waterlogging.
ROTUNDIFOLIA3 (ROT3) in Arabidopsis encodes the cytochrome P450 enzyme CYP90C1, which catalyzes the C-23 hydroxylation of various brassinosteroids (BRs). ROT3 is involved in
polar cell elongation, and it has recently been shown that rot3
mutants have reduced hyponastic growth upon ET treatment, as
well as low-light treatment and heat treatment, which both also
induced hyponastic growth. Treatment with brassinazole, an inhibitor of BR biosynthesis, reduces the ET-induced increase of
the petiole angle, revealing a modulatory role of BRs in petiole
angle establishment (Polko et al., 2013). In addition to BRs, other
phytohormones like auxin and gibberellins can act as positive
regulators of hyponastic leaf growth, while abscisic acid functions
as a negative regulator (Polko et al., 2011). Furthermore, the defense-related hormones methyl jasmonate and salicylic acid have
been shown to act as positive and negative modulators, respectively, of ET-induced hyponastic leaf growth (van Zanten
et al., 2012). Flooding triggers and accelerates leaf senescence in
many plant species, including tobacco (Nicotiana tabacum), tomato (Solanum lycopersicum), sunflower (Helianthus annuus), and
maize (Zea mays), possibly because of the reduced production of
cytokinin, a phytohormone that delays senescence, in flooded
roots (Burrows and Carr, 1969; Trought and Drew, 1980; VanToai
et al., 1994; Huynh et al., 2005). In line with this model, expression
4942
The Plant Cell
of the rate-limiting enzyme of cytokinin biosynthesis (i.e., isopentenyl transferase) from a senescence-induced promoter enhanced flooding tolerance in Arabidopsis (Zhang et al., 2000).
Taken together, although various molecular players affecting the
adaptive leaf growth response to waterlogging have been identified in recent years, an integrated view of the underlying regulatory networks is currently missing.
ET regulates two important molecular processes during hyponastic leaf growth, namely, rapid acidification of the apoplast to
reduce cell wall rigidity and enhance cell wall extensibility and the
upregulation of the expression of various EXPANSIN genes,
which encode cell wall–loosening enzymes. Four sequencerelated expansin protein families are currently distinguished in
plants: EXPANSIN A (EXPA), EXPB, EXPANSIN-LIKE A (EXLA),
and EXLB (Kende et al., 2004). In R. palustris, Rp-EXPA1 mRNA
levels increased ninefold relative to air-exposed control plants
with a subsequent increase in expansin activity (Vreeburg et al.,
2005). A phylogenetic comparison of Rp-EXPA1 with putative
orthologs in rice (Oryza sativa), Arabidopsis, and Regnellidium
diphyllum revealed high similarity of Rp-EXPA1 to At-EXPA8 and
At-EXPA2 from Arabidopsis, Os-EXPA1, Os-EXPA2, Os-EXPA 3,
Os-EXPA4, and Os-EXPA10 from rice, and Rd-EXPA1 from
R. diphyllum. These expansin genes are induced during floodinginduced growth responses (Cho and Kende, 1997; Kim et al.,
2000). Furthermore, several members of the XYLOGLUCAN ENDOTRANSGLYCOSYLASE/HYDROLASE (XTH) gene family are
upregulated by submergence, including XTH23 from Arabidopsis
(Lee et al., 2011). XTHs are another class of cell wall–modifying
proteins that contribute to loosening cell walls during cell expansion (Rose et al., 2002; Nishitani and Vissenberg, 2007; Van
Sandt et al., 2007).
The biosynthesis of ET involves the conversion of Met to Sadenosyl-L-Met (S-AdoMet) by the enzyme S-AdoMet synthetase.
S-AdoMet is then further converted to 1-aminocyclopropane-1carboxylic acid (ACC) by ACC synthase (ACS), followed by subsequent metabolism of ACC to ET by ACC oxidase (ACO) (Yang
and Hoffmann, 1984). In all plant species studied so far, ACS is
encoded by a multigene family, and the Arabidopsis genome
contains nine authentic ACS genes that exhibit distinct expression patterns throughout plant development and in response to
stresses (reviewed in Lin et al., 2009). Similarly, ACO is encoded
by multiple genes in plants (ACO1 to ACO5 in Arabidopsis), and
expression patterns differ between the various ACO genes. In
R. palustris, Rp-ACO transcript level is strongly induced by ET
treatment or submergence, and ACO enzyme activity in shoots
increases twofold within 24 h of submergence, suggesting that ET
formation during submergence is due to a rise of ACO protein
level. Notably, the increased expression of Rp-ACO was particularly evident in petioles, where most of the cell elongation occurs
during submergence (Vriezen et al., 1999). In Arabidopsis, the
ACO2 gene is involved in endosperm cap weakening and rupture
during seed germination (Linkies et al., 2009). In addition to the
direct activation of genes involved in ET biosynthesis, altered
expression of perception- and signaling-related genes and transcription factors such as ETHYLENE RESPONSE2, ETHYLENE
INSENSITIVE2 (EIN2), and EIN3 under submergence (Lee et al.,
2011) may contribute to enhanced hyponastic leaf growth; however, this has not been tested so far.
NAC (for NAM, ATAF1, ATAF2, and CUC2) domain transcription
factors (TFs) represent a plant-specific transcription regulatory
family encoded by ;100 to 150 genes in all higher plants sequenced to date (Ooka et al., 2003; Nuruzzaman et al., 2010;
Puranik et al., 2013; Singh et al., 2013), with 106 genes present in
the genome of Arabidopsis. NAC TFs typically contain a highly
conserved N-terminal DNA binding domain and a divergent
C-terminal part (Olsen et al., 2005). NAC TFs play important roles
in various biological processes, including senescence (Guo and
Gan, 2006; Kim et al., 2009; Balazadeh et al., 2010, 2011; Lee
et al., 2012; Hickman et al., 2013; Rauf et al., 2013), the response
to abiotic and biotic stresses (Tran et al., 2004; Hu et al., 2006;
Jensen et al., 2008; Wang et al., 2009; Wu et al., 2009; Jeong et al.,
2010), leaf development (Berger et al., 2009), secondary wall biosynthesis (Zhong et al., 2010, 2011), regulation of Fru sensitivity
(Li et al., 2011), regulation of iron homeostasis (Ogo et al., 2008),
and others. The NAC TF VASCULAR-RELATED NAC-DOMAIN
INTERACTING2 (ANAC083) integrates abscisic acid signaling with
leaf senescence (Yang et al., 2011) and negatively regulates xylem
vessel formation (Yamaguchi et al., 2010). The NAC TF JUNGBRUNNEN1 (ANAC042) positively regulates plant longevity, most
likely by reducing the cellular hydrogen peroxide level (Wu et al.,
2012), and plays a role in acquired thermotolerance (ShahnejatBushehri et al., 2012). In wheat (Triticum aestivum), the NAC TF
NAM-B1 was shown to affect senescence and nutrient remobilization during grain maturation (Uauy et al., 2006).
Here, we report the physiological function of the NAC TF
SPEEDY HYPONASTIC GROWTH (SHYG; ANAC047; At3g04070).
We demonstrate that SHYG mediates waterlogging-induced hyponastic leaf growth by directly regulating the expression of ACO5
involved in ET biosynthesis.
RESULTS
SHYG Encodes a Submergence-Induced NAC TF
The TF SHYG (ANAC047) belongs to group III of the NAC family,
which also includes the functionally characterized stress-related
TFs ARABIDOPSIS TRANSCRIPTION ACTIVATION FACTOR1
(ATAF1), At-NAP (for NAC-LIKE, ACTIVATED BY APETALA3/
PISTILLATA), and RESPONSIVE TO DESICCATION26 (Fujita et al.,
2004; Guo and Gan, 2006; Lu et al., 2007). SHYG encodes a 359–
amino acid protein with a calculated molecular mass of 40.8 kD.
SHYG contains a NAM domain (pfam02365) at its N terminus. Its
coding region consists of three exons, interrupted by two introns.
The SHYG protein does not have a transmembrane domain, which
otherwise is present in some NAC TFs (Seo et al., 2008).
We analyzed public transcriptome data and found that SHYG
expression increased 4.3-fold in rosettes of fully submerged Arabidopsis plants within 7 h (Lee et al., 2011), indicating that it might act
as a transcriptional regulator in waterlogging- or submergencecontrolled processes. Indeed, as we show below, SHYG plays an
important role in waterlogging-induced hyponastic leaf movement,
a function not reported for any of the other group III NACs.
SHYG Regulates the Expression of ACO5
First, to identify genes downstream of SHYG, we expressed it from
an estradiol-inducible promoter (Zuo et al., 2000) and performed
SHYG Controls Hyponastic Leaf Movement
4943
Figure 1. SHYG Acts Upstream of ACO5.
(A) ACO5 and SHYG expression, determined by qRT-PCR in 2-week-old b-estradiol–treated (1, 2, 4, and 6 h) SHYG-IOE seedlings, relative to the wild type.
(B) Immunodetection of ACO protein after b-estradiol induction using anti-ACC antibody (top panel). RbcL, ribulose-1,5-bis-phosphate carboxylase/
oxygenase large subunit (loading control; bottom panel).
(C) ACO5 expression in 35S:SHYG-GFP, 35S:SHYG, and shyg-1 and shyg-2 lines compared with the wild type.
(D) SHYG transactivates the ;1.87-kb (three SHYG binding sites), but not the 169-bp (no binding site), ACO5 promoter. Luciferase signal was
determined 8 and 16 h after transfection. Data in (A), (C), and (D) represent means 6 SE (n $ 3).
(E) EMSA. SHYG-GST protein binds to 40-bp double-stranded oligonucleotide containing SHYG BS-1 of ACO5 promoter (lane 2), while no binding
occurs in the absence of SHYG-GST protein (lane 1) or when nonlabeled competitor is added (lane 3). For EMSA, we used 1 mL (0.05 pmol/µL) labeled
probe in 20 mL of total volume. Competitor was used in 100-fold molar excess.
(F) ChIP-qPCR on 35S:SHYG-GFP Arabidopsis plants. Data are the means 6 SD (two biological replicates each with three technical replicates).
Enrichment of sequences at BS-1, BS-2, and BS-3 of the ACO5 promoter was quantified by qPCR. Negative control (Neg cont): qPCR on a promoter
(CLAVATA1; At1g75820) lacking SHYG binding sites.
4944
The Plant Cell
expression profiling 5 h after b-estradiol treatment, using 14-d-old
transgenic seedlings (SHYG-IOE ). Only few genes robustly
increased upon SHYG induction, including ACO5 (4.3-fold),
encoding an uncharacterized enzyme involved in ET biosynthesis
(see Supplemental Table 1 online). ACO5 transcript abundance and
ACO protein level increased upon SHYG induction in a timedependent manner (Figures 1A and 1B). ACO5 mRNA was also
more abundant in Arabidopsis 35S:SHYG overexpressors than
in Col-0 wild-type plants (Figure 1C) and showed reduced levels
in two homozygous T-DNA insertion lines, shyg-1 and shyg-2
(Figure 1C; see Supplemental Figures 1A to 1C online). These
observations are consistent with the model that SHYG acts
upstream of ACO5 in a regulatory cascade. SHYG fused to
green fluorescent protein (GFP) accumulated in nuclei of transformed Arabidopsis plants (see Supplemental Figure 2 online),
consistent with its function as a TF.
SHYG Directly Binds to the ACO5 Promoter
To further test the SHYG-ACO5 regulatory cascade, we next performed transactivation assays using Arabidopsis mesophyll cell
protoplasts cotransfected with a 35S:SHYG effector plasmid and
a reporter construct (pACO5-fLUC) carrying a fusion between the
ACO5 promoter (1.87 kb) and firefly luciferase (fLUC) as
a reporter for transcriptional activation. As shown in Figure
1D, SHYG strongly transactivated ACO5 expression 8 and 16
h after transfection.
To investigate whether ACO5 is a direct target gene of SHYG,
we analyzed the SHYG DNA binding sequence. Sequence
alignment of SHYG with Ta-NAC69 (Xue et al., 2006) revealed
90% amino acid identity in their five conserved NAC subdomains,
while little sequence identity (19%) exists between their C-terminal
domains. Considering the fact that SHYG and Ta-NAC69 have
very high amino acid sequence similarity in their DNA binding
domains, we assumed that these proteins may share similar
DNA binding specificity. Previously, two high-affinity binding
sites of Ta-NAC69 (site I, rrwkmCGTrnnnnnyACGtmayy; site II,
rswvktynnnnnnnnyACGwcwct) were identified through in vitro
binding site selection, followed by extensive mutation analysis of
the two binding sites (Xue et al., 2006). To test the DNA binding
affinity of SHYG to Ta-NAC69 binding sites, we determined the
binding activity of SHYG toward Ta-NAC69 binding site I (SO1)
and site II (SO39). In addition, to learn more about the specificity of
binding, we also included the following sequences in our analysis:
SO1m (mutated SO1 motif) that appears to confer no Ta-NAC69
binding affinity; SO39h that contains a sequence similar to
Ta-NAC69 binding site II; ANAC019 binding site (ANAC019S);
35S motif-1 (2139 to 2110) from the cauliflower mosaic virus
(CaMV) 35S promoter that contains a weak Ta-NAC69 binding site
I; and 35S motif-2 containing the sequence of agggatg, which is
the protected site of At-NAM (Duval et al., 2002). As shown in
Table 1, the binding affinities of SHYG to Ta-NAC69 sites
SO1 and SO39 were highly similar to that of Ta-NAC69 (Xue
et al., 2006). SHYG also showed binding toward the
ANAC019 binding site and the CaMV 35S motif-1, but with
higher binding affinity. In contrast with Ta-NAC69, SHYG
better tolerated mutations within the two consensus motifs
(SO39h and ANAC19S).
With these binding sequence data, we identified three potential
SHYG binding sites (BS) within the ACO5 promoter 170 bp (BS-1,
TCAACTG[8n]TACGTTTTT), 206 bp (BS-2, CATAACGTA[6n]AACGATAAA), and 1719 bp (BS-3, AAGCTTT[7n]TACGTTTTG) upstream of the translation initiation codon (see Supplemental Figure
3 online). However, the predicted affinity of BS-3 is low, as the
reduction in the spacer length in Ta-NAC69 binding site II markedly
reduces the binding affinity (Xue et al., 2006). Transactivation
Table 1. Comparison of Binding Sequence Specificity of SHYG and Ta-NAC69
RBA (%)
Motifs
Ta-NAC69 DNA binding site I
SO1
SO1m
Ta-NAC69 DNA binding site II
SO39
SO39h
ANAC019 binding site
ANAC19S
CaMV 35S motifs
35S motif-1
35S motif-2
Synthetic Oligonucleotide Sequence
Ta-NAC69
SHYG
ggagatcCGTgcacagtACGtaactgtta
ggagatcCGTgcacagaaaataactgtta
100 6 3.1
0
100 6 8.7
0
gaggtgtttaatgtttacACGtctctagtg
taggtaagcaaattgatcACGcaactgccc
94.2 6 3.5
32.8 6 1.7
96.6 6 4.1
86 6 4.7
gagctcttcttctgtaacACGcatgtgttg
16.9 6 1.2
56.2 6 6
aaagaagaCGTtccaaccACGtcttcaaag
ccactgacgtaagggatgacgcacaatccc
10.3 6 1.0
0
31.6 6 1.4
1.4 6 0.2
Relative binding activity (RBA) is expressed as percentage relative to SO1. Values are means 6 SD of three assays. Bases matching with the high-affinity
binding sequences of Ta-NAC69 site I (rrwkmCGTrnnnnnyACGtmayy) or site II (rswvktynnnnnnnnyACGwcwct) are in bold. The NAC core binding site is
shown as capital letters. Substituted bases of SO1 (SO1m) are underlined. SO39h contains a sequence similar to Ta-NAC69 binding site II. ANAC19S
represents the ANAC019 binding site. The as-1 site of the CaMV 35S promoter in 35S motif-2 (–87 to 258) is shown in italics. The nucleotide positions
of the 35S motif-1 in the 35S promoter are from 2139 to 2110. The data indicate that the high-affinity binding sites of SHYG can be modified from the
Ta-NAC69 binding sites to rrwkmCGTr(5-6n)yACGtmayy (site I) and rswvdky(8n)yACGhmwst (site II), where d = a, g, or t; h = a, c, or t; k = g or t; m = a or
c; r = a or g; s = g or c; v = a, c, or g; w = a or t; y = c or t.
SHYG Controls Hyponastic Leaf Movement
4945
Figure 2. Hyponastic Leaf Movement.
Images in (A), (C), and (E) show plants in the absence (2WL) or presence of 8 h (+WL) of waterlogging.
(A) Enhanced and reduced hyponastic growth in 35S:SHYG and shyg-2 plants, respectively, compared with the wild type (WT).
(B) Leaf angle kinetics. Shown are initial and pairwise subtracted differential petiole angles, corrected for diurnal petiole movement in control conditions.
(C) Leaf reorientation is inhibited in aco5 mutants compared with the wild type.
(D) Leaf reorientation kinetics in aco5 and wild-type plants.
(E) Leaf reorientation is impaired in aco5 mutants overexpressing SHYG or SHYG-GFP.
(F) Leaf reorientation kinetics in 35S:SHYG/aco5-1, 35S:SHYG-GFP/aco5-2, and wild-type plants. Means 6 SE (n $ 5) in all experiments.
capacity of SHYG toward ACO5 was strongly reduced when all
three binding sites were deleted (Figure 1D). Electrophoretic mobility shift assays (EMSAs) confirmed binding of recombinant
SHYG-glutathione S-transferase (SHYG-GST) fusion protein to
BS-1 (Figure 1E), which has a better match to the preferred binding
sequences of Ta-NAC69 than BS-2 and BS-3. Finally, to demonstrate in vivo binding of SHYG to the ACO5 promoter, we performed chromatin immunoprecipitation (ChIP) and determined
enrichment of ACO5 promoter fragments in the precipitated
chromatin by quantitative PCR (qPCR) with primers spanning the
three predicted SHYG binding sites. We detected clear enrichment of BS-1 and BS-2, whereas no binding to BS-3 was observed (Figure 1F).
SHYG Regulates Waterlogging-Induced Hyponastic
Leaf Growth
Although SHYG transcript abundance increased in plants submerged for several hours (see above), a physiological function for
this NAC TF was not known. As root flooding leads to hyponastic
leaf growth in soil-grown plants in Arabidopsis, we thought to
investigate whether SHYG has a function in this adaptive growth
response. To this end, 30-d-old plants grown in individual pots in
soil were placed in a flat plastic tank and roots were flooded by
filling the tank with water up to a level slightly below the pot’s
upper edge (for details, see Methods). Shoots remained in ambient air. For control treatments, plants were put inside the tanks
without flooding. We followed hyponastic leaf movement in Col-0
wild-type plants and the two shyg T-DNA insertion mutants using
a time-lapse video setup. While hyponastic petiole growth was
clearly detected in the Col-0 wild type, it was strongly impaired in
shyg-2 (Figures 2A and 2B; see Supplemental Movies 1 and 2
online) and shyg-1 (see Supplemental Figure 4 and Supplemental
Movie 2 online) over an 8-h waterlogging time span, revealing
SHYG’s critical function in this physiological response. This
conclusion was further supported by the fact that waterlogginginduced hyponastic growth was strongly stimulated compared
with Col-0 wild-type plants in 35S:SHYG lines (Figures 2A and 2B;
see Supplemental Movie 1 online). The petiole bending response
was stimulated by ACC spray but diminished by treatment with
aminoisobutyric acid (AIB), which blocks ACO activity and, hence,
ET biosynthesis, and silver nitrate (AgNO3), an ET receptor
4946
The Plant Cell
in both mutants and correlated to the level of residual ACO5
expression (Figures 2C and 2D; see Supplemental Figure 1F and
Supplemental Movie 3 online), indicating that ACO5 has
a unique function in this process. ACO5 deficiency was virtually
overcome by treating plants with the ET-releasing agent ethephon (see Supplemental Figure 5B online), a response blocked
Figure 3. Hyponastic Leaf Movement in SHYG Inducible Lines.
(A) SHYG-IOE plants. Petioles reorient to a more vertical position upon
waterlogging after pretreatment with either 10 µM b-estradiol (EST; four
rosette sprays during 48-h prior waterlogging), ACC, or both, while this
response is diminished after pretreatment either with AIB or AgNO3.
(B) Leaf reorientation kinetics in SHYG-IOE line. Means 6 SE (n $ 5).
Pretreatments were performed using 10 mM each chemical 4 h prior to
waterlogging.
antagonist that minimizes ET perception (Guo and Ecker, 2003;
Ouaked et al., 2003; see Supplemental Figure 5A online), strongly
supporting the model that SHYG acts through ET and likely through
ACO5. Similarly, treatment with another ET receptor antagonist,
1-methylcyclopropene, prevented submergence-induced hyponasty in the strongly responding Col-0 accession and reduced
it in the weaker responding accession Landsberg erecta (Millenaar
et al., 2005).
SHYG Acts through ACO5
To substantiate our premise that waterlogging-induced petiole
growth is controlled via the SHYG-ACO5 regulatory cascade, we
identified two homozygous T-DNA insertion mutants, aco5-1
and aco5-2 (see Supplemental Figures 1D and 1E online), with
low ACO5 expression (see Supplemental Figure 1F online).
Waterlogging-induced hyponastic growth was strongly reduced
Figure 4. Petiole Epidermal Cells.
(A) Microscopic view of abaxial epidermal imprints of petiole segments
proximal (1.4 mm) to the stem (leaf No. 9) before (2WL) and after 8 h of
waterlogging (+WL). WT, the wild type. Bar = 100 mm.
(B) to (E) Epidermal cell lengths of petiole regions of wild-type, 35S:
SHYG, and shyg-2 plants, before ([B] and [C]) and after ([D] and [E])
waterlogging. Data points represent means 6 SE (n = 8) of epidermal cell
lengths of the first 5.4-mm adaxial and abaxial petiole surfaces.
(F) Expression of EXPA11 and EXPA8 in abaxial and adaxial proximal
parts of the leaf petiole after waterlogging compared with control. Error
bars represent means 6 SE (n $ 4).
SHYG Controls Hyponastic Leaf Movement
4947
by the simultaneous application of AgNO3 (see Supplemental
Figure 5B online).
Next, we tested whether SHYG indeed functions via activation
of ACO5 and to this end established 35S:SHYG/aco5-1 and 35S:
SHYG-GFP/aco5-2 lines. We found waterlogging-induced hyponastic leaf movement to be strongly impaired in both aco5 mutant
backgrounds (Figures 2E and 2F; see Supplemental Movie 4
online); the lack of petiole bending was reversed by treatment of
plants with ethephon, a response that was blocked by AgNO3
(see Supplemental Figure 5C online). Finally, we tested the effect
of waterlogging in SHYG-IOE lines. Although root flooding alone
triggered hyponastic leaf growth, as expected, this response was
enhanced by treatment with b-estradiol or ACC (Figures 3A and
3B); the strongest growth effect was observed when b-estradiol
and ACC were applied together to waterlogged plants, a reaction
almost completely diminished in the presence of AIB or AgNO3
(Figures 3A and 3B). Collectively, our data show that ACO5 is
critically important for SHYG-mediated petiole bending during
root flooding.
Localized Cell Expansion Is Modified by SHYG Expression
Waterlogging-induced hyponastic leaf growth requires localized
expansion of abaxial cells of the basal (shoot-proximal) petiole
segment, while cell elongation in adaxial petiole cells is not affected by waterlogging (Polko et al., 2012). We determined the
length of epidermal cells in petioles of wild-type, shyg, and 35S:
SHYG plants. Whereas cell length in the abaxial and adaxial petiole
epidermis did not significantly differ between genotypes before
waterlogging (Figures 4A to 4C), abaxial cells elongated more in
35S:SHYG than wild-type petioles after root flooding, but abaxial
cell elongation was reduced in shyg-2 petioles (Figures 4A to 4D).
As expected, adaxial cell length remained unaffected by root
flooding in all three genotypes (Figure 4E). Thus, the level of SHYG
expression is critically important for root waterlogging-induced
localized cell expansion at the petiole base.
Expansins are secreted proteins playing critical roles during cell
expansion (Cosgrove, 2000). EXPANSIN A11 (EXPA11) is a marker
for ET-induced cell elongation in Arabidopsis petioles (Millenaar
et al., 2005; Polko et al., 2011), and we therefore tested its expression in the SHYG-modified plants. Upon root flooding, EXPA11
expression increased in shoot-proximal abaxial petiole segments of
wild-type plants, as expected. Notably, EXPA11 expression in
abaxial petiole cells increased to higher levels in the 35S:SHYG
overexpressor plants but remained low in shyg-2 (Figure 4F). Expression of EXPA11 remained largely unaffected in adaxial cells.
EXPA8, a submergence-induced gene (Lee et al., 2011), behaved
similarly (Figure 4F).
We also tested SHYG expression in the proximal segment of the
leaf petiole using the ProSHYG:GUS lines. As seen in Supplemental
Figure 5. Expression Profiling of EXP and XTH Genes in SHYG Transgenic Plants.
(A) Phenotype of 30-d-old wild-type (WT), 35S:SHYG overexpressor, and
shyg-2 mutant plants treated with waterlogging for 8 h. Dissected leaf
petioles were subjected to EXP and XTH gene expression profiling by
qRT-PCR.
(B) Venn diagram showing an overview of EXP and XTH genes that were
significantly differentially expressed in 35S:SHYG and shyg-2 mutant
lines compared with the wild type.
(C) The heat map indicates expression ratios of EXP and XTH genes in
35S:SHYG and shyg-2 compared with the wild type. Expression ratios
(log2): red, increased expression (between 0 and + 2); blue, reduced
expression (between 0 and 22).
4948
The Plant Cell
Figure 6. GUS Activity in ProSHYG:GUS Plants.
(A) SHYG expression in rosettes triggered by waterlogging for 8 h (+WL) relative to control (2WL). GUS staining was further enhanced by ACC
pretreatment; the response was blocked by AIB. The corresponding plant phenotypes are shown on the top.
(B) Quantification of GUS activity; experimental setup as in (A); means 6 SE (n $ 3). FW, fresh weight.
(C) GUS activity in ProSHYG:GUS seedlings, triggered by ET released from neighboring SHYG-IOE seedlings treated with b-estradiol (10 µM) for the indicated
time points (see Supplemental Figure 8 online for experimental details). Note elevated GUS activity in the first true leaves after b-estradiol (EST) treatment
(arrows) compared with mock. GUS activity remains low in seedlings pretreated for 4 h with ACO inhibitor AIB, even in the presence of b-estradiol.
(D) Quantification of GUS from (C); means 6 SE (n $ 4).
Figure 6A online, b-glucuronidase (GUS) staining was low before
waterlogging but was strongly enhanced after 8 h of waterlogging.
However, no major difference in staining intensity between the
abaxial and adaxial petiole regions was observed. We also tested
SHYG expression by quantitative real-time PCR (qRT-PCR) and,
like in the GUS studies, did not detect a major difference between
the abaxial and adaxial petiole regions, similar to ACO5, while
EXPA11 and EXPA8 expression was considerably higher in the
abaxial than adaxial petiole regions (see Supplemental Figure 6B
online), suggesting that also ET formation may not be locally different between the two petiole sides.
We used qRT-PCR to test the expression of 44 additional cell
expansion–related genes, namely, EXP and XTH genes, and observed opposite responses for several of them in 35S:SHYG and
shyg-2 plants versus the wild type (Figure 5), supporting the important role of SHYG as a regulator of cell expansion during hyponastic leaf growth.
staining in petioles and the rosette center was weak in nonstressed plants. However, GUS activity was strongly elevated after
8 h of waterlogging (Figures 6A and 6B), when petiole angle was
also increased in these lines (Figure 6A; see Supplemental Figure 7
online); this response was further enhanced by simultaneous application of ACC but diminished by AIB (Figures 6A and 6B; see
Supplemental Figure 7 online), indicating a positive feedback loop
connecting SHYG expression with ET level, most likely via ACO5.
We next tested the effect of ET released from b-estradiol–induced
SHYG-IOE seedlings on SHYG expression in neighboring ProSHYG:
GUS lines (pooled in a tightly sealed deep-well plate to ensure the
capture of ET produced by SHYG:IOE plants; see Supplemental
Figure 8 online). As seen in Figures 6C and 6D, b-estradiol treatment strongly enhanced GUS activity in ProSHYG:GUS lines in
a time-dependent manner. This induction was not observed in
mock-treated seedlings or when ET synthesis was blocked by AIB
in b-estradiol–treated samples.
Waterlogging Triggers SHYG Expression
Natural Variation of the SHYG-ACO5 Regulatory Cascade
Global expression profiling revealed elevated transcript levels of
many genes, including SHYG, in fully submerged plants (Lee
et al., 2011). To test whether enhanced SHYG expression is due
to promoter activation, we tested waterlogging-dependent GUS
activity in SHYG promoter-GUS fusion (ProSHYG:GUS) lines. GUS
To assess whether there exists natural variation of the SHYGACO5 regulatory cascade, we tested the response to root flooding
in accession Cvi-0, which shows a low tolerance to complete
submergence, and compared it with Col-0, an accession reported
to exhibit moderate submergence tolerance (Vashisht et al., 2011).
SHYG Controls Hyponastic Leaf Movement
Figure 7. Model of SHYG Action during Waterlogging-Induced Hyponastic Leaf Growth.
Waterlogging triggers SHYG expression through unknown upstream factors. SHYG directly activates ACO5, leading to elevated ET formation.
Waterlogging also induces expression of ACS genes involved in ET biosynthesis. In parallel, various EXP and XTH genes are induced, facilitating
petiole bending and, hence, hyponastic growth.
Leaf movement was much less pronounced in Cvi-0 than in Col-0
(see Supplemental Figure 9 online). Expression of SHYG and
ACO5 (and EXPA8) increased upon waterlogging in the proximal
petiole segments of Col-0 but remained largely unaffected in Cvi-0,
in accordance with its weak growth response (see Supplemental
Figure 9 online). As expected, expression of these genes was not
affected by waterlogging in the distal petiole segments.
DISCUSSION
NAC TFs have been shown to be involved in many developmental
and stress-related processes in plants (Tran et al., 2004; Jensen
et al., 2008; Ogo et al., 2008; Berger et al., 2009; Kim et al., 2009;
Wu et al., 2009, 2012; Balazadeh et al., 2010; Li et al., 2011;
Zhong et al., 2011; Lee et al., 2012). Here, we report the biological
function of SHYG, a group III NAC TF from Arabidopsis, in root
flooding–induced hyponastic leaf growth. Expression of SHYG in
shoots of soil-grown plants is low to moderate before root waterlogging but rapidly increases upon waterlogging as well as ACC
treatment. As we demonstrate here, SHYG directly regulates the
expression of ACO5 by binding to its promoter, in accordance with
the observation that root flooding triggers ET formation (as reviewed in Bailey-Serres and Voesenek, 2008; Jackson, 2008). Loss
of SHYG function strongly diminishes waterlogging-induced hyponastic leaf growth (Figures 2A and 2B), and a loss of ACO5 has
a similar effect (Figures 2C and 2D).
Notably, when SHYG was overexpressed from the CaMV 35S
promoter in the absence of a functional ACO5 gene (in aco5-1
and aco5-2 mutant backgrounds) waterlogging-induced hyponastic leaf movement was strongly impaired (Figures 2E and 2F),
revealing ACO5 to be a key element of this physiological response under the direct regulation of SHYG. Therefore, our data
provide firm evidence for a central role of SHYG as an upstream
regulator of waterlogging-induced hyponasty by influencing ET
4949
biosynthesis through direct transcriptional activation of an ET
biosynthesis gene. Our data indicate that other ACO genes in
Arabidopsis do not compensate for the lack of ACO5 in this
physiological response. An important aspect of our findings is
that SHYG expression itself is stimulated by ACC/ET, thereby
constituting a positively acting ET-SHYG-ACO5 activator loop for
rapid petiole cell expansion upon root flooding.
Upon flooding, ACC accumulates in the anoxic roots and after
transport via the xylem to the shoot ET is liberated by the action of
ACO (Bradford and Yang, 1980). Generally, ACO is not considered to be rate-limiting; thus, ACC arriving at the shoot might be
expected to be readily converted to ET. However, as we demonstrate, ACO5 expression is barely induced in the proximal
petiole segment upon root flooding in accession Cvi-0, which
shows a weak hyponastic growth response to waterlogging, while
it is strongly induced in accession Col-0, which exhibits a much
more pronounced hyponastic response to root flooding (see
Supplemental Figure 9 online). This observation and the fact that
the strength of the hyponastic growth response correlates with
the level of residual ACO5 expression in the two aco5 T-DNA
insertion mutants (Figures 2C and 2D; see Supplemental Figure
1F online) points to rate-limiting expression (and potentially activity) of ACO during waterlogging-induced hyponastic leaf
growth. Notably, SHYG did not modulate expression of any of the
nine ACS genes in the Arabidopsis genome in our experimental
setting, indicating that SHYG-mediated enhanced ET formation
upon waterlogging does not involve these genes. However,
submergence-triggered increases of ACS gene expression have
been observed (Peng et al., 2005; Lee et al., 2011), leaving open
the possibility that other transcriptional regulators control their
expression. Currently, however, no single ACS gene has been
functionally connected to hyponastic leaf growth.
Hyponastic leaf movement is due to a locally restricted expansion of cells in the proximal, abaxial petiole region, while cells
at the adaxial petiole side remain largely unaffected with respect
to cell length upon root flooding. Compared with the wild type, we
found increased and decreased abaxial cell expansion, respectively, in SHYG overexpressors and shyg mutants, a phenotype consistent with the macroscopic leaf movement response. In
contrast with the locally restricted cell elongation, however, expression of both SHYG and ACO5 did not appear to be regionally
distinct at the abaxial and adaxial petiole sides (see Supplemental
Figure 6 online), suggesting that also ET formation may not be
locally different between the two petiole sides.
Previously, it was shown in Arabidopsis that ET triggers elevated expression of EXPA11 at the proximal abaxial but not adaxial petiole side (Polko et al., 2012), which is consistent with our
observation of the differential cell elongation responses during
waterlogging. We observed a similar transcriptional response for
EXPA11 as well as for EXPA8 in wild-type (Col-0) Arabidopsis
plants; notably, compared with wild-type plants, expression of the
two genes at the abaxial petiole side was stimulated in SHYG
overexpressors, while it was reduced in the shyg-2 mutant; no
difference in EXPA8 and EXPA11 expression was observed at the
adaxial petiole side. Thus, although expression of SHYG itself
lacks local specificity (as does ACO5), genes involved in cell expansion are likely to be of functional relevance for the upward
directed petiole bending (EXPA8 and EXPA11) and maintain their
4950
The Plant Cell
locally distinct patterns of expression upon SHYG overexpression.
Currently, it remains an open question whether EXPA8 and EXPA11
are direct transcriptional output genes of SHYG or whether additional TFs are involved in regulating these genes during waterlogging. Of note, however, EXPA8 is an ortholog of Rp-EXPA1,
a marker gene for submergence-induced leaf hyponasty in
R. palustris (Vreeburg et al., 2005), indicating regulatory and functional conservation of the gene networks controlling this physiological response.
As we show in Figure 5, several other EXP genes as well as XTH
genes are modulated by SHYG, which most likely contributes to
abaxial petiole cell expansion upon waterlogging. However, the
contribution of each individual gene to hyponastic leaf growth has
so far not been analyzed; it is possible that several of the EXP/XTH
genes affected by SHYG work in concert to contribute to cell
expansion during waterlogging-triggered leaf hyponastic leaf
growth. In addition, our data reveal several other genes rapidly
modulated by SHYG after its induction by estradiol in SHYG-IOE
lines (see Supplemental Table 1 online). However, their functional
involvement in hyponastic leaf growth remains open at present.
A further important question that remains to be addressed in future experiments is which upstream transcriptional regulators control the expression of SHYG. A possible candidate is EIN3, a master
transcriptional regulator of ET-controlled processes (Roman et al.,
1995; Chao et al., 1997). Of note, an EIN3 core binding site is located ;580 bp upstream of the SHYG start codon (data not shown),
and ChIP-seq studies have revealed binding of EIN3 to the SHYG
promoter (Chang et al., 2013), indicating that both TFs constitute
a transcriptional cascade with SHYG as an output regulator of the
EIN3 TF. However, a detailed functional analysis will be required to
unravel in detail under which physiological conditions and in which
cells EIN3 regulates SHYG expression.
Collectively, our data suggest a regulatory model (Figure 7)
whereby SHYG plays a decisive role in regulating root waterlogging-induced leaf movement by directly or indirectly stimulating localized cell expansion at the abaxial petiole side through
direct activation of ACO5 and ET formation. The control circuit
involves an intrinsic ET-SHYG-ACO5 activator loop that accelerates cell expansion after an initial trigger and underlies the rapid
petiole growth response that becomes already evident 90 min
after starting root flooding (Figure 2). Our data also suggest natural variation of SHYG, ACO5, and EXPA8 gene expression,
which is in accordance with the differential hyponastic leaf response observed in Col-0 (relatively strong responder) versus Cvi-0
(weak responder; see Supplemental Figure 9 online), providing
further evidence for the biological importance of the SHYG-ACO5
regulatory interaction.
Future work will have to unravel the peculiarities of the signaling
circuitry that fine-tunes SHYG expression at the cell level and the
details of the downstream gene network(s) that governs local cell
expansion to drive directional leaf movement. The SHYG-ACO5
regulatory system appears to be distinct from the regulatory
networks controlled by the SNORKEL1 (SK1) and SK2 genes in
deepwater rice, both of which encode ET response factor TFs that
regulate internode elongation to keep leaves above the rising
water surface and avoid tissue anoxia. Both SK genes are upregulated by ET. Experimental evidence shows an involvement of
gibberellic acid in the elongation process controlled by SK1 and
SK2 (Hattori et al., 2009, 2011). Flash flood is another type of
stress that appears suddenly and often damages rice seedlings.
Tolerance to flash flood is achieved by temporally restricting
growth (up to a few weeks), leading to stunted seedlings. When
flood waters recede, seedlings restart growth. The ET response
factor TF Submergence-1A has been shown to be a central
regulator of submergence tolerance (Xu et al., 2006; Jung et al.,
2010). Within the Arabidopsis NAC family, several other NACs
besides SHYG, including, for example, ANAC013, ANAC084,
ANAC091, and ATAF1, are induced by submergence (Lee et al.,
2011). It appears that plants have evolved different strategies
and molecular mechanisms to combat threats posed by waterlogging or submergence.
METHODS
General
Standard molecular techniques were employed as reported (Sambrook et al.,
2001; Skirycz et al., 2006). Chemicals and reagents were obtained from
Sigma-Aldrich, Fluka, and Roche Diagnostics. For sequence and expression
analyses, the following tools were used: eFP browser (www.bar.utoronto.ca/
efp/cgi-bin/efpWeb.cgi), GENEVESTIGATOR (www.genevestigator.com), the
National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/),
The Arabidopsis Information Resource (http://www.Arabidopsis.org/), the
European Bioinformatics Institute (http://www.ebi.ac.uk/), and the Plant
Transcription Factor Database (http://plntfdb.bio.uni-potsdam.de/v3.0/).
Plants
Seeds of Arabidopsis thaliana, accessions Col-0 and Cvi-0, were obtained
from the Arabidopsis thaliana Resource Centre for Genomics (Institut National de la Recherche Agronomique, France; http://dbsgap.versailles.inra.
fr/publiclines/). For growth under long-day conditions, seedlings were
grown in soil (Einheitserde GS90; Gebrüder Patzer) in a climate-controlled
chamber with 16-h daylength provided by fluorescent light at ;100 µmol
m22 s21, and day/night temperatures of 20/16°C and RH of 60/75%. After
2 weeks, seedlings were transferred to a growth chamber (16-h day,
120 µmol m22 s21) with day/night temperature of 22/16°C and 60/75% RH.
For growth on nutrient agar medium (13 Murashige and Skoog and 1%
Suc, pH 5.8), the Arabidopsis seeds were surface-sterilized using sodium
hypochlorite solution (10%) and sown on the plates. The vertically oriented
plates were stored for 2 d under vernalization conditions and then transferred to long-day growth conditions (16 h light at 22°C and 8 h dark at
18°C). Seed stocks of the SALK (http://signal.salk.edu/cgi-bin/tdnaexpress)
T-DNA insertion lines shyg-1 (SALK-066615) and aco5-1 (SALK-042400)
and the GABI-Kat (http://www.gabikat.de) insertion lines shyg-2
(GK-343D11) and aco5-2 (GK-119A07) were obtained from the Nottingham
Arabidopsis Stock Centre (http://Arabidopsis.info). T-DNA insertion
sites and homozygosity were confirmed by PCR-based genotyping (see
legend to Supplemental Figure 1 online). Primer sequences are listed in
Supplemental Table 2 online. qRT-PCR was performed to check for
transcript abundance. Plant 35S:SHYG (BASTAr) was crossed with aco5-1
(Kanr). Plant 35S:SHYG-GFP (Kanr) was crossed with aco5-2 (sulfadiaziner).
DNA Constructs
Constructs were generated by PCR. Construct generation strategies
and primer sequences are listed in Supplemental Table 2 online.
Amplicons generated by PCR were checked for correctness by
DNA sequence analysis (Eurofins MWG Operon). Constructs were
transformed into Arabidopsis Col-0 via Agrobacterium tumefaciens–
mediated transformation.
SHYG Controls Hyponastic Leaf Movement
Expression Profiling by qRT-PCR
RNA extraction, synthesis of cDNA, and qRT-PCR were done as described
(Caldana et al., 2007; Balazadeh et al., 2008, 2010). Genes included in the
qRT-PCR platforms and primer sequences are given in Supplemental Table
3 online. Primers were designed using QuantPrime (Arvidsson et al., 2008;
www.quantprime.de). PCR reactions were run on an ABI PRISM 7900HT
sequence detection system (Applied Biosystems Applera).
Affymetrix ATH1 Microarray Hybridization
The RNeasy plant mini kit (Qiagen) was used to extract total RNA from two
biological replicates of 14-d-old SHYG-IOE seedlings treated with 10 µM
b-estradiol (Sigma-Aldrich) for 5 h or ethanol (0.1%) for control. Probe
preparation and hybridization to the Arabidopsis ATH1 array were performed by ATLAS Biolabs. Data analysis was performed as reported
(Balazadeh et al., 2010). Microarray data (SHYG-IOE-5 h) are available
from the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/) under
accession number GSE38721.
Identification of SHYG Binding Sites
The DNA binding activity of SHYG-CELD fusion protein was determined as
described previously (Xue, 2002, 2005), using 1 pmol biotin-labeled synthetic oligonucleotides that were immobilized in the wells of streptavidincoated eight-well strips and binding/washing buffer (25 mM HEPES/KOH,
pH 7.0, 50 mM KCl, and 2 mM MgCl2) containing 0.5 mM DTT, 0.15 mg mL21
sheared herring sperm DNA, 0.3 mg mL21 BSA, 10% glycerol, and 0.025%
Nonidet P-40. DNA binding assays with a biotin-labeled single-stranded
oligonucleotide or a biotin-labeled double-stranded oligonucleotide without
a target binding site were used as controls.
Transactivation Assay
Transactivation assays in Arabidopsis mesophyll cell protoplasts were
performed as described (Wu et al., 2012; Rauf et al., 2013), with 35S:SHYG
and ProACO5:FLuc as effector and reporter plasmids, respectively. The 35S:
RLuc (for Renilla luciferase) vector (Licausi et al., 2011) was used for
normalization against transformation efficiency. FLuc and RLuc were assayed using the Dual Luciferase Reporter Assay System (Promega). Six
micrograms of DNA was used for protoplast transformation. Readings were
performed 8 and 16 h after transfection using a GloMax 20/20 Luminometer
(Promega). Data were collected as ratio (FLuc activity:RLuc activity).
4951
membrane (Whatman). Immunoblot analysis was performed as described
(Dortay and Mueller-Roeber, 2010) using goat polyclonal IgG primary
antibody directed against ACO (aE-18; Santa Cruz Biotechnology) and
IRDye800CW donkey anti-goat IgG secondary antibody (LI-COR). Signal
intensities were analyzed at 800 nm using the Odyssey Infrared Imaging
System (LI-COR).
In Vivo Binding of SHYG to the ACO5 Promoter
ChIP followed by qPCR (ChIP-qPCR) was performed with whole shoots from
short-day-grown, 35-d-old Arabidopsis plants expressing GFP-tagged
SHYG protein from the CaMV 35S promoter (35S:SHYG-GFP). Wild-type
plants were used as negative control. ChIP was performed as described
(Kaufmann et al., 2010) using an anti-GFP antibody. The experiment was run
in two independent replications with three technical replications per assay.
Equal amounts of starting plant material and ChIP products were used for
PCR reactions. Primers used for qPCR flanked the SHYG binding site within
the ACO5 promoter. As a negative control, we used primers annealing to
a promoter region of an Arabidopsis gene (At1g75820) lacking a SHYG
binding site. Primers are listed in Supplemental Table 2 online. ChIP-qPCR
data analysis was performed as described (Wu et al., 2012).
Waterlogging Experiments
Seedlings were grown in soil in a climate-controlled chamber with an 8-h light
period (short-day condition) provided by fluorescent light at ;100 µmol m22
s21 and day/night temperatures of 20/16°C and RH of 60/75%. After 2
weeks, seedlings were transferred to a growth chamber with a 16-h light
period (long-day condition) provided by fluorescent light at 120 µmol m22 s21
and day/night temperatures of 22/16°C and 60/75% RH. For all waterlogging
experiments, 30-d-old plants were used. Root flooding was started (t = 0 h) 6
h after the beginning of the photoperiod to prevent against the effect of
diurnal leaf movement. Plants grown individually in pots (height 5.6 cm) with
organic potting mix were placed inside plastic tanks (45 cm:27 cm:5 cm,
length:width:height) and were exposed to flooding with tap water by filling up
to 5 cm such that the upper water level always remained below the pot upper
edge. For control treatments, plants were put inside the tanks without
flooding. To assess natural variation of waterlogging-induced hyponastic leaf
movement in Arabidopsis, accession Cvi-0 (low tolerance to flooding) was
compared with Col-0 (intermediate tolerance) (Vashisht et al., 2011).
Treatment with ET Synthesis Inducers and Signaling Modifiers
Recombinant SHYG-GST protein for EMSA experiments was expressed in
Escherichia coli as described (Dortay et al., 2011). Protein purification for
EMSA was performed using a 1-mL GSTrap HP column (GE Healthcare)
coupled to an Äkta-Purifier FPLC system (GE Healthcare). EMSA was
performed as described (Wu et al., 2012) using the Odyssey Infrared EMSA
Kit (LI-COR). 59-DY682–labeled DNA fragments were purchased from
Eurofins MWG Operon. Sequences of labeled DNA fragments and unlabeled competitors are given in Supplemental Table 2 online.
To determine whether ACC or 2-chloroethylphosphonic acid (ethephon)
promotes waterlogging-induced hyponastic leaf movement, shoots were
sprayed with 10 mM each compound (in aqueous solution containing 0.1%
Tween 20) 4 h before flooding. The aqueous solution containing 0.1%
Tween 20 was used in control treatments. To test the effect of ET biosynthesis and signaling inhibitors on waterlogging-induced leaf movements, plants were sprayed with 10 mM AIB (ACO inhibitor) or 10 mM
AgNO3 (ET signaling inhibitor). To evaluate whether AgNO3 reverses ethephon-promoted waterlogging-induced hyponastic leaf movement, plants
were sprayed with 10 mM ethephon and 10 mM AgNO3 in combination. All
chemicals were from Sigma-Aldrich.
Immunoblot
Petiole Angle Measurements
Fourteen-day-old seedlings were incubated in liquid Murashige and
Skoog medium containing 10 mM b-estradiol (control treatment: 0.1%
ethanol). The seedlings were kept on a rotary shaker for 1, 2, 4, and 6 h,
harvested, and after removal of the roots immediately frozen in liquid
nitrogen. Total protein was extracted from seedlings essentially as described (Martínez-García et al., 1999). Proteins (15 µg) were separated on
12% polyacrylamide SDS gels and transferred to Protran nitrocellulose
In the intact plants, leaf hyponastic movements were recorded using highresolution digital images of rosette leaves captured using time-lapse
photography on a Color Box charge-coupled device Camera XC621
(X-Core), at a rate of one frame per 20 s. Quantitative measurements of
petiole angle kinetics from the adaxial surface of the petiole relative to the
horizontal plane were obtained on the digital images by drawing a straight
line from the petiole base using the freeware algorithm ImageJ version
EMSA
4952
The Plant Cell
1.46n (http://imagej.nih.gov/ij/). For all plants, three or more petioles were
measured, and the mean value was used for further analysis. In order to
correct for diurnal and circadian effects on leaf movements, values of
differential petiole angles were obtained by pairwise subtraction in all cases.
This was done by calculating the differences between the absolute petiole
angles of treated and control plants for each time point separately. Absolute
petiole angles are defined as the angle between the horizontal and the
petiole/lamina junction through the base of the petiole in the rosette center
(Salter et al., 2003; Benschop et al., 2007).
Epidermal Cell Length Measurements
Epidermal imprints along the abaxial and adaxial epidermal surfaces of leaf
petioles before and after waterlogging were obtained by agarose impressions (Mathur and Koncz, 1997). To this end, 1-cm-long proximal petiole
regions close to the stem were placed in 3% molten agarose and carefully
removed from the solidified carrier before taking microscopic photographs.
When dried, the thin film of gel was placed onto a microscopic slide and
observed under an M125 stereomicroscope (Leica). Cell length measurements were performed on 5-mm-long segments of the abaxial and adaxial
surfaces of the leaf petiole proximal to the stem using laser absorption
spectrometry Live-Measurement software (Leica). To allow calculations of
average cell sizes relative to the distance from the stem along the petiole,
each cell was assigned to a 200-µm class, depending on its position relative
to the most proximal part of the petiole.
GUS Assays in Twinned SHYG-IOE and ProSHYG:GUS Seedlings
Two-week-old SHYG-IOE and ProSHYG:GUS seedlings were pooled together in a tightly sealed deep-well plate to ensure the capture of ET
produced by SHYG-IOE plants inside the wells after b-estradiol induction
(see Supplemental Figure 8 online). SHYG expression in SHYG:IOE
seedlings was induced by 10 µM b-estradiol for 0, 6, 12, and 24 h (mock
treatment: 0.1% ethanol). GUS activity in the ProSHYG:GUS seedlings was
determined histochemically and quantified by spectrophotometric assay.
AIB (10 mM) was used to block ACO activity.
Other Methods
The histochemical assay for GUS activity was performed according to
Jefferson et al. (1987). Quantitative GUS assays using p-nitrophenyl glucuronide were performed as described (Wilson et al., 1992; Subramaniam
et al., 2009). For GUS staining in petioles of ProSHYG:GUS rosette leaves (see
Supplemental Figure 6A online), waterlogging was performed for 8 h. After
GUS staining, rosettes were submerged in 70% ethanol to remove chlorophyll. Free-hand cross section through the petiole region proximal to the
base was performed by cutting with a sharp razor blade. Sections were
cleared in 8:2:1 (chloral hydrate:glycerol:water) before microscopy analysis.
numbers: SHYG (At3g04070), ACO5 (At1g77330), At-EXPA8 (At2g40610),
and At-EXPA11 (At1g20190). Microarray data (SHYG-IOE-5h) are available at the Gene Expression Omnibus (www.ncbi.nlm.nih.gov/geo/) under
accession number GSE38721.
Supplemental Data
The following materials are available in the online version of this article.
Supplemental Figure 1. Confirmation of T-DNA Insertions in shyg-1,
shyg-2, aco5-1, and aco5-2 Mutants.
Supplemental Figure 2. Nuclear Localization of SHYG-GFP Fusion
Protein in Transgenic Arabidopsis.
Supplemental Figure 3. Schematic Presentation of Predicted SHYG
Binding Sites in the ACO5 Promoter and Recombinant SHYG-GST
Protein Used for EMSA.
Supplemental Figure 4. Hyponastic Leaf Growth in 4-Week-Old WildType and shyg-1 Mutant Plants upon Waterlogging.
Supplemental Figure 5. Hyponastic Leaf Movement in SHYG- and
ACO5-Modified Plants.
Supplemental Figure 6. Gene Expression in Proximal Petiole Region.
Supplemental Figure 7. Quantitative Measurements for Absolute
Angles of Leaf Petiole Kinetics Obtained Using a Time-Lapse Digital
Camera Setup.
Supplemental Figure 8. Schematic Representation of the Experimental Setup of the Twinned-Seedling Experiment.
Supplemental Figure 9. Hyponastic Leaf Movement in Arabidopsis
Accessions Col-0 and Cvi-0.
Supplemental Table 1. Genes Affected by SHYG.
Supplemental Table 2. Constructs and Primer Sequences.
Supplemental Table 3. Sequences of Primers Used for Expression
Profiling by qRT-PCR.
Supplemental Movie 1. Time-Lapse Video of Waterlogging-Induced
Hyponastic Leaf Growth in 35S:SHYG, Wild-Type, and shyg-2 Plants.
Supplemental Movie 2. Time-Lapse Video of Waterlogging-Induced
Hyponastic Leaf Growth in shyg-1, Wild-Type, and shyg-2 Plants.
Supplemental Movie 3. Time-Lapse Video of Waterlogging-Induced
Hyponastic Leaf Growth in aco5-1, aco5-2, and Wild-Type Plants.
Supplemental Movie 4. Time-Lapse Video of Waterlogging-Induced
Hyponastic Leaf Growth in 35S-SHYG/aco5-1, Wild-Type, and 35S:
SHYG-GFP/aco5-2 Plants.
Microscopy
ACKNOWLEDGMENTS
Distribution of SHYG-GFP fusion protein was analyzed by confocal
fluorescence microscopy using an Eclipse E600 microscope (Nikon).
We thank Eugenia Maximova for microscopy assistance, Josef Bergstein
for photographic work, and Karin Koehl and colleagues for plant care.
Financial support was provided by the Deutsche Forschungsgemeinschaft (MU 1199/14-1).
Statistical Analyses
Statistical analyses were performed using Student’s t test embedded in
the Microsoft Excel software. Only the return of P < 0.05 was taken as
statistically significant.
Accession Numbers
Sequence data from this article can be found in the Arabidopsis Genome
Initiative or GenBank/EMBL databases under the following accession
AUTHOR CONTRIBUTIONS
B.M.-R. initiated the research. B.M.-R., S.B., M.R., and M.A. designed the
experiments. M.R. and M.A. conducted the experiments. G.-P.X. performed the binding site selection assay. J.F. provided expertise in timelapse video imaging. B.M.-R., M.R., and S.B. prepared the article with input
from all the authors.
SHYG Controls Hyponastic Leaf Movement
Received August 27, 2013; revised November 9, 2013; accepted
November 30, 2013; published December 20, 2013.
REFERENCES
Arvidsson, S., Kwasniewski, M., Riaño-Pachón, D.M., and MuellerRoeber, B. (2008). QuantPrime—A flexible tool for reliable highthroughput primer design for quantitative PCR. BMC Bioinformatics
9: 465.
Bailey-Serres, J., and Voesenek, L.A.C.J. (2008). Flooding stress:
Acclimations and genetic diversity. Annu. Rev. Plant Biol. 59: 313–339.
Balazadeh, S., Kwasniewski, M., Caldana, C., Mehrnia, M., Zanor, M.I.,
Xue, G.P., and Mueller-Roeber, B. (2011). ORS1, an H₂O₂-responsive
NAC transcription factor, controls senescence in Arabidopsis thaliana.
Mol. Plant 4: 346–360.
Balazadeh, S., Riaño-Pachón, D.M., and Mueller-Roeber, B. (2008).
Transcription factors regulating leaf senescence in Arabidopsis thaliana.
Plant Biol. (Stuttg.) 10 (suppl. 1): 63–75.
Balazadeh, S., Siddiqui, H., Allu, A.D., Matallana-Ramirez, L.P.,
Caldana, C., Mehrnia, M., Zanor, M.I., Köhler, B., and MuellerRoeber, B. (2010). A gene regulatory network controlled by the NAC
transcription factor ANAC092/AtNAC2/ORE1 during salt-promoted
senescence. Plant J. 62: 250–264.
Banga, M., Slaa, E.J., Blom, C.W.P.M., and Voesenek, L.A.C.J.
(1996). Ethylene biosynthesis and accumulation under drained and
submerged conditions (a comparative study of two Rumex species).
Plant Physiol. 112: 229–237.
Benschop, J.J., Millenaar, F.F., Smeets, M.E., van Zanten, M.,
Voesenek, L.A.C.J., and Peeters, A.J. (2007). Abscisic acid
antagonizes ethylene-induced hyponastic growth in Arabidopsis.
Plant Physiol. 143: 1013–1023.
Berger, Y., Harpaz-Saad, S., Brand, A., Melnik, H., Sirding, N.,
Alvarez, J.P., Zinder, M., Samach, A., Eshed, Y., and Ori, N.
(2009). The NAC-domain transcription factor GOBLET specifies leaflet
boundaries in compound tomato leaves. Development 136: 823–832.
Bradford, K.J., and Yang, S.F. (1980). Xylem transport of 1aminocyclopropane-1-carboxylic acid, an ethylene precursor, in
waterlogged tomato plants. Plant Physiol. 65: 322–326.
Burrows, W.J., and Carr, D.J. (1969). Effects of flooding the root
system of sunflower plants on the cytokinin content of the xylem
sap. Plant Physiol. 22: 1105–1112.
Caldana, C., Scheible, W.R., Mueller-Roeber, B., and Ruzicic, S.
(2007). A quantitative RT-PCR platform for high-throughput expression
profiling of 2500 rice transcription factors. Plant Methods 3: 7.
Chang, K.N., et al. (2013). Temporal transcriptional response to ethylene gas
drives growth hormone cross-regulation in Arabidopsis. Elife 2: e00675.
Chao, Q., Rothenberg, M., Solano, R., Roman, G., Terzaghi, W., and
Ecker, J.R. (1997). Activation of the ethylene gas response pathway in
Arabidopsis by the nuclear protein ETHYLENE-INSENSITIVE3 and related
proteins. Cell 89: 1133–1144.
Cho, H.T., and Kende, H. (1997). Expression of expansin genes is
correlated with growth in deepwater rice. Plant Cell 9: 1661–1671.
Cosgrove, D.J. (2000). Loosening of plant cell walls by expansins.
Nature 407: 321–326.
Cox, M.C.H., Millenaar, F.F., Van Berkel, Y.E.M.D.J., Peeters, A.J.M.,
and Voesenek, L.A.C.J. (2003). Plant movement. Submergence-induced
petiole elongation in Rumex palustris depends on hyponastic growth.
Plant Physiol. 132: 282–291.
Dortay, H., Akula, U.M., Westphal, C., Sittig, M., and MuellerRoeber, B. (2011). High-throughput protein expression using
a combination of ligation-independent cloning (LIC) and infrared
fluorescent protein (IFP) detection. PLoS ONE 6: e18900.
4953
Dortay, H., and Mueller-Roeber, B. (2010). A highly efficient pipeline
for protein expression in Leishmania tarentolae using infrared fluorescence
protein as marker. Microb. Cell Fact. 9: 29.
Duval, M., Hsieh, T.F., Kim, S.Y., and Thomas, T.L. (2002). Molecular
characterization of AtNAM: A member of the Arabidopsis NAC domain
superfamily. Plant Mol. Biol. 50: 237–248.
Fujita, M., Fujita, Y., Maruyama, K., Seki, M., Hiratsu, K., Ohme-Takagi,
M., Tran, L.S.P., Yamaguchi-Shinozaki, K., and Shinozaki, K. (2004).
A dehydration-induced NAC protein, RD26, is involved in a novel ABAdependent stress-signaling pathway. Plant J. 39: 863–876.
Guo, H., and Ecker, J.R. (2003). Plant responses to ethylene gas are
mediated by SCF(EBF1/EBF2)-dependent proteolysis of EIN3
transcription factor. Cell 115: 667–677.
Guo, Y., and Gan, S. (2006). AtNAP, a NAC family transcription factor,
has an important role in leaf senescence. Plant J. 46: 601–612.
Hattori, Y., Nagai, K., and Ashikari, M. (2011). Rice growth adapting
to deepwater. Curr. Opin. Plant Biol. 14: 100–105.
Hattori, Y., et al. (2009). The ethylene response factors SNORKEL1 and
SNORKEL2 allow rice to adapt to deep water. Nature 460: 1026–1030.
Hickman, R., et al. (2013). A local regulatory network around three
NAC transcription factors in stress responses and senescence in
Arabidopsis leaves. Plant J. 75: 26–39.
Hu, H., Dai, M., Yao, J., Xiao, B., Li, X., Zhang, Q., and Xiong, L.
(2006). Overexpressing a NAM, ATAF, and CUC (NAC) transcription
factor enhances drought resistance and salt tolerance in rice. Proc.
Natl. Acad. Sci. USA 103: 12987–12992.
Huynh, N., Vantoai, T., Streeter, J., and Banowetz, G. (2005).
Regulation of flooding tolerance of SAG12:ipt Arabidopsis plants by
cytokinin. J. Exp. Bot. 56: 1397–1407.
Jackson, M.B. (2008). Ethylene-promoted elongation: An adaptation
to submergence stress. Ann. Bot. (Lond.) 101: 229–248.
Jefferson, R.A., Kavanagh, T.A., and Bevan, M.W. (1987). GUS
fusions: Beta-glucuronidase as a sensitive and versatile gene fusion
marker in higher plants. EMBO J. 6: 3901–3907.
Jensen, M.K., Hagedorn, P.H., de Torres-Zabala, M., Grant, M.R., Rung,
J.H., Collinge, D.B., and Lyngkjaer, M.F. (2008). Transcriptional regulation
by an NAC (NAM-ATAF1,2-CUC2) transcription factor attenuates ABA
signalling for efficient basal defence towards Blumeria graminis f. sp. hordei
in Arabidopsis. Plant J. 56: 867–880.
Jeong, J.S., Kim, Y.S., Baek, K.H., Jung, H., Ha, S.H., Do Choi, Y.,
Kim, M., Reuzeau, C., and Kim, J.K. (2010). Root-specific
expression of OsNAC10 improves drought tolerance and grain yield
in rice under field drought conditions. Plant Physiol. 153: 185–197.
Jung, K.H., Seo, Y.S., Walia, H., Cao, P., Fukao, T., Canlas, P.E.,
Amonpant, F., Bailey-Serres, J., and Ronald, P.C. (2010). The
submergence tolerance regulator Sub1A mediates stress-responsive
expression of AP2/ERF transcription factors. Plant Physiol. 152:
1674–1692.
Kaufmann, K., Muiño, J.M., Østerås, M., Farinelli, L., Krajewski, P., and
Angenent, G.C. (2010). Chromatin immunoprecipitation (ChIP) of plant
transcription factors followed by sequencing (ChIP-SEQ) or hybridization
to whole genome arrays (ChIP-CHIP). Nat. Protoc. 5: 457–472.
Kende, H., Bradford, K.K., Brummell, D.A., Cho, H.T., Cosgrove, D.J.,
Fleming, A.J., Gehring, C., Lee, Y., McQueen-Mason, S., Rose, J.K.C.,
and Voesenek, L.A.C.J. (2004). Nomenclature for members of the
expansin superfamily of genes and proteins. Plant Mol. Biol. 55: 311–314.
Kim, J.H., Cho, H.T., and Kende, H. (2000). Alpha-expansins in the
semiaquatic ferns Marsilea quadrifolia and Regnellidium diphyllum:
Evolutionary aspects and physiological role in rachis elongation.
Planta 212: 85–92.
Kim, J.H., Woo, H.R., Kim, J., Lim, P.O., Lee, I.C., Choi, S.H., Hwang, D.,
and Nam, H.G. (2009). Trifurcate feed-forward regulation of age-dependent
cell death involving miR164 in Arabidopsis. Science 323: 1053–1057.
4954
The Plant Cell
Li, P., Wind, J.J., Shi, X., Zhang, H., Hanson, J., Smeekens, S.C., and
Teng, S. (2011). Fructose sensitivity is suppressed in Arabidopsis by the
transcription factor ANAC089 lacking the membrane-bound domain.
Proc. Natl. Acad. Sci. USA 108: 3436–3441.
Lee, S., Seo, P.J., Lee, H.J., and Park, C.M. (2012). A NAC transcription
factor NTL4 promotes reactive oxygen species production during
drought-induced leaf senescence in Arabidopsis. Plant J. 70:
831–844.
Lee, S.C., Mustroph, A., Sasidharan, R., Vashisht, D., Pedersen, O.,
Oosumi, T., Voesenek, L.A.C.J., and Bailey-Serres, J. (2011).
Molecular characterization of the submergence response of the
Arabidopsis thaliana ecotype Columbia. New Phytol. 190: 457–471.
Licausi, F., Weits, D.A., Pant, B.D., Scheible, W.R., Geigenberger,
P., and van Dongen, J.T. (2011). Hypoxia responsive gene
expression is mediated by various subsets of transcription factors
and miRNAs that are determined by the actual oxygen availability.
New Phytol. 190: 442–456.
Lin, Z., Zhong, S., and Grierson, D. (2009). Recent advances in
ethylene research. J. Exp. Bot. 60: 3311–3336.
Linkies, A., Müller, K., Morris, K., Turecková, V., Wenk, M.,
Cadman, C.S., Corbineau, F., Strnad, M., Lynn, J.R., FinchSavage, W.E., and Leubner-Metzger, G. (2009). Ethylene interacts
with abscisic acid to regulate endosperm rupture during
germination: a comparative approach using Lepidium sativum and
Arabidopsis thaliana. Plant Cell 21: 3803–3822.
Lu, P.L., Chen, N.Z., An, R., Su, Z., Qi, B.S., Ren, F., Chen, J., and
Wang, X.C. (2007). A novel drought-inducible gene, ATAF1,
encodes a NAC family protein that negatively regulates the expression
of stress-responsive genes in Arabidopsis. Plant Mol. Biol. 63:
289–305.
Martínez-García, J.F., Monte, E., and Quail, P.H. (1999). A simple,
rapid and quantitative method for preparing Arabidopsis protein
extracts for immunoblot analysis. Plant J. 20: 251–257.
Mathur, J., and Koncz, C. (1997). Method for preparation of
epidermal imprints using agarose. Biotechniques 22: 280–282.
Millenaar, F.F., Cox, M.C.H., van Berkel, Y.E.M.D.J., Welschen, R.
A.M., Pierik, R., Voesenek, L.A.C.J., and Peeters, A.J.M. (2005).
Ethylene-induced differential growth of petioles in Arabidopsis.
Analyzing natural variation, response kinetics, and regulation. Plant
Physiol. 137: 998–1008.
Nishitani, K., and Vissenberg, K. (2007). Roles of the XTH protein
family in the expanding cell. In The Expanding Cell. Plant Cell
Monographs, Vol. 5, Verbelen, J.-P., and Vissenberg, K., eds
(Berlin: Springer), pp. 89–116.
Nuruzzaman, M., Manimekalai, R., Sharoni, A.M., Satoh, K.,
Kondoh, H., Ooka, H., and Kikuchi, S. (2010). Genome-wide
analysis of NAC transcription factor family in rice. Gene 465: 30–44.
Ogo, Y., Kobayashi, T., Nakanishi Itai, R., Nakanishi, H., Kakei, Y.,
Takahashi, M., Toki, S., Mori, S., and Nishizawa, N.K. (2008). A
novel NAC transcription factor, IDEF2, that recognizes the iron
deficiency-responsive element 2 regulates the genes involved in
iron homeostasis in plants. J. Biol. Chem. 283: 13407–13417.
Olsen, A.N., Ernst, H.A., Leggio, L.L., and Skriver, K. (2005). NAC
transcription factors: Structurally distinct, functionally diverse.
Trends Plant Sci. 10: 79–87.
Ooka, H., et al. (2003). Comprehensive analysis of NAC family genes
in Oryza sativa and Arabidopsis thaliana. DNA Res. 10: 239–247.
Ouaked, F., Rozhon, W., Lecourieux, D., and Hirt, H. (2003). A
MAPK pathway mediates ethylene signaling in plants. EMBO J. 22:
1282–1288.
Peng, H.P., Lin, T.Y., Wang, N.N., and Shih, M.C. (2005). Differential
expression of genes encoding 1-aminocyclopropane-1-carboxylate
synthase in Arabidopsis during hypoxia. Plant Mol. Biol. 58: 15–25.
Pierik, R., Millenaar, F.F., Peeters, A.J.M., and Voesenek, L.A.C.J.
(2005). New perspectives in flooding research: The use of shade
avoidance and Arabidopsis thaliana. Ann. Bot. (Lond.) 96: 533–540.
Polko, J.K., Pierik, R., van Zanten, M., Tarkowská, D., Strnad, M.,
Voesenek, L.A.C.J., and Peeters, A.J. (2013). Ethylene promotes
hyponastic growth through interaction with ROTUNDIFOLIA3/
CYP90C1 in Arabidopsis. J. Exp. Bot. 64: 613–624.
Polko, J.K., van Zanten, M., van Rooij, J.A., Marée, A.F.M.,
Voesenek, L.A.C.J., Peeters, A.J.M., and Pierik, R. (2012).
Ethylene-induced differential petiole growth in Arabidopsis thaliana
involves local microtubule reorientation and cell expansion. New
Phytol. 193: 339–348.
Polko, J.K., Voesenek, L.A.C.J., Peeters, A.J., and Pierik, R. (2011).
Petiole hyponasty: An ethylene-driven, adaptive response to changes in
the environment. AoB Plants 2011: plr031.
Puranik, S., Sahu, P.P., Mandal, S.N., B, V.S., Parida, S.K., and
Prasad, M. (2013). Comprehensive genome-wide survey, genomic
constitution and expression profiling of the NAC transcription factor
family in foxtail millet (Setaria italica L.). PLoS ONE 8: e64594.
Rauf, M., Arif, M., Dortay, H., Matallana-Ramírez, L.P., Waters, M.T.,
Nam, H.G., Lim, P.O., Mueller-Roeber, B., and Balazadeh, S. (2013).
ORE1 balances leaf senescence against maintenance by antagonizing
G2-like-mediated transcription. EMBO Rep. 14: 382–388.
Roman, G., Lubarsky, B., Kieber, J.J., Rothenberg, M., and Ecker,
J.R. (1995). Genetic analysis of ethylene signal transduction in
Arabidopsis thaliana: Five novel mutant loci integrated into a stress
response pathway. Genetics 139: 1393–1409.
Rose, J.K.C., Braam, J., Fry, S.C., and Nishitani, K. (2002). The XTH
family of enzymes involved in xyloglucan endotransglucosylation
and endohydrolysis: Current perspectives and a new unifying
nomenclature. Plant Cell Physiol. 43: 1421–1435.
Salter, M.G., Franklin, K.A., and Whitelam, G.C. (2003). Gating of the
rapid shade-avoidance response by the circadian clock in plants.
Nature 426: 680–683.
Sambrook, J., Fritsche, E.F., and Maniatis, T. (2001). Molecular
Cloning: A Laboratory Manual, 3rd ed. (Cold Spring Harbor, NY:
Cold Spring Harbor Laboratory Press).
Schaller, G.E. (2012). Ethylene and the regulation of plant development.
BMC Biol. 10: 9.
Schaller, G.E., and Kieber, J.J. (2002). Ethylene. The Arabidopsis
Book 1: e0071, doi/10.1199/tab.0071.
Seo, P.J., Kim, S.G., and Park, C.M. (2008). Membrane-bound
transcription factors in plants. Trends Plant Sci. 13: 550–556.
Shahnejat-Bushehri, S., Mueller-Roeber, B., and Balazadeh, S.
(2012). Arabidopsis NAC transcription factor JUNGBRUNNEN1
affects thermomemory-associated genes and enhances heat stress
tolerance in primed and unprimed conditions. Plant Signal. Behav.
7: 1518–1521.
Singh, A.K., Sharma, V., Pal, A.K., Acharya, V., and Ahuja, P.S.
(2013). Genome-wide organization and expression profiling of the
NAC transcription factor family in potato (Solanum tuberosum L.).
DNA Res. 20: 403–423.
Skirycz, A., Reichelt, M., Burow, M., Birkemeyer, C., Rolcik, J.,
Kopka, J., Zanor, M.I., Gershenzon, J., Strnad, M., Szopa, J.,
Mueller-Roeber, B., and Witt, I. (2006). DOF transcription factor
AtDof1.1 (OBP2) is part of a regulatory network controlling glucosinolate
biosynthesis in Arabidopsis. Plant J. 47: 10–24.
Stepanova, A.N., and Alonso, J.M. (2009). Ethylene signaling and
response: Where different regulatory modules meet. Curr. Opin. Plant
Biol. 12: 548–555.
Subramaniam, S., Balasubramaniam, V., Poobathy, R., Sreenivasan,
S., and Rathinam, X. (2009). Chemotaxis movement and attachment of
Agrobacterium tumefaciens to Phalaenopsis violacea orchid tissues: An
SHYG Controls Hyponastic Leaf Movement
assessment of early factors influencing the efficiency of gene transfer.
Trop. Life Sci. Res. 20: 39–49.
Tran, L.S.P., Nakashima, K., Sakuma, Y., Simpson, S.D., Fujita, Y.,
Maruyama, K., Fujita, M., Seki, M., Shinozaki, K., and YamaguchiShinozaki, K. (2004). Isolation and functional analysis of Arabidopsis
stress-inducible NAC transcription factors that bind to a droughtresponsive cis-element in the early responsive to dehydration stress 1
promoter. Plant Cell 16: 2481–2498.
Trought, M.C.T., and Drew, M.C. (1980). The development of waterlogging
damage in wheat seedlings (Triticum aestivum L.). I. Shoot and root
growth in relation to changes in the concentrations of dissolved gases
and solutes in the soil solution. Plant Soil 54: 77–94.
Uauy, C., Distelfeld, A., Fahima, T., Blechl, A., and Dubcovsky, J.
(2006). A NAC gene regulating senescence improves grain protein,
zinc, and iron content in wheat. Science 314: 1298–1301.
Van Sandt, V.S.T., Suslov, D., Verbelen, J.P., and Vissenberg, K.
(2007). Xyloglucan endotransglucosylase activity loosens a plant
cell wall. Ann. Bot. (Lond.) 100: 1467–1473.
VanToai, T.T., Beuerlein, J.E., Schmitthenner, A.F., and St. Martin,
K.S. (1994). Genetic variability for flooding tolerance in soybeans.
Crop Sci. 34: 1112–1115.
van Zanten, M., Ritsema, T., Polko, J.K., Leon-Reyes, A.,
Voesenek, L.A.C.J., Millenaar, F.F., Pieterse, C.M.J., and
Peeters, A.J.M. (2012). Modulation of ethylene- and heat-controlled
hyponastic leaf movement in Arabidopsis thaliana by the plant defence
hormones jasmonate and salicylate. Planta 235: 677–685.
Vashisht, D., Hesselink, A., Pierik, R., Ammerlaan, J.M.H., BaileySerres, J., Visser, E.J., Pedersen, O., van Zanten, M., Vreugdenhil,
D., Jamar, D.C.L., Voesenek, L.A.C.J., and Sasidharan, R. (2011).
Natural variation of submergence tolerance among Arabidopsis thaliana
accessions. New Phytol. 190: 299–310.
Voesenek, L.A.C.J., Benschop, J.J., Bou, J., Cox, M.C.H., Groeneveld,
H.W., Millenaar, F.F., Vreeburg, R.A.M., and Peeters, A.J.M. (2003).
Interactions between plant hormones regulate submergence-induced
shoot elongation in the flooding-tolerant dicot Rumex palustris. Ann.
Bot. (Lond.) 91 (Spec. No.): 205–211.
Voesenek, L.A.C.J., Colmer, T.D., Pierik, R., Millenaar, F.F., and
Peeters, A.J.M. (2006). How plants cope with complete submergence.
New Phytol. 170: 213–226.
Vreeburg, R.A.M., Benschop, J.J., Peeters, A.J.M., Colmer, T.D.,
Ammerlaan, A.H.M., Staal, M., Elzenga, T.M., Staals, R.H.J.,
Darley, C.P., McQueen-Mason, S.J., and Voesenek, L.A.C.J.
(2005). Ethylene regulates fast apoplastic acidification and expansin
A transcription during submergence-induced petiole elongation in
Rumex palustris. Plant J. 43: 597–610.
Vriezen, W.H., Hulzink, R., Mariani, C., and Voesenek, L.A.C.J.
(1999). 1-Aminocyclopropane-1-carboxylate oxidase activity limits
ethylene biosynthesis in Rumex palustris during submergence.
Plant Physiol. 121: 189–196.
Wang, X., Basnayake, B.M.V.S., Zhang, H., Li, G., Li, W., Virk, N.,
Mengiste, T., and Song, F. (2009). The Arabidopsis ATAF1, a NAC
transcription factor, is a negative regulator of defense responses
against necrotrophic fungal and bacterial pathogens. Mol. Plant
Microbe Interact. 22: 1227–1238.
4955
Wilson, K.J., Hughes, S.G., and Jefferson, R.A. (1992). The
Escherichia coli gus operon, induction and expression of the gus
operon in E. coli and the occurrence and use of GUS in other
bacteria. In GUS Protocols: Using the GUS Gene as a Reporter of
Gene Expression, S. Gallagher, ed (New York: Academic Press),
pp. 7–23.
Wu, A., et al. (2012). JUNGBRUNNEN1, a reactive oxygen speciesresponsive NAC transcription factor, regulates longevity in Arabidopsis.
Plant Cell 24: 482–506.
Wu, Y., Deng, Z., Lai, J., Zhang, Y., Yang, C., Yin, B., Zhao, Q.,
Zhang, L., Li, Y., Yang, C., and Xie, Q. (2009). Dual function of
Arabidopsis ATAF1 in abiotic and biotic stress responses. Cell Res.
19: 1279–1290.
Xu, K., Xu, X., Fukao, T., Canlas, P., Maghirang-Rodriguez, R.,
Heuer, S., Ismail, A.M., Bailey-Serres, J., Ronald, P.C., and
Mackill, D.J. (2006). Sub1A is an ethylene-response-factor-like
gene that confers submergence tolerance to rice. Nature 442:
705–708.
Xue, G.P. (2002). Characterisation of the DNA-binding profile of barley
HvCBF1 using an enzymatic method for rapid, quantitative and
high-throughput analysis of the DNA-binding activity. Nucleic Acids
Res. 30: e77.
Xue, G.P. (2005). A CELD-fusion method for rapid determination of the
DNA-binding sequence specificity of novel plant DNA-binding proteins.
Plant J. 41: 638–649.
Xue, G.P., Bower, N.I., McIntyre, C.L., Riding, G.A., Kazan, K., and
Shorter, R. (2006). TaNAC69 from the NAC superfamily of transcription
factors is up-regulated by abiotic stresses in wheat and recognises
two consensus DNA-binding sequences. Funct. Plant Biol. 33:
43–57.
Yamaguchi, M., Ohtani, M., Mitsuda, N., Kubo, M., Ohme-Takagi,
M., Fukuda, H., and Demura, T. (2010). VND-INTERACTING2, a NAC
domain transcription factor, negatively regulates xylem vessel formation
in Arabidopsis. Plant Cell 22: 1249–1263.
Yang, S.D., Seo, P.J., Yoon, H.K., and Park, C.M. (2011). The
Arabidopsis NAC transcription factor VNI2 integrates abscisic acid
signals into leaf senescence via the COR/RD genes. Plant Cell 23:
2155–2168.
Yang, S.F., and Hoffmann, N.E. (1984). Ethylene biosynthesis and its
regulation in higher plants. Annu. Rev. Plant Physiol. 35: 155–189.
Zhang, J., VanToai, T.T., Huynh, L.N., and Preiszner, J. (2000).
Flooding tolerance of transgenic Arabidopsis plants containing the
autoregulated cytokinin biosynthesis system. Mol. Breed. 6: 135–
144.
Zhong, R., Lee, C., and Ye, Z.H. (2010). Global analysis of direct
targets of secondary wall NAC master switches in Arabidopsis. Mol.
Plant 3: 1087–1103.
Zhong, R., McCarthy, R.L., Lee, C., and Ye, Z.H. (2011). Dissection
of the transcriptional program regulating secondary wall biosynthesis
during wood formation in poplar. Plant Physiol. 157: 1452–1468.
Zuo, J., Niu, Q.W., and Chua, N.H. (2000). Technical advance: An
estrogen receptor-based transactivator XVE mediates highly
inducible gene expression in transgenic plants. Plant J. 24: 265–
273.
NAC Transcription Factor SPEEDY HYPONASTIC GROWTH Regulates Flooding-Induced Leaf
Movement in Arabidopsis
Mamoona Rauf, Muhammad Arif, Joachim Fisahn, Gang-Ping Xue, Salma Balazadeh and Bernd
Mueller-Roeber
Plant Cell 2013;25;4941-4955; originally published online December 20, 2013;
DOI 10.1105/tpc.113.117861
This information is current as of August 2, 2017
Supplemental Data
/content/suppl/2013/12/19/tpc.113.117861.DC2.html
/content/suppl/2013/12/11/tpc.113.117861.DC1.html
References
This article cites 95 articles, 25 of which can be accessed free at:
/content/25/12/4941.full.html#ref-list-1
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs
Sign up for eTOCs at:
http://www.plantcell.org/cgi/alerts/ctmain
CiteTrack Alerts
Sign up for CiteTrack Alerts at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription Information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY