Download Functional coupling of FcRI to nicotinamide adenine

From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
PHAGOCYTES
Functional coupling of Fc␥RI to nicotinamide adenine dinucleotide phosphate
(reduced form) oxidative burst and immune complex trafficking requires
the activation of phospholipase D1
Alirio J. Melendez, Luce Bruetschy, R. Andres Floto, Margaret M. Harnett, and Janet M. Allen
Immunoglobulin G (IgG) receptors (Fc␥Rs)
on myeloid cells are responsible for the
internalization of immune complexes. Activation of the oxidase burst is an important component of the integrated cellular
response mediated by Fc receptors. Previous work has demonstrated that, in
interferon-␥–primed U937 cells, the highaffinity receptor for IgG, Fc␥RI, is coupled
to a novel intracellular signaling pathway
that involves the sequential activation of
phospholipase D (PLD), sphingosine kinase, and calcium transients. Here, it is
shown that both known PLD isozymes,
PLD1 and PLD2, were present in these
cells. With the use of antisense oligonucleotides to specifically reduce the expression of either isozyme, PLD1, but not
PLD2, was found to be coupled to Fc␥RI
activation and be required to mediate
receptor activation of sphingosine kinase
and calcium transients. In addition, coupling of Fc␥RI to activation of the nicotinamide adenine dinucleotide phosphate
(reduced form) (NADPH) oxidase burst
was inhibited by pretreating cells with
0.3% butan-1-ol, indicating an absolute
requirement for PLD. Furthermore, use of
antisense oligonucleotides to reduce expression of PLD1 or PLD2 demonstrated
that PLD1 is required to couple Fc␥RI to
the activation of NADPH oxidase and trafficking of internalized immune complexes
for degradation. These studies demonstrate the critical role of PLD1 in the
intracellular signaling cascades initiated
by Fc␥RI and its functional role in coordinating the response to antigen-antibody
complexes. (Blood. 2001;98:3421-3428)
© 2001 by The American Society of Hematology
Introduction
Receptors for the constant region (Fc) of immunoglobulins play a
pivotal role linking the humoral and cellular arms of the immune
system. On leukocytes, aggregation of receptors (Fc␥Rs) for
immunoglobulin G (IgG) leads to a number of cellular responses,
including the internalization of immune complexes, release of
proteases, activation of the respiratory burst, and release of
cytokines. Receptor aggregation can ultimately lead to targeted cell
killing through antibody-directed cellular cytotoxicity.1,2 These Fc
receptors, therefore, play critical roles in host defense mechanisms
against invading pathogens, in autoimmune diseases,3 and in
cancer surveillance.4 We have recently reported that, in cytokineprimed U937 cells, aggregation of the high-affinity receptor for
IgG (Fc␥RI)5 activates, through nonreceptor tyrosine kinases, a
novel signaling pathway that involves the sequential activation of
phospholipase D (PLD) and sphingosine kinase.6 This pathway is
necessary for efficient intracellular trafficking of Fc␥RI-internalized immune complexes to lysosomes for degradation and release
of calcium from intracellular stores.6,7
Phosphatidylcholine-specific PLD (PC-PLD) catalyzes the hydrolysis of the terminal diester bond of phosphatidylcholine to liberate
phosphatidic acid and choline.8 PC-PLD was first identified in plants but
has subsequently been shown to be highly conserved across all species
and present in large amounts in bacteria, yeast, and mammalian cells.9,10
In mammalian cells, activation of PC-PLD has been proposed to control
signal transduction pathways regulating a wide range of physiological
processes, including membrane trafficking and cytoskeletal reorganization,11-17 mitogenesis,18,19 neuronal and cardiac stimulation,20,21
phagocytosis,22 the respiratory burst in neutrophils,23,24 inflammation, and diabetes.25
The immediate products of PLD hydrolysis of phosphatidylcholine
are phosphatidic acid and choline.8 A role for phosphatidic acid as a key
intracellular signaling molecule has been proposed as it has been shown
to directly activate protein kinases,18,19,26,27 protein tyrosine phosphatase,28-30 phospholipase C,31 phosphoinositol-4-kinase,32 sphingosine
kinase,33 and small molecular weight guanosine triphosphatase–
activating proteins.34 Phosphatidic acid has also been shown to promote
the release of calcium from intracellular compartments35,36 and, in
neutrophils, to activate the oxidative burst through nicotinamide adenine
dinucleotide phosphate (reduced form) (NADPH) oxidase.24,27 Phosphatidic acid itself can also act as a precursor for other intracellular signaling
molecules. Thus, phosphatidic acid can be converted into diacyl glycerol
(DAG) by phosphatidic acid–phosphohydrolase10,23 or to the mitogen
lyso–phosphatidic acid (LPA) by phospholipase A2.10,23 DAG is an
established activator of conventional and novel protein kinase C (PKC)
isoforms37,38 and LPA, which, following release from cells, acts on
G-protein–coupled receptors to further stimulate cells or adjacent cells.39
Phosphatidic acid can also be subject to acid hydrolases followed by
lipo-oxygenase, leading to the formation of oxygen radicals and lipid
peroxides that cause tissue damage.40
In mammalian cells, 2 isoforms of PLD (PLD1 and PLD2) have
From the Department of Molecular and Cellular Biology, Pfizer Global
Research and Development, Fresnes, France; the Department of Medicine,
Imperial College School of Medicine, London, United Kingdom; and the
Department of Immunology, the Department of Medicine and Therapeutics,
and the Division of Biochemistry and Molecular Biology, University of Glasgow,
Scotland.
Reprints: Janet M. Allen, Inpharmatica, 60 Charlotte Street, London WIT 2NU,
England, United Kingdom; e-mail: [email protected].
Submitted April 11, 2001; accepted July 23, 2001.
© 2001 by The American Society of Hematology
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
The publication costs of this article were defrayed in part by page charge
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. section 1734.
3421
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
3422
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
MELENDEZ et al
been cloned, sequenced, and characterized.17,41,42 Furthermore, PLD1 is
expressed as 2 splice variants, namely, PLD1a and PLD1b.43 Both
PLD1 and PLD2 use phosphatidylcholine as substrate. In previous
studies, we have shown that coupling of Fc␥RI to PLD activation results
in activation of sphingosine kinase6,7 and calcium transients. However,
in these previous studies, the nature of the PLD isozyme activated by
Fc␥RI was not defined, and the relationship of the activation of PLD to
the various signaling enzyme cascades following Fc␥RI aggregation
was unknown.
Here, we demonstrate that coupling of Fc␥RI to NADPH
oxidase has an absolute requirement on the activation of PLD.
Although both isozymes of PLD (PLD1 and PLD2) are present in
U937 cells, only PLD1, but not PLD2, functionally couples Fc␥RI
to intracellular effectors, such as the activation of sphingosine
kinase and cytosolic calcium transients. PLD1, but not PLD2, is
also required for Fc␥RI-mediated activation of the oxidative burst
and trafficking of immune complexes.
Materials and methods
Immunoprecipitation of PLDs
PLD1 and PLD2 were immunoprecipitated from cell lysates prior to Western blot
analysis of the desired proteins. Rabbit polyclonal antibody (2 ␮g), either
anti-PLD1 or anti-PLD2 (QCB, Hopkinton, MA), were incubated with 50 ␮L
50% protein A-agarose and 450 ␮L buffer for 2 hours on a rocking platform at
4°C in order to form precipitating complexes. Then, the antibody–protein
A–agarose mix was washed to remove unbound antibody. Following this, 500
␮L cell lysate containing 200 ␮g protein was mixed with the precipitating
(antibody–protein A–agarose) complex and placed in a tumbler at 4°C for 4
hours. Following incubation, the precipitating complex was centrifuged and
washed prior to addition of Laemlli buffer for loading onto sodium dodecyl
sulfate–polyacrylamide gel electrophoresis (SDS-PAGE).
Gel electrophoresis and Western blots
Proteins were resolved on 8% polyacrylamide gels (SDS-PAGE) under
denaturing conditions and then transferred to 0.45-␮m nitrocellulose
membranes. After blocking overnight at 4°C with 5% nonfat milk in
Tris-buffered saline and 0.1% Tween 20 and washing, the membranes were
incubated with the relevant antibodies for 4 hours at room temperature. The
membranes were washed extensively in the washing buffer and bands
visualized by means of the appropriate horseradish peroxidase–conjugated
secondary antibody and ECL Western Blotting Detection System (Amersham, Buckinghamshire, United Kingdom).
Cell culture
U937 cells were cultured in RPMI 1640 (Gibco, Rockville, MD) supplemented with 10% fetal calf serum (FCS), 2 mM glutamine, 10 U/mL
penicillin, and 10 ␮g/mL streptomycin at 37°C in 6.8% carbon dioxide in a
water-saturated atmosphere. The cells were treated with interferon (IFN)–␥
(200 ng/mL) (Bender Wien, Vienna, Austria) for 16 hours. Antisense
oligonucleotides were purchased from Oswell DNA Service (Southampton,
United Kingdom); 24-mers were synthesized and capped at either end by
the phosphothiorate linkages (first 2 and last 2 linkages); these 24-mers
corresponded to the reverse complement of the first 8 amino acids for either
PLD1 or PLD2. The sequences of the oligonucleotides were as follows:
5⬘CCGTGGCTCGTTTTTCAGTGACAT3⬘ for PLD1 and 5⬘GAGGCTCTCAGGGGTCGCCGTCAT3⬘ for PLD2. Cells were incubated in 10 ␮M
oligonucleotide for a total of 36 hours (20 hours prior to, and then for the
duration of culture with IFN-␥).
Reverse-transcriptase–polymerase chain reaction
Cells were either primed with IFN-␥ or differentiated to a macrophage phenotype
with dibutyryl cyclic adenosine monophosphate (dbcAMP)6 and messenger
RNA (mRNA)–isolated (Quiagen midi kit for mRNA extraction). Specific
forward and reverse primers were designed for either PLD1 or PLD2: PLD1
forward, GTGGGCTCACCATGAGAAGC; PLD1 reverse, GCAATGTCATGCCAGGGCATC; PLD2 forward, CTGCACTTTACTTACAGGACCCTG; and
PLD2 reverse, CTGCTCATAGATATTGGCGTTGC.
The PLD1 primers were designed against an overlapping region in the
sequence of both PLD1 isoforms to yield a fragment of approximate 640
base pairs (bp) for PLD1a and another fragment of approximate 520 bp for
PLD1b.43 Specific primers designed for PLD2 would yield a 450-bp
fragment. The reaction was carried out as described previously.43
Receptor aggregation
Cells were harvested by centrifugation and then incubated at 4°C for 45
minutes with 1 ␮M human monomeric IgG (Serotec, Oxford, United
Kingdom) to occupy surface Fc␥RI in the presence or absence of inhibitors
or alcohols. Excess unbound ligand was removed by dilution and centrifugation of the cells. Cells were resuspended in ice-cold RPMI 1640/10 mM
Hepes/0.1% bovine serum albumin (BSA) (RHB medium), and surface
immune complexes were formed by incubating with cross-linking antibody
(sheep antihuman IgG; 1:50) in the continued presence of inhibitors or
alcohols. Cells were then warmed to 37°C for the times specified in each
assay as described previously.44,45
Measurement of phospholipase D activity
PLD activity was measured as previously described in Melendez et al,7 by
means of the transphosphatidylation assay. Briefly, U937 cells were labeled
(106 cells/mL) with [3H] palmitic acid (5 ␮Ci/mL [185 kBq/mL]) (Amersham) in the cell culture medium for 16 hours. Following washing, the cells
were incubated at 37°C for 15 minutes in RHB medium containing
butan-1-ol (0.3% final). Following Fc␥RI aggregation, cells were incubated
for a further 30 minutes and then extracted by Bligh-Dyer phase separation.
The accumulated phosphatidylbutanol was assayed as described previously.7
Measurement of rate of trafficking of immune complexes
Trafficking of immune complexes was measured with a protocol similar to
that used in previous studies.44,45 Fc␥RI was aggregated as described above,
but surface immune complexes were formed by using radiolabeled crosslinking antibody ([125I]-rabbit antihuman IgG; 1:50) (R&D Systems,
Abington, United Kingdom). Supernatant trichloroacetic acid (TCA)–
soluble counts were measured to provide the rate of intracellular trafficking.45,46 The results were expressed as a percentage of the total cell surface
counts at time zero.
Oxidase assays
Whole cell superoxide production following Fc␥RI aggregation or N-formyl1-methionyl-1-leucyl-1-phenylalamine (f-MLP) stimulation was measured
in IFN-␥–primed U937 cells, pretreated or not with butan-1-ol, butan-2-ol,
or antisense oligonucleotides for PLD1 or PLD2.
Cells were assayed in RPMI–1% FCS without phenol red placed in a
96-well plate. For each well, 200 000 cells suspended in 80 ␮L were mixed
with 20 ␮L luminol-based substrate (Diogenes, National Diagnostics,
Atlanta, GA) at the same time as the cross-linking antibody, or f-MLP (1
␮M). Luminescence was measured with a luminometer (Wallac 1420
Multilabel counter, Cambridge, United Kingdom).
Cytosolic calcium assays
Cytosolic calcium was measured as described previously except the cuvette
buffer was calcium supplemented (final concentration, 1.5 mM Ca⫹⫹).7
Briefly, cells were loaded with 1 ␮g/mL Fura-2–AM (Molecular Probes,
Leiden, The Netherlands) and 1 ␮M human monomeric IgG (Serotec) in
phosphate-buffered saline (PBS), 1.5 mM Ca⫹⫹, and 1% BSA. After
removal of excess reagents by dilution and centrifugation, the cells were
resuspended in 1.5 mM calcium-supplemented PBS and warmed to 37°C in
the cuvette. Cell surface–bound IgG was aggregated by the addition of goat
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
Fc␥RI IS COUPLED TO THE OXIDASE BURST BY PLD1
3423
anti–human IgG (1:50 dilution) (Sigma, Poole, United Kingdom). Fluorescence was measured at 340 and 380 nm, and the background-corrected
340:380 ratio was calibrated as previously described.6
Sphingosine kinase assays
Activation of sphingosine kinase was measured as described previously.7,33
Briefly, cells were resuspended in ice-cold 0.1 M phosphate buffer (pH 7.4)
containing 20% glycerol, 1 mM mercaptoethanol, 1 mM EDTA, phosphatase inhibitors (20 mM ZnCL2, 1 mM sodium orthovanadate, and 15 mM
sodium fluoride), protease inhibitors (10 ␮g/mL leupeptin, 10 ␮g/mL
aprotinin, and 1 mM phenylmethyl sulfonyl fluoride), and 0.5 mM
4-deoxypyridoxine, disrupted by freeze-thawing and centrifuged at 105 000g
for 90 minutes at 4°C. Supernatants were assayed for sphingosine kinase
activity by incubating with sphingosine (Sigma) and [␥32P]–adenosine
triphosphate (2 ␮Ci, 5 mM [74 kBq]) for 30 minutes at 37°C, and products
were separated by thin-layer chromatography on silica gel G60 (Whatman,
Maidstone, United Kingdom) by means of chloroform/methanol/acetic
acid/water (90:90:15:6) and visualized by autoradiography. The radioactive
spots corresponding to sphingosine phosphate were scraped and counted in
a scintillation counter. The activity of sphingosine kinase following in vitro
activation by phosphatidic acid was measured in cell lysates by addition of
L-␣-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) (Sigma Aldrich, Paris, France) at 10 mol 1% Triton X-100.
Results
Both PLD1 and PLD2 are expressed in U937 cells, but only
PLD1 is coupled to Fc␥RI activation
PLD expression profiles in the human monocytic cell line U937.
The isozymes of PLD expressed in U937 cells were determined by
means of reverse-transcriptase–polymerase chain reaction (RTPCR), Northern analysis, and Western analysis. Relative levels of
expression were compared in untreated cells, cytokine (IFN-␥)–
primed cells, and cells differentiated to a macrophage phenotype by
means of dbcAMP.47
RT-PCR analysis of mRNAs extracted from untreated, IFN-␥–
primed or dbcAMP-differentiated cells revealed that both known
PLD isozymes, PLD1 and PLD2, were present. In addition, both
splice variants of PLD1 (PLD1a and PLD1b) were present.43 The
profile of the RT-PCR products was not altered by treating cells
with IFN-␥ or following differentiation (Figure 1A). At the protein
level, Western blot analysis of immunoprecipitated PLDs revealed
immunoreactive bands corresponding to the predicted molecular
weights for PLD1a, PLD1b, and PLD2. The PLD expression
profile did not alter following priming of cells with IFN-␥ or cell
differentiation by dbcAMP (Figure 1B).
Fc␥RI aggregation stimulates PLD1. As both isozymes for
PLD are expressed in U937 cells, experiments were performed to
examine their respective roles, in particular, their activities following Fc␥RI aggregation. For this purpose, specific antisense oligonucleotides were designed against each of the PLD isozymes to
specifically knock down the expression of each enzyme (ie,
antisense to PLD1 and antisense to PLD2). We have previously
shown that U937 cells are sensitive to antisense manipulation.6,48
IFN-␥–primed cells were treated with 1 of the 2 antisense
oligonucleotides, and PLD activity was assayed in unstimulated
cells to measure basal levels of activity or after stimulation with
either Fc␥RI activation by immune complexes or with phorbolmyristate acetate (PMA) treatment (PMA was used as control). The
specificity of the antisense oligonucleotides on relative PLD
isozyme expression was checked by Western analysis (Figure 2A).
Thus, in cells treated with antisense to PLD1, there was a reduction
Figure 1. PLD expression profiles in U937 cells. (A) RT-PCR was performed with
mRNA extracted from untreated, IFN-␥–primed and dbcAMP-differentiated U937
cells. Specific primers for PLD1 (which yield 2 fragments corresponding to PLD1a,
640bp, and PLD1b, 520bp) and primers specific for PLD2 amplifying a 450-bp
fragment, were used. The results shown are typical from 3 separate experiments.
(B) Western blot analysis of immunoprecipitates of PLD1 or PLD2, from cell lysates
from untreated, IFN-␥–primed and dbcAMP-differentiated U937 cells, were resolved
by SDS/PAGE 8% polyacrylamide gels. Proteins were transferred to nitrocellulose
and probed with anti-PLD1 or anti-PLD2 antibodies. The results shown are typical
from 3 separate experiments. Mw indicates molecular weight.
in PLD1 immunoreactivity whereas PLD2 immunoreactivity was
unaffected. Conversely, in cells treated with antisense to PLD2,
there was a reduction in PLD2 immunoreactivity whereas PLD1
immunoreactivity remained unchanged. Each antisense oligonucleotide, therefore, acted as an internal control for the other.
Treatment of cells with the antisense oligonucleotide to PLD1
resulted in no change in basal activity. However, following
aggregation of Fc␥RI, the increase in PLD activity was significantly reduced compared with the control cells (P ⬍ .01) (Figure
2B). The reduction in the increase after Fc␥RI activation was
77% ⫾ 8% in cells treated with antisense PLD1 compared with
control cells and was proportional to the observed reduction in
protein expression by Western analysis. In contrast, treatment of
cells with the antisense oligonucleotide to PLD2 significantly
reduced basal PLD activity (P ⬍ .01). Fc␥RI-mediated activation
of PLD was marginally reduced in cells treated with the antisense
to PLD2, but this reduction was entirely accounted for by the
reduction in basal levels; the increment over the basal level was
identical in control (untreated) cells and those pretreated with
PLD2 antisense oligonucleotide (Figure 2B). In contrast to PLD
activation by Fc␥RI, PLD activity stimulated by PMA was
significantly reduced in cells pretreated with either of the 2
antisense oligonucleotides, indicating that PMA is able to stimulate
both forms of PLD (Figure 2C). Thus, PMA-stimulated PLD
activity was reduced by 50% ⫾ 5% in cells pretreated with PLD1
antisense and by 33% ⫾ 5% in cells pretreated with PLD2
antisense. A combination of treatment with both antisense oligonucleotides (PLD1 and PLD2) proved toxic to the cells.
These data demonstrate that PLD2 contributes to the basal,
unstimulated PLD activity in these cells, whereas PLD1, but not
PLD2, is coupled to Fc␥RI activation.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
3424
MELENDEZ et al
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
from intracellular stores and subsequent cytosolic calcium transients.7 Here, the specific dependence for this response on PLD1
and not PLD2 is shown. Reduction in expression of PLD1 by
pretreatment of cells with antisense PLD1 oligonucleotide resulted
in an attenuation of peak cytosolic calcium spike observed after
aggregation of Fc␥RI (Figure 3A). Reducing expression of PLD2
had no effect on the calcium transients compared with controls.
Previous studies have shown that sphingosine kinase is activated by Fc␥RI aggregation in cytokine-primed U937 cells and that
PLD activation is necessary for coupling the receptor to this
kinase.7 Pretreating cells with the antisense oligonucleotide to
PLD1 to knock down isozyme expression significantly reduced the
peak activation of sphingosine kinase following aggregation of
Fc␥RI in IFN-␥–primed cells by 70% ⫾ 6% (P ⬍ .01). The
reduction in the peak activation was proportional to the loss of PLD
Figure 2. Use of antisense oligonucleotides to reduce specific expression of
either PLD1 or PLD2 demonstrates that only PLD1 is coupled to Fc␥RI
aggregation. (A) Western blot analysis of immunoprecipitates of either PLD1 or
PLD2 to assess expression of either isozyme in IFN-␥–primed U937 cells following
treatment for 36 hours with antisense oligonucleotides (10 ␮M) specific for either
PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2), and control cells (control). The results shown
are typical from 3 separate experiments. (B) PLD activity following Fc␥RI aggregation
in IFN-␥–primed U937 cells pretreated with 10 ␮M antisense oligonucleotides for
either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2). 1. Basal level (basal control); 2. Fc␥RI
aggregation (XL control); 3. basal level in cells pretreated with antisense PLD1 (basal
a.s.PLD1); 4. Fc␥RI aggregation in cells pretreated with antisense PLD1 (XL
a.s.PLD1); 5. basal level in cells pretreated with antisense PLD2 (basal a.s.PLD2);
6. Fc␥RI aggregation in cells pretreated with antisense PLD2 (XL a.s.PLD2). Results
are the mean ⫾ SD for triplicate measurements and are representative of the results
from 3 separate experiments. PtdBut indicates phosphatidylbutanol. (C) PLD activity
following PMA stimulation (1 ␮M) in IFN-␥–primed U937 cells pretreated with
antisense oligonucleotides (10 ␮M) for either PLD1 (a.s.PLD1) or PLD2 (a.s.PLD2).
1. Basal level (basal control); 2. PMA stimulation (PMA control); 3. basal level in cells
pretreated with antisense PLD1 (basal a.s.PLD1); 4. PMA stimulation in cells
pretreated with antisense PLD1 (PMA a.s.PLD1); 5. basal level in cells pretreated
with antisense PLD2 (basal a.s.PLD2); 6. PMA stimulation in cells pretreated with
antisense PLD2 (PMA a.s.PLD2). Results are the mean ⫾ SD for triplicate
measurements and are representative of the results from at least 3 separate
experiments. Tot. indicates total.
PLD1 but not PLD2 is required to couple Fc␥RI to intracellular
signaling cascades
As the coupling of Fc␥RI to sphingosine kinase6 and cytosolic
calcium transients6,7 requires PLD activation, the nature of the
isozyme involved in this coupling was investigated by means of
antisense oligonucleotides to specifically downregulate either PLD1
or PLD2.
Previously, we have shown that aggregation of Fc␥RI in
cytokine-primed cells results in PLD-dependent release of calcium
Figure 3. Coupling of Fc␥RI to downstream intracellular signaling pathways
requires PLD1 and not PLD2. (A) Intracellular cytosolic calcium changes following
aggregation of Fc␥RI. Responses were compared in control cells and cells pretreated
with antisense oligonucleotides (10 ␮M) to either PLD1 or PLD2. Traces shown are
as follows: left, XL Fc␥RI control cells ⫽ Fc␥RI aggregation in IFN-␥–primed control
cells; upper right panel, Fc␥RI aggregation in IFN-␥–primed cells pretreated with
antisense to PLD1 (XL Fc␥RI a.s.PLD1); lower right panel, Fc␥RI aggregation in
IFN-␥–primed cells pretreated with antisense to PLD2 (XL Fc␥RI a.s.PLD2). The
arrow marks the addition of the goat antihuman IgG antibody to create cell surface
immune complexes. Traces are typical from fura-2–loaded cells from 3 separate
experiments. (B) Fc␥RI coupling to sphingosine kinase. Following aggregation of
Fc␥RI in IFN-␥–primed U937 cells, cells were harvested at given time points to
measure sphingosine kinase activity. Sphingosine kinase activity was assayed from
basal control cells (basal control); following Fc␥RI aggregation in control cells (XL
control) and in cells pretreated with antisense oligonucleotides (10 ␮M) for either
PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Lysates from these cells were treated
with phosphatidic acid (L-␣-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate) in
vitro to ensure sphingosine kinase activity (P.A.a.s.PLD1 and P.A.a.s.PLD2).33
Results are the mean ⫾ SD for triplicate measurements and are representative of the
results from at least 3 separate experiments.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
Figure 4. NADPH oxidase activity stimulated by Fc␥RI aggregation. NADPH
oxidase activity stimulated by Fc␥RI aggregation has an absolute dependence on
PLD. (A) Fc␥RI-mediated activation of the oxidase burst in control cells (XL control) or
cells pretreated for 20 minutes with either 0.3% butan-1-ol (XL but-1-ol) or 0.3%
butan-2-ol (XL but-2-ol). The results shown are typical from 3 separate experiments.
RLU ⫽ relative luminescence units. (B) Activation of oxidase by 1 ␮M f-MLP
stimulation (fMLP control) in control cells and in cells pretreated for 20 minutes with
either 0.3% butan-1-ol (fMLP but-1-ol) or 0.3% butan-2-ol (fMLP but-2-ol). The results
shown are typical of 3 separate experiments. RLU ⫽ relative luminescence units.
Fc␥RI IS COUPLED TO THE OXIDASE BURST BY PLD1
3425
we show an absolute requirement for PLD in the coupling of Fc␥RI
aggregation to the activation of NADPH oxidase in IFN-␥–primed
U937 cells. Thus, formation of surface immune complexes and
warming to 37°C result in a transient activation of NADPH oxidase
as measured by the oxidative burst (Figure 4A). Pretreatment of
cells with 0.3% butan-1-ol completely abolished this response
whereas pretreatment with 0.3% butan-2-ol had no effect and cells
demonstrated a normal response (Figure 4A). Butan-1-ol but not
butan-2-ol can act as an acceptor for the phosphatidyl moiety,
thereby generating phosphatidylbutanol instead of phosphatidic
acid.7 As butan-2-ol cannot act as an acceptor, it serves as a control
for nonspecific effects of the alcohol. This absolute dependence on
PLD activation was not observed for other receptors known to be
coupled to NADPH oxidase in these cells. Thus, f-MLP also
initiates an oxidase burst in these cells. However, in contrast to
Fc␥RI, pretreatment of cells with 0.3% butan-1-ol decreased the
oxidase burst activated by f-MLP by only about 50% (Figure 4B).
Again, 0.3% butan-2-ol was without effect on this response.
PLD1 and not PLD2 couples Fc␥RI to the activation of
NADPH oxidase. A role for PLD1 but not PLD2 in mediating the
activation of NADPH oxidase by Fc␥RI was demonstrated.
Treatment of IFN-␥–primed U937 cells with the antisense oligonucleotide to PLD1 to specifically knock down expression of this
isozyme resulted in an attenuation of the activation of NADPH
oxidase by Fc␥RI aggregation (peak activity, approximately 30%
of control) (Figure 5A). Similar treatment of cells with the
antisense oligonucleotide to PLD2 did not alter Fc␥RI activation of
enzyme expressed in these cells as assessed by Western analysis.
Reduction in expression of PLD2 had no effect on the ability of
Fc␥RI to couple to sphingosine kinase activation.
To ensure that the loss of sphingosine kinase activity after
Fc␥RI activation in cells treated with the antisense oligonucleotide
to PLD1 was a feature of the loss of coupling of the receptor and
not some direct effect of the PLD1 antisense oligonucleotide on
sphingosine kinase, enzyme activity was measured in lysates
following activation of sphingosine kinase with exogenous phosphatidic acid (L-␣-phosphatidic acid (1,2-diacyl-sn-glycero-3-phosphate). Addition of phosphatidic acid to the cell lysates from
control cells or cells treated with either antisense PLD1 or antisense
PLD2 resulted in an identical increase in sphingosine kinase
activity (Figure 3B). These data indicate that the reduction in
sphingosine kinase activity following Fc␥RI activation resulting
from PLD1 antisense reflects blockage of this pathway and
uncoupling of Fc␥RI to sphingosine kinase activation (Figure 3B).
Thus, in keeping with the observed coupling of Fc␥RI to PLD1
but not PLD2, receptor-mediated activation of sphingosine kinase
and cytosolic calcium transients were found to be attenuated in
cells following the specific downregulation of PLD1.
PLD1 but not PLD2 functionally couples Fc␥RI to
intracellular effectors
Fc␥RI is functionally coupled to NADPH oxidase through PLD
activation. Fc receptors are coupled to the oxidative burst, and
activation of NADPH oxidase is an important functional consequence of aggregation of these receptors by opsonized particles or
immune complexes to assist in destruction of pathogens.49,50 Here,
Figure 5. Fc␥RI-mediated activation of NADPH oxidase. Fc␥RI-mediated activation of NADPH oxidase is dependent on PLD1 and not PLD2. (A) Superoxide
production in response to Fc␥RI in control cells (XL control) compared with cells
pretreated with antisense oligonucleotide (10 ␮M) to either PLD1 (XL a.s.PLD1) or
PLD2 (a.s.PLD2). The trace results shown are typical from 3 separate experiments.
(B) Superoxide production in response to Fc␥RIIa in control cells (XL Fc␥RIIa control)
compared with cells pretreated with antisense (10 ␮M) to PLD1 (Fc␥RIIa a.s.PLD1)
or PLD2 (Fc␥RIIa a.s.PL2). Fc␥RIIa was specifically aggregated by means of an
anti-Fc␥RII–specific monoclonal antibody.7 The trace results shown are typical from 3
separate experiments.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
3426
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
MELENDEZ et al
NADPH oxidase compared with control cells despite decreasing PLD2
expression (Figure 5A). Treatment of cells with either antisense
oligonucleotide (PLD1 or PLD2) did not alter the response of NADPH
oxidase to activation by the low-affinity IgG receptor Fc␥RIIa, which
has previously been shown to be coupled to phospholipase C and is
independent of PLD activation (Figure 5B).6
PLD1 is necessary for trafficking of immune complexes for
degradation. Formation of surface immune complexes on myeloid
cells results in their rapid internalization44 and trafficking to
lysosomes for degradation.45 We have previously shown that
endocytosis (the initial internalization of immune complexes to
early endosomes) mediated by Fc␥RI is independent of PLD
activation but that subsequent intracellular trafficking of immune
complexes is significantly delayed in cells treated with 0.3%
butan-1-ol.7 Here, using antisense oligonucleotides to downregulate either PLD1 or PLD2, we demonstrate that Fc␥RI is functionally coupled to PLD1 and not PLD2 to mediate the intracellular
trafficking of immune complexes.
Trafficking of immune complexes to lysosomes for degradation
can be readily monitored by means of radiolabeled immune
complexes and the appearance of TCA-soluble counts in the cells
over time.46 Following Fc␥RI aggregation in cytokine-primed
U937 cells, almost 50% of the initial radiolabel internalized as
immune complexes appears as TCA-soluble counts in the supernatant of these cells after 120 minutes’ incubation at 37°C.7,47
Consistent with previous findings that PLD activation is not
necessary for the initial endocytosis of immune complexes mediated by Fc␥RI,44 downregulation of either PLD1 or PLD2 by
pretreating cells with either antisense oligonucleotide did not alter
the rate of initial endocytosis of radiolabeled immune complexes
(data not shown). However, pretreatment of cells with the antisense
PLD1 oligonucleotide significantly changed the rate of appearance
of TCA-soluble counts in the supernatant of the cells whereas
pretreatment with antisense PLD2 did not. In control and antisense
PLD2-treated cells, 50% ⫾ 2% and 49 ⫾ 2% of the initial internalized counts appeared in the supernatant in the TCA-soluble fraction
after 120 minutes’ incubation whereas for cells treated with
antisense PLD1, only 24% ⫾ 1% of counts appeared in this
fraction (Figure 6). These data demonstrate that PLD1 but not
Figure 6. Effect of PLD1 on coupling of Fc␥RI to trafficking of immune
complexes. PLD1 functionally couples Fc␥RI to trafficking of immune complexes.
Trafficking of radiolabeled immune complexes is monitored by the appearance of
TCA-soluble counts in cell supernatants. Following aggregation of Fc␥RI, radiolabeled surface–bound counts are rapidly internalized. During 120 minutes incubation,
appearance of radiolabel in the supernatant as TCA-soluble counts (XL control) is
compared between control cells and cells pretreated with antisense oligonucleotides
(10 ␮M) to either PLD1 (XL a.s.PLD1) or PLD2 (XL a.s.PLD2). Results shown for
each time point are the counts in the incubation supernatant soluble in TCA
expressed as a percentage of the total counts bound at time zero. Results are the
mean ⫾ SD for triplicate measurements and are representative of the results from at
least 3 separate experiments.
PLD2 activation is required to mediate the trafficking of Fc␥RIinternalized immune complexes in U937 cells.
Discussion
In this study, we have shown that Fc␥RI is functionally coupled to
PLD1 but not PLD2 in IFN-␥–primed U937 cells even though both
enzymes are expressed in these cells. Further, we show that PLD1
but not PLD2 is required for Fc␥RI-mediated activation of the
NADPH oxidase burst and intracellular trafficking of immune
complexes for degradation.
Two forms of PLD have been characterized in mammalian cells, and
PLD1 exists as a number of splice variants although the significance of
these is not known. Here we show that both isozymes are expressed in
U937 cells and that priming with IFN-␥ or differentiation with dbcAMP
did not significantly alter the expression levels of the 2 enzymes.
Specific roles for the 2 enzymes, PLD1 and PLD2, are unclear. Cell lines
appear to differ in their expression of the different isozymes.51 Thus, a
number of cell lines have been reported to express both isozymes
although some cells appear to express one isozyme or the other
exclusively. Thus, Jurkat cells only express PLD2 whereas 2 human
monoblastic cell types, THP1 and HL60, express predominantly PLD1
in resting state; this contrasts with our report here for U937, cells which
are also monoblastic in nature. The expression of PLD1 and PLD2 in
U937 cells appeared to be relatively stable. Neither mRNA nor protein
levels were altered by priming with IFN-␥ or differentiation with
dbcAMP. This contrasts with observations made for HL60 cells, where
differentiation to a neutrophil phenotype with dbcAMP over 3 days
resulted in the upregulation of PLD1 and a 20-fold induction of PLD2.52
In these cells, despite the large increase in PLD2 expression, the
coupling of f-MLP to the oxidase burst correlated with PLD1 not PLD2
in these differentiated cells.53
In vitro studies have shown that the activity of these 2 enzymes
is regulated differently. Both PLD1 and PLD2 have an absolute
requirement for phosphatidylinositol(4,5)P2 (PIP2) for activation.41,42 Activity of PLD1 has been shown to be stimulated in vitro
by 3 additional factors; adenosine diphosphate–ribosylation factor
(ARF), Rho, and PKC54 through protein-protein interactions. In
contrast, PLD2 is insensitive to these 3 factors and, in the absence
of other factors apart from PIP2, PLD2 is very active.17 Consistent
with these in vitro observations, our data here indicate that, within
the intact U937 cell, PLD2 contributes to the basal activity of PLD
whereas PLD1 is coupled to cell activation through Fc␥RI aggregation by immune complexes. Recent data studying PLD1 activation
in intact cells suggest that mechanisms similar to those observed in
vitro may occur within cells55,56 although there is a growing body
of evidence that ARF6, not ARF1, is responsible for coupling
receptors to PLD activation.20,57-59 Our recent studies have demonstrated a role for ARF6 and PKC␣ in coupling Fc␥RI to the
activation of PLD1 through protein-protein interactions.59 Although Fc␥RI is coupled to signaling cascades through the
activation of tyrosine kinases, tyrosine phosphorylation of PLD1 is
not thought to play a role in regulating the enzyme.9,10
Consistent with the finding that Fc␥RI specifically activates
PLD1 and not PLD2, antisense knock-down experiments demonstrated a specific role for PLD1 and not PLD2 in coupling this
receptor to sphingosine kinase activation and calcium transients.
The immediate product of PLD is phosphatidic acid, and this has
been shown in vitro to directly activate sphingosine kinase.33
Furthermore, here we demonstrate that PLD1 but not PLD2 is
required for the functional coupling of Fc␥RI to cellular effectors,
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
such as NADPH oxidase activation and intracellular vesicular
trafficking of immune complexes from endosomes to lysosomes for
degradation. High local production of phosphatidic acid has been
proposed to alter membrane properties and facilitate membrane
fusion and budding events,13,60 which are important in vesicular
trafficking within the cell. Recent work has demonstrated that
phagocytosis, which similarly depends on membrane fusion events
and vesicular trafficking, is dependent on PLD activation.24
The regulation of assembly of the subunits of NADPH oxidase
to form active enzyme and the subsequent oxidase burst is
complex. Here, we demonstrate a surprising absolute requirement
on PLD activity for the coupling of Fc␥RI to NADPH oxidase
activation. Thus, treatment of cells with butan-1-ol completely
abolished the oxidase burst in response to Fc␥RI aggregation by
immune complexes. By contrast, the oxidase burst in response to
f-MLP was reduced by only about 50%. Receptor-coupled activation of oxidase assembly is regulated through the phosphorylation
of the p47phox component, and PKCs are widely recognized as
playing a major role in this phosphorylation event.61 Previous work
has shown that, in these IFN-␥–primed U937 cells, the PKC
isozymes ␦, ⑀, and ␨ are activated by Fc␥RI62 and, surprisingly, all
PKC activity lies downstream of PLD activation.59 Thus, PLD may
couple Fc␥RI to NADPH oxidase through the activation of these
Fc␥RI IS COUPLED TO THE OXIDASE BURST BY PLD1
3427
PKC isozymes. However, there is also growing evidence that
phosphatidic acid can itself activate NADPH oxidase through both
kinase-dependent and kinase-independent mechanisms. Thus, data
have implied that a phosphatidic acid–dependent kinase is able to
phosphorylate p47phox and p22phox to regulate NADPH oxidase
assembly.63,64 In addition, recent data using a cell-free system
revealed that phosphatidic acid and diacyl glycerol were able to
activate NADPH oxidase in a kinase-independent manner.65
Our findings that PLD1-mediated generation of phosphatidic
acid drives these monocyte biological responses demonstrates the
pivotal role of PLD1 in the intracellular signaling cascades initiated
by Fc␥RI and in the functional coupling of this receptor to provide
a coordinated response that can ultimately lead to targeted cell
killing through antibody-directed cellular cytotoxicity, an important host defense mechanism to combat invading pathogens and
important in cancer surveillance.
Acknowledgments
We thank Drs Andrew Morris and Michael Frohman, Department
of Pharmacology, State University of New York, for helpful advice
in discussions of material in this manuscript.
References
1. Graziano RF, Fanger MW. Fc␥RI and Fc␥RII on
monocytes and granulocytes are cytotoxic trigger
molecules for tumor cells. J Immunol. 1987;139:
3536-3541.
13. Siddhanta A, Shields D. Secretory vesicle budding from the trans-Golgi network is mediated by
phosphatidic acid levels. J Biol Chem. 1998;273:
17995-17998.
2. Fanger MW, Shen L, Graziano RF, Guyre PM.
Cytotoxicity mediated by human Fc receptors for
IgG. Immunol Today. 1989;10:92-99.
3. Hulett MD, Hogarth PM. Molecular basis of Fc
receptor function. Adv Immunol. 1994;57:1-127.
14. Brown FD, Thomson N, Saqib KM, et al. Phospholipase D1 localises to secretory granules and
lysosomes and is plasma-membrane translocated on cellular stimulation. Curr Biol. 1998;8:
835-838.
4. Ely P, Wallace PK, Givan AL, Guyre PM, Fanger
MW. Bispecific-armed, interferon gamma-primed
macrophage-mediated phagocytosis of malignant
non-Hodgkin’s lymphoma. Blood. 1996;86:38133821.
15. Arneson LS, Kunz J, Anderson RA, Traub LM.
Coupled inositide phosphorylation and phospholipase D activation initiates clathrin-coat assembly on lysosomes. J Biol Chem. 1999;274:1779417805.
5. Allen JM, Seed B. Isolation and expression of
functional high-affinity Fc receptor complementary DNAs. Science. 1989;243:378-381.
16. Cross MJ, Roberts S, Ridley AJ, et al. Stimulation
of actin stress fibre formation mediated by activation of phospholipase D. Curr Biol. 1996;6:588597.
27. Waite KA, Wallin R, Qualliotine-Mann D, McPhail
LC. Phosphatidic acid-mediated phosphorylation
of the NADPH oxidase component p47-phox.
J Biol Chem. 1997;272:15569-15578.
17. Colley WT, Sung TC, Roll R, et al. Phospholipase
D2, a PLD1-related isoform with novel regulatory
properties and discrete subcellular localization
that provokes cytoskeletal reorganization. Curr
Biol. 1997;7:191-201.
28. Zhao Z, Shen SH, Fischer EH. Stimulation by
phospholipids of a protein-tyrosine-phosphatase
containing two src homology 2 domains. Proc
Natl Acad Sci U S A. 1993;90:4251-4255.
6. Melendez A, Floto RA, Gillooly DJ, Harnett MM,
Allen JM. Fc␥RI coupling to phospholipase D initiates sphingosine kinase-mediated calcium mobilization and vesicular trafficking. J Biol Chem.
1998;273:9393-9402.
7. Melendez A, Floto RA, Cameron AJ, Gillooly DJ,
Harnett MM, Allen JM. A molecular switch
changes the signalling pathway used by the
Fc␥RI antibody receptor to mobilise calcium. Curr
Biol. 1998;8:210-221.
8. Exton JH. Phosphatidylcholine breakdown and
signal transduction. Biochim Biophys Acta. 1994;
1212:26-42.
9. Morris AJ, Engebrecht J, Frohman MA. Structure
and regulation of phospholipase D. Trends Pharm
Sci. 1996;17:182-185.
10. Exton JH. Phospholipase D: enzymology, mechanisms of regulation, and function. Physiol Rev.
1997;77:303-320.
11. Ktistakis NT, Brown HA, Waters MG, Sternweis
PC, Roth MG. Evidence that phospholipase D
mediates ADP ribosilation factor-dependent formation of Golgi coated vesicles. J Cell Biol. 1996;
134:295-306.
12. Morgan CP, Sengelov H, Whatmore J, Borregaard N, Cockcroft S. ADP-ribosylation-factorregulated phospholipase D activity localizes to
secretory vesicles and mobilizes to the plasma
membrane following N-formylmethionyl-leucylphenylalanine stimulation of human neutrophils.
Biochem J. 1997;325:581-585.
18. Ghosh S, Strum JC, Sciorra VA, Daniel L, Bell
RM. Raf-1 kinase possesses distinct binding domains for phosphatidylserine and phosphatidic
acid: phosphatidic acid regulates the translocation of Raf-1 in 12-O-tetradecanoylphorbol-13acetate-stimulated Madin-Darby canine kidney
cells. J Biol Chem. 1996;271:8472-8480.
19. Rizzo MA, Shome K, Vasudevan C, et al. Phospholipase D and its product, phosphatidic acid,
mediate agonist-dependent raf-1 translocation to
the plasma membrane and the activation of the
mitogen-activated protein kinase pathway. J Biol
Chem. 1999;174:1131-1139.
20. Caumont A-S, Galas M-C, Vitale N, Aunis D,
Bader M-F. Regulated exocytosis in chromaffin
cells: translocation of ARF6 stimulates a plasma
membrane-associated phospholipase D. J Biol
Chem. 1998;273:1373-1379.
21. Dhalla NS, Xu Y-J, Sheu S-S, Tappia PS, Panagia V. Phosphatidic acid: a potential signal transducer for cardiac hypertrophy. J Mol Cell Cardiol.
1997;29:2865-2871.
22. Kusner DJ, Hall CF, Jackson S. Fc␥ receptor-mediated activation of phospholipase D regulates
macrophage phagocytosis of IgG-opsonized particles. J Immunol. 1999;162:2266-2274.
23. English D, Cui Y, Sidiqui RA. Messenger functions of phosphatidic acid. Chem Phys Lipids.
1996;80:117-132.
24. Olson SC, Lambeth JD. Biochemistry and cell
biology of phospholipase D in human neutrophils.
Chem Phys Lipids. 1996;80:3-19.
25. Ortmeyer Y, Mohsenin V. Inhibition of phospholipase D and superoxide generation by glucose in
diabetic neutrophils. Life Sci. 1996;59:255-262.
26. Bocckine SB, Wilson PB, Exton JH. Phosphatidate-dependent protein phosphorylation. Proc
Natl Acad Sci U S A. 1991;88:6210-6213.
29. Cui Y, English K. Phosphatidic acid-mediated
regulation of neutrophil plasma membrane CD45phosphotyrosine phosphatase. Cell Signal. 1997;
9:257-263.
30. Kishikawa K, Chalfant CE, Perry DK, Bielawska
A, Hannun YA. Phosphatidic acid is a potent and
selective inhibitor of protein phosphatase 1 and
an inhibitor of ceramide-mediated responses.
J Biol Chem. 1999;274:21335-21341.
31. Jackowski S, Rock CO. Stimulation of phosphatidylinositol-4,5-bisphosphate phospholipase C
activity by phosphatidic acid. Arch Biochem Biophys. 1989;268:516-524.
32. Moritz A, Graan PND, Gispen WH, Wirtz KW.
Phosphatidic acid is a specific activator of phosphatidylinositol-4-phosphate kinase. J Biol Chem.
1992;267:7207-7210.
33. Olivera A, Rosenthal J, Spiegel S. Effect of acidic
phospholipids on sphingosine kinase. J Cell Biochem. 1996;60:529-537.
34. Tsai MH, Yu CL, Wei FS, Stacey DW. The effect
of GTPase activating protein upon ras is inhibited
by mitogenically responsive lipids. Science. 1989;
243:522-526.
35. Limas CJ. Phosphatidate releases calcium from
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
3428
MELENDEZ et al
cardiac sarcoplasmic reticulum. Biochem Biophys
Res Commun. 1980;95:541-546.
36. Xu YJ, Panagia V, Shao Q, Wang X, Dhalla NS.
Phosphatidic acid increases intracellular free calcium and cardiac contractile force. Am J Physiol.
1996;271:H651–H659.
37. Nishizuka Y. The molecular heterogeneity of protein kinase C. Science. 1988;334:661-663.
38. Hug H, Sarre TF. Protein kinase C isoenzymes:
divergence in signal transduction? Biochem J.
1993;291:329-334.
39. Guo Z, Liliom K, Fischer DJ, et al. Molecular cloning of a high-affinity receptor for the growth factor-like lipid mediator lysophosphatidic acid from
Xenopus oocytes. Proc Natl Acad Sci U S A.
1996;93:14367-14372.
40. Ryu SB, Wang X. Activation of phospholipase D
and the possible mechanism of activation in
wound-induced lipid hydrolysis in castor bean
leaves. Biochim Biophys Acta. 1996;1303:243250.
41. Hammond SM, Altshuller YM, Sung T-C, et al.
Human ADP-ribosylation factor-activated phosphatidylcholine-specific phospholipase D defines
a new and highly conserved gene family. J Biol
Chem. 1995;270:29640-29643.
42. Lopez I, Arnold RS, Lambeth JD. Cloning and
initial characterization of a human phospholipase
D2 (hPLD2). J Biol Chem. 1998;273:1284612852.
43. Hammond SM, Jenco JM, Nakashima S, et al.
Characterization of two alternatively spliced
forms of phospholipase D1. J Biol Chem. 1997;
272:3860-3868.
44. Harrison PT, Davis W, Norman JC, Hockaday A,
Allen JM. Binding of monomeric IgG triggers
Fc␥RI-mediated endocytosis. J Biol Chem. 1994;
269:24396-24400.
45. Norman JC, Harrison PT, Davis W, Floto RA,
Allen JM. Lysosomal routing of Fc␥RI from early
endosomes requires recruitment of tyrosine kinases. Immunology. 1998;94:48-55.
46. Miettinen HM, Rose JK, Mellman I. Fc receptor
isoforms exhibit distinct abilities for coated pit lo-
BLOOD, 1 DECEMBER 2001 䡠 VOLUME 98, NUMBER 12
calization as a result of cytoplasmic domain heterogeneity. Cell. 1989;58:317-327.
47. Sheth B, Dransfield I, Partridge LJ, Barker MD,
Burton DR. Dibutyryl cyclic AMP stimulation of a
monocytic cell line, U937: a model for monocyte
chemotaxis and Fc receptor-related functions.
Immunology. 1988;63:483-490.
48. Melendez AJ, Gillooly DJ, Harnett MM, Allen JM.
Aggregation of the human high affinity immunoglobulin G receptor (Fc␥RI) activates both tyrosine kinase and G protein-coupled phosphoinositide 3-kinase isoforms. Proc Natl Acad Sci
U S A. 1998;95:2169-2174.
49. Pfefferkorn LC, Fanger MW. Transient activation
of the NADPH oxidase through Fc␥RI: oxidase
deactivation precedes internalization of crosslinked receptors. J Immunol. 1989;143:26402649.
50. Pound JD, Lund J, Jefferis R. Human Fc␥RI triggering of the mononuclear phagocyte respiratory
burst. Mol Immunol. 1993;30:469-478.
51. Gibbs TC, Meier KE. Expression and regulation
of phospholipase D isoforms in mammalian cell
lines. J Cell Physiol. 2000;182:77-87.
52. Nakashima S, Ohguchi K, Frohman MA, Nozawa
Y. Increased mRNA expression of phospholipase
D (PLD) isozymes during granulocytic differentiation of HL60 cells. Biochim Biophys Acta. 1998;
1389:173-177
53. Meier KE, Gibbs TC, Knoepp SM, Ella KM. Expression of phospholipase D isoforms in mammalian cells. Biochim Biophys Acta. 1999;1439:199213.
54. Sung T-C, Zhang Y, Morris AJ, Frohman MA.
Structural analysis of human phospholipase D1.
J Biol Chem. 1999;274:3659-3666.
55. Zhang Y, Altshuller YM, Hammond SM, Morris AJ,
Frohman MA. Loss of receptor regulation by a
phospholipase D1 mutant inresponsive to protein
kinase C. EMBO J. 1999;18:6339-6348.
56. Meacci E, Vasta V, Moorman JP, et al. Effect of
Rho and ADP-ribosylation factor GTPases on
phospholipase D activity in intact human adenocarcinoma A549 cells. J Biol Chem. 1999;274:
18605-18612.
57. Le Stunff H, Dokhac L, Bourgoin S, Bader MF,
Harbon S. Phospholipase D in rat myometrium:
occurrence of a membrane-bound ARF6 (ADPribosylation factor 6)-regulated activity controlled
by betagamma subunits of heterotrimeric G-proteins. Biochem J. 2000;352:491-499.
58. Dana RR, Eigesti C, Holmes KL, Leto TL. A regulatory role for ADP-ribosylation factor 6 (ARF6) in
activation of the phagocyte NADPH oxidase.
J Biol Chem. 2000;275:32566-32571.
59. Melendez AJ, Harnett MM, Allen JM. Crosstalk
between ARF6 and protein kinase C alpha in
Fc␥RI-mediated activation of phospholipase D1.
Curr Biol. 2001;11:869-874.
60. Rudge SA, Morris AJ, Engebrecht J. Relocalization of phospholipase D activity mediates membrane formation during meiosis. J Cell Biol. 1998;
140:81-90.
61. El Benna J, Faust RP, Johnson JL, Babior BM.
Phosphorylation of the respiratory burst oxidase
subunit p47phos as determined by two-dimensional phosphopeptide mapping: phosphorylation
by protein kinase C, protein kinase A, and a mitogen activated protein kinase. J Biol Chem. 1996;
271:6374-6378.
62. Melendez AJ, Harnett MM, Allen JM. Differentiation-dependent switch in protein kinase C isoenzyme activation by Fc␥RI, the human high-affinity
receptor for immunoglobulin G. Immunology.
1999;96:457-464.
63. Waite KA, Wallin R, Qualliotine-Mann D, McPhail
LC. Phosphatidic acid-mediated phosphorylation
of the NADPH oxidase component p47-phox: evidence that phosphatidic acid may activate a
novel protein kinase. J Biol Chem. 1997;272:
15569-15578.
64. Regier DS, Waite KA, Wallin R, McPhail LC. A
phosphatidic-acid protein kinase and conventional protein kinase C isoforms phosphorylate
p22phox, an NADPH oxidase component. J Biol
Chem. 1999;274:36601-36608.
65. Palicz A, Foubert TR, Jesaitis AJ, Marodi L,
McPhail LC. Phosphatidic acid and diacylglycerol
directly activate NADPH oxidase by interacting
with enzyme components. J Biol Chem. 2001;
276:3090-3097.
From www.bloodjournal.org by guest on August 1, 2017. For personal use only.
2001 98: 3421-3428
doi:10.1182/blood.V98.12.3421
Functional coupling of FcγRI to nicotinamide adenine dinucleotide phosphate
(reduced form) oxidative burst and immune complex trafficking requires the
activation of phospholipase D1
Alirio J. Melendez, Luce Bruetschy, R. Andres Floto, Margaret M. Harnett and Janet M. Allen
Updated information and services can be found at:
http://www.bloodjournal.org/content/98/12/3421.full.html
Articles on similar topics can be found in the following Blood collections
Phagocytes (969 articles)
Signal Transduction (1930 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.