Download Microsoft Word - Supplemental Methods-Phil 8-17-2016

Supplemental Methods:
Matrigel Invasion Assay:
Briefly, MMTV-PyMT mammary tumor cells were pretreated with vehicle or with BKM120 for 30
min at the concentrations of 30, 100, 300 and 1000 nM. One hundred thousand cells were
loaded in the upper well of the transwell and invasion was induced in response to a gradient of
CXCL12 (0 – 100 ng/ml) emitted from the lower chamber for 24 hours in the presence of
BKM120 throughout the experiment.
Tumor harvesting and processing for flow cytometry:
Mice were anesthetized with 2.5% isoflurane (Isothesia, Henry Schein Animal Health, Dublin,
OH). Blood was collected via heart puncture to collect circulating tumor cells, and then mice
were sacrificed by cervical dislocation. Primary tumor was removed, and part of it was cut into
small pieces and mixed with 5 ml tumor dissociation buffer [complete RPMI medium containing
300 CDU/ml Collagenase I, 1 mg/ml Dispase II, and 2000 U/ml DNase I (Sigma-Aldrich, St.
Louis, MO)]. The tumor sample was processed on a Gentlemacs dissociator (Miltenyi Biotec,
San Diego, CA) and then rocked on a nutator for 1 hour at 37C. The dissociated tumor sample
was filtered through a cell strainer (BD Biosciences), washed with PEB buffer (PBS pH 7.2,
0.5% BSA and 2 mM EDTA), and then stimulated for 4 hours at 37C in 2 ml of stimulation
buffer [complete RPMI containing 10 ng/ml PMA, 1 µg/ml Ionomycin, 0.66 µl/ml Golgistop, and 1
µl/ml Golgiplug (Sigma-Aldrich)]. Cells were then washed and re-suspended at 107 cell/ml in
PEB buffer. One million of these cells were mixed with extracellular staining cocktail (mixture of
different fluorescence tagged antibodies for cell surface marker in PEB buffer) and incubated on
ice for 30 min in the dark. After staining, cells were washed thrice in PEB buffer and
permeabilized in perm buffer according to the manufacturer’s recommendation (Sigma-Aldrich).
Cells were then stained with an intracellular staining cocktail (mixture of intracellular antibodies
in PEB buffer) at room temperature for 20 min in the dark. Cells were finally washed thrice and
re-suspended in 400 µl PEB for flow cytometry. FACS data acquisition was performed on the
LSR-II system (BD Biosciences) and FlowJo software was used for analysis as previously
described {Vilgelm, 2015 #145} .
Histology and Immunohistochemistry:
Formalin-Fixed-Paraffin Embedded (FFPE) tissues were sectioned at 5m and staining for H&E
or Masson Trichrome Blue was performed as previously described (1). PicroSirius Red staining
was performed as previously described and immunofluorescence for cytokeratin 8 and Vimentin
were performed with Ftizgerald guinea pig K8 at 1:500 with chicken Vimentin from Covance at
1:1000. Slides were placed on the Leica Bond Max IHC stainer. All steps besides dehydration,
clearing and coverslipping are performed on the Bond Max. Slides are deparaffinized. Heat
induced antigen retrieval was performed on the Bond Max using their Epitope Retrieval 2
solution for 20 minutes. Slides were incubated with primary rat antibody for one hour at the
recommended dilution and then incubated in a rabbit anti-rat secondary (BA-4001, Vector
Laboratories, Inc.) for 15mins at a 1:200 dilution. The Bond Polymer Refine detection system
was used for visualization. Slides were then dehydrated, cleared and cover slipped. FoxP3(FJK16s) eBioscience, Inc., San Diego, CA 1:100. CD4(4SM95) eBioscience, Inc., San Diego, CA
1:1000. CD8(4SM15) eBioscience, Inc., San Diego, CA 1:1500. B220/CD45RO(RA3-6B2)
BDPharmingen, San Diego, CA 1:200.
Development of a humanized mouse model for breast cancer
The CD4+ and CD8+ T cells from cancer patients from which PDX were generated were
purified from peripheral blood and expanded in vitro by culturing in TexMACS medium with 50
U/ml hIL-2 and 70 ng/ml hIL-7-Fc followed by Dynabeads CD3/CD28/CD137 stimulation.
Th1/Th2 phenotype of expanded cells was evaluated by antibody staining for CD4, CD25,
CD69, CD8 and CD107a and flow cytometry analysis. Figure 4A indicates that, in contrast to the
original T cells, CD4+CD25+ and CD8+CD107a+ T cells were greatly increased (44% vs. 1% and
17% vs 4%) in the cultured cells.
NSGB mice were sub-lethally irradiated with 200 cGy. Patient peripheral blood CD34+
hematopoietic stem cells (HSCs) were isolated using ficoll hypaque centrifugation and a positive
selection kit (Stem Cell Technology), expanded in stem cell media and transplanted (4106) into
40 irradiated adult (2–4 month old) female mice by tail vein injection. One month after bone
marrow transplant, peripheral human vs. mouse CD45+ cells were monitored by FACS to
assess reconstitution. Chimerism, was calculated as follows: % CD45+ human cells/total cells
(human CD45+ cells plus mouse CD45+ cells).
One and half months after HSC transplantation, a small piece (12 mm) of the PDX from the
TN breast cancer patients (2) that had been successfully grown in NSGB mice was implanted
into the 4th mammary fat pad of each of the 40 NSGB mice (20 mice per patient tumor) that had
been previously engrafted with the patients CD34+ HCSs. When the PDX diameter reached
55 mm in mice where hCD45+ cells constituted over 30% of the peripheral blood, mice were
treated 2 weeks with 30 mg/kg of BKM120 daily via oral gavage. The patient’s expanded
peripheral CD4+ and CD8+ T cells (2106) were then infused intravenously into the tumor
bearing mice and BKM120 daily treatment continued for an additional 2 weeks, after which mice
were euthanized, tumors were removed for volume determination and aliquoted for histology
and FACS analysis of infiltrating leukocytes as previously described.(2).
T cell proliferation and cytotoxicity assay
Splenocytes were isolated from OT-I or OT-II mice and proliferation in response to BKM120 or
vehicle control was evaluated (3) in the presence of different concentrations of BKM120 or
vehicle control for 4 days using carboxyfluorescein succinimidyl ester (CFSE) (Biolegend, San
Diego, CA) staining and flow. The cells were collected and stained with 7AAD and APC labeled
anti-CD8 or CD4 antibody, and examined by flow (LSRII) (BD Biosciences, San Jose, CA).
CD8+ effector T cells were isolated from the spleen of BALB/c mice orthotopically implanted
with 4T1 breast tumor cells (1 x 106) and then 3 days after implantation, mice were treated with
vehicle or BKM120 (30mg/kg) daily for 7 days. The CD8+ T cell isolation was by negative
selection using the EasySep Mouse CD8+T cell Enrichment Cocktail (Stemcell Technologies).
CD8+ effector cells were co-cultured with target 4T1 cells that were genetically engineered to
express a luciferase reporter over a E/T ratio range of 0/1 to 50/1. After co-culture for 18h,
remaining viable cells were collected by centrifugation and luciferase activity in the lysate was
determined.
CD8+ cell depletion
Anti CD8 antibodies were delivered i. p. at dosage 100 µg/mouse for the first three days and
then every other day for three weeks total.
PCR Primers: PCR was performed with the PCR kit SYBR (Applied Biosystems/ThermoFisher
Scientific):
Arginase I (Fwd: CTCCAAGCCAAAGTCCTTAGAG; Rev: AGGAGCTGTCATTAGGGACATC);
COX2 (FWD: TTCAACACACTCTATCACTGGC; REV: AGAAGCGTTTGCGGTACTCAT), IL6
(FWD: CCAAGAGGTGAGTGCTTCCC; REV: CTGTTGTTCAGACTCTCTCCCT); and IL10
(FWD: GCTCTTACTGACTGGCATGAG; REV: CGCAGCTCTAGGAGCATGTG).
Additional primers are referenced in Novitiskiy SV, Pickup MW, Gorska A, Owens P, Chytil A,
Aakre M, Wu H, Shyr Y, Moses HL. Cancer Discov 1 (5) 430-441, 2011
1.
Pickup MW, Hover LD, Polikowsky ER, Chytil A, Gorska AE, Novitskiy SV, et al. BMPR2
loss in fibroblasts promotes mammary carcinoma metastasis via increased inflammation. Mol
Oncol. 2015;9:179-91.
2.
Vilgelm AE, Pawlikowski JS, Liu Y, Hawkins OE, Davis TA, Smith J, et al. Mdm2 and
aurora kinase a inhibitors synergize to block melanoma growth by driving apoptosis and
immune clearance of tumor cells. Cancer research. 2015;75:181-93.
3.
Youn JI, Nagaraj S, Collazo M, Gabrilovich DI. Subsets of myeloid-derived suppressor
cells in tumor-bearing mice. J Immunol. 2008;181:5791-802.