Download Flora of Jammu and Kashmir state (Family Asteraceae

Journal of Plant Biology Research 2014, 3(2): 78-86
eISSN: 2233-0275
pISSN: 2233-1980
http://www.inast.org/jpbr.html
REGULAR ARTICLE
Assessment of Agrobacterium Transformation Efficiency
in a Model plant System
Anusha Pulavarty, Jyoti Tiwari and Bijaya Ketan Sarangi *
Environmental Biotechnology Division, CSIR-National Environmental Engineering Research Institute,
Nehru Marg, Nagpur - 440020, Maharashtra, India
ABSTRACT
Among the various available plant transformation techniques, Agrobacterium mediated gene transfer is highly
preferred due to its high gene transfer efficiency, low copy number incorporation, possible avoidance of gene
silencing, stable expression and ease of the protocol. However, in a highly optimized condition the transformation
efficiency through organogenesis vary between 4 to 20 % and often false positives, putative transformants and
chimeras are encountered. Therefore, efficient protocol standardization is an important prerequisite to obtain high
transformation efficiency; avoid putative transformants and false positives. In this paper we have evaluated
Agrobacterium transformation efficiency of a standardized protocol using the N. tobaccum plant system with a wild
type Agrobacterium tumefaciens strain. The Ti-TDNA specific tms2 gene was tagged as molecular marker to identify
transformants among the regenerated progeny through PCR, and gene expression was ascertained through SDSPAGE.
Keywords: Agrobacterium tumefaciens, tms2, transformation, efficiency.
INTRODUCTION
Agrobacterium mediated transformation has been
one of the most widely used transformation
technique to produce transgenic plants with
desirable characteristics [1, 2, 3, 4, 5]. The T-DNA
within Ti plasmid of the wild armed Agrobacterium
strains is well known to cause crown gall diseases
in the wounded parts of stems, crowns and roots of
thousands of dicots, gymnosperms and monocots
[6, 7, 8, 9, 10, 11]. It has been demonstrated that the
phenotypic tumorous growth of the infected tissue
is due to the expression of several genes present in
the T-DNA segment of Ti plasmid. The tumorous
tissue often become organogenic/embryogenic and
complete plant regeneration takes place from this
unorganized tissue [12, 13]. The T-DNA of Tiplasmids has onc region consisting of three genes
(two representing shooty locus and one representing
rooty locus) have been identified to synthesize the
*
Corresponding author: Bijaya Ketan Sarangi, Environmental
Biotechnology Division, CSIR-National Environmental Engineering
Research Institute, Nehru Marg, Nagpur - 440020, Maharashtra, India.
Tel: +91-9421706693, FAX: 0712-2249900
E-mail: [email protected]
hormones responsible for gall formation and
regenerate plants in course of further culture [14,
15, 16, 17]. Two of them responsible for auxin
synthesis are tms1 and tms2 (or) iaaM and iaaH that
are involved in the biosynthesis of Indole acetic acid
(IAA) from L-tryptophan [18, 19]. The tms1 gene
encodes for tryptophan-2-monooxygenase gene1
which helps in conversion of tryptophan to
indoleacetamide (IAM) precursor of IAA. Further,
conversion of IAM to IAA is governed by tms2 gene
that encodes indoleacetamide hydrolase (iaaH) [20,
21]. This biosynthetic pathway of L-tryptophan
synthesis occurs only in iaa-synthesizing bacteria
but not in plants [22, 23]. The third gene of T-DNA
involved in cytokinin (transzeatin) synthesis is ipt
or tmr gene [24, 25] that encodes for
isopentyltransferase, catalyzes the biosynthesis of
trans-zeatin (tZ) riboside 5’-monophosphate
(tZRMP) or N6-(∆2 isopentyl) adenine (ip) riboside
J. Plant Bio. Res. 2014, 3(2): 78-86
5’- monophosphate isopentyl) adenine (ip) riboside
5’- monophosphate (iPRMP),the precursors of
cytokinins from adenosine monophosphate (AMP)
with 1 hydroxy 2 methyl 2 (E) butenyl 4
diphosphate(HMBDP)
or
dimethylallyl
diphosphate (DMAPP) [21, 24, 25, 26, 27, 28].
There are many reports on Agrobacterium mediated
transformation with respect to tobacco plant system
[13, 17, 29, 30, 31, and 32], however the factors
effecting transformation efficiency are never
complete. Literature survey indicates that in most of
the transformation cases even in model systems,
there has been requirement to develop protocol for
efficient transformation. Thus, development of
efficient transformation protocol is a very important
parameter when attempting for Agrobacterium
mediated transformation with a new plant system.
Therefore, insight into the Agrobacterium-plant
host interaction during infection and co-cultivation
is an important study area; so as to develop a
comprehensive optimized protocol for gene
expression analysis investigations. In this study we
have investigated to determine the transformation
efficiency with respect to T-DNA transfer and
expression in the host tissue using the model
tobacco plant system which is highly amenable for
Agrobacterium transformation. The genetic
transformants have been selected based on PCR
amplification of T-DNA specific gene and its
expression has been ascertained by identification of
the gene specific protein through SDS page.
MATERIALS & METHODS
Plant, bacterial strain and test for pathogenicity
Aseptic Nicotiana tobaccum plants were maintained
on agar gelled Murashige and Skoog (MS) media
(Murashige
and
Skoog
[33]).
Virulent
Agrobacterium tumefaciens (NCIM 2147) strain
was collected from National Collection of Industrial
Microorganisms, Pune. The A. tumefaciens strain
was grown overnight in Yeast Extract (YE) broth
containing 1g L-1 yeast extract, 5 g L-1 peptone, 5 g
L-1 beef extract, 0.3 g L-1 magnesium chloride and 5
g L-1 sucrose at 28±2º C with vigorous shaking at
120 rpm. After 24 hours, 1 O.D. culture broth was
used for infecting the explants tissue. Pathogenicity
of the Agrobacterium strains was tested by infecting
a wound site of the N. tobaccum plant with the
bacterial strain. The infected plant was grown under
laboratory conditions at 28±2º C. The proliferated
tumor tissue was excised and grown on hormone
free MS medium supplemented with 500 mg L-1
Carbenicillin. Leaf disk transformation was carried
out by infecting tissues from aseptically growing N.
tobaccum plants with Agrobacterium grown broth.
The explants were dipped in overnight grown
Agrobacterium in YE broth for 2, 5 and 10 minutes.
After infection, the explants were removed, blotted
on sterile tissue paper, and co-cultivated on
hormone free MS medium in dark condition. After
24 hours the explants were transferred to the same
medium supplemented with Carbenicillin (500 mg
L-1) to eliminate bacteria from the infected tissue.
Three sets of experiments were carried out with
respect to the duration of treatment of explants in
the YE bacterial broth. The control was treated with
the YE broth without bacterial culture. All four sets
of experiments were repeated three times to
optimize the co-cultivation time duration.
Proliferated co-cultivated tissues were sub-cultured
onto fresh MS medium supplemented with same
concentration of Carbenicillin and devoid of growth
hormones. Regenerated individual plantlets were
excised from the tissue and grown separately.
Genomic DNA was isolated from all plantlets
regenerated from the co-cultivated tissue by CTAB
method [34]. Genomic DNA from the non-infected
tissue was taken as negative control, and total DNA
from the used A. tumefaciens strain was taken as
positive control.
PCR primers were designed complementary to tms
2 gene using DNASTAR software. The primers we
re; tms2F (5`TTTCAGCTGCTAGGGCCACATC
AG3`) and tms2 R (5`TCGCCATGGAAACGCCG
GAGTAGG3`) with expected PCR amplicon of 617
base pairs. The PCR conditions were set to: one
cycle of initial denaturation at 95º C for 4 min
followed by; 40 cycles of 95º C for 30sec, 55º C for
30 sec, 72º C for 1min, final extension for 5 min at
72º C before rapid cooling at 4º C. PCR was
performed using Thermocycler Biorad (MJ-mini
personal Thermocycler #PTC-1148C) with high
pace available temperature transitions. The obtained
PCR amplicon was separated on 1% Agarose gel
with ethidium bromide (0.5µg ml-1) in 1× TAE
buffer (0.04 M TRIS-acetate, 1 mM EDTA, pH =
8). The desired amplicon was excised from gel,
purified using ZymocleanTM gel DNA recovery kit,
sequenced and analyzed using BLASTn tool of
NCBI to identify homology and confirm the T-DNA
insertion in the host genome. The expression profile
of iaaM gene was studied through profiling total
79
J. Plant Bio. Res. 2014, 3(2): 78-86
protein from PCR positive regenerated plants, noninfected N. tobaccum plant was considered as
negative control and protein from the tumor cells as
positive control. The total protein was profiled
through SDS-PAGE, and analyzed for presence of
protein band corresponding to the indolyl-3acetamide hydrolase enzyme in the extracted
protein [35].
RESULTS & DISCUSSION
This study was carried out to assess the influence of
culture conditions for gene transfer during cocultivation of Agrobacterium infected tissues and
determine the key parameter(s) regulating
transformation efficiency. The Agrobacterium
infected wound sites of N. tobaccum plant
developed gall after a period of 7 days which were
distinctly visible within 2 to 3 weeks (Figure 1c).
The developed gall proliferated in to calli biomass
on hormone free MS medium without antibiotic,
whereas non-cocultivated tissue of the tobacco plant
did not proliferate to calli in similar medium. Calli
formation from explants in plant tissue culture
medium takes place under the influence of plant
growth hormones which are supplemented in the
medium [36, 37]. In majority cases, callus
formation is regulated by the ratio between Auxins
and Cytokinins. Proliferation of the gall tissue to
calli indicated endogenous synthesis of these
hormones by virtue of the hormone synthesizing
genes present in the T-DNA of Ti plasmid that have
been transferred to the host genome through the
Agrobacterium infection. The results showed
virulence of the collected Agrobacterium strain,
transfer and expression of the T-DNA genes in the
transfer and expression of the T-DNA genes in the
studied tobacco genotype. The gall tissue was
maintained in hormone free MS medium without
antibiotic and used for gene expression analysis
(Figure 1d). Co-cultivation experiments were robust
and very less time consuming, as virulent
Agrobacterium strain took only 24 hours in dark
conditions to develop colonies around the surface of
explants. Agrobacterium strain 2147 was highly
virulent when compared to Agrobacterium strain
2145 as observed through several repetition of
experiments (Table 1). After the desired period of
co-cultivation, the explants were transferred to MS
medium containing 500mg L-1 Carbenicillin to
eliminate bacteria from the co-cultivated tobacco
tissues which should have transferred the T-DNA
from their Ti-plasmid to the host cells. It was also
found that 5 minutes treatment of explants in the
bacterial broth was optimum for sufficient growth
of bacteria during further incubation, whereas 10
minutes treatment leads to bacterial overgrowth.
Carbenicillin served as an effective antibiotic for
elimination of further bacterial growth. But,
bacterial growth could not be eliminated from
explants treated with bacterial solution for 10
minutes in spite of repeated subculture to antibiotic
supplemented medium. Proliferation of the cocultivated tissues on the incision sites were
observed (Figure 2b), especially on the surface of
the leaf explants within a period of 7 days (Figure
2c). After a period of 15 days, the proliferated
tissues grew into individual plantlets (Figure 2d).
From single leaf explants of 0.5 cm size, 6 plantlets
were regenerated on hormone free MS medium
through
Figure 1. Tumor induction by the Agrobacterium strain (NCIM 2147): (a) Agrobacterium tumefaciens strain in
YE broth, (b) Tobacco plant before pricking, (c) Gall formation in the infected site of the plant, (d) Proliferation of
tumor in hormone free MS hormone free medium with antibiotic.
80
J. Plant Bio. Res. 2014, 3(2): 78-86
Table 1. Response of explants co-cultivated with the two bacterial strains
Agrobacterium
Bacterial
Co-cultivation
Observation
Strain
treatment duration
duration
Control
2, 5, 10
minutes in
YE broth
without
bacteria
24 hours on
hormone free
MS medium
No bacterial growth
on
the
medium
around the tissues
A. tumefaciens
(NCIM 2147)
2 minutes
in YE
overnight
grown
broth
5 minutes
in YE
overnight
grown
broth
10
minutes in
YE
overnight
grown
broth
2, 5, 10
minutes in
YE broth
Grown
overnight
As above
After
24
hours
bacteria growth was
visible around the
tissues.
As above
After
24
hours
growth of bacteria
was visible around
the tissues with tissue
swelling
After
24
hours
bacteria overgrowth
growth around the
tissues,
wounded
parts
become
brownish.
No bacterial growth
on and around the
tissues after 48 hrs
A. tumefaciens
(NCIM 2147)
A. tumefaciens
(NCIM 2147)
A. tumefaciens
(NCIM 2145)
As above
As above
Post cocultivated
processing
Performance
Co-cultivated
tissues
subcultured on MS
hormone
free
medium
with
Carbenicillin
500mg L-1
As above
No
plant
regeneration
As above
Organogenic
calli and plant
regeneration
As above
Tissue
putrefied due
to
bacteria
overgrowth
As above
No
tissue
proliferation
was observed
Organogenic
calli and plant
regeneration
(c)
Figure 2. Plant regeneration from the Agrobacterium co-cultivated tissue: (a) 24 hours after co-cultivation, (b)
Proliferation of tissues after 15 days, (c) Plant regeneration from a single co-cultivated explant after 1 month.
81
J. Plant Bio. Res. 2014, 3(2): 78-86
the morphogenetic co-cultivated tissue as well as
regenerants on the antibiotic supplemented
medium, the regenerated plants were unfit for
subsequent experiments. Plant regeneration from
such cultures often produces false positives due to
cross feed of growth hormones to the co-cultivated
tissue by the bacterial strain that facilitates growth
and plant regeneration from the tissue in the
hormone free medium. Further, during DNA
isolation from regenerants of this types of culture,
DNA of the bacterial strain will contaminate the
plant genomic DNA. The PCR positive regenerants
from such types of cultures will be false positives
due to the tms2 of the bacterial strain itself. Hence,
elimination of bacterial culture during further
subculture of the co-cultivated tissue is one of the
foremost issues to avoid false positives. Therefore,
the treatment duration of the tissue with bacterial
broth during co-cultivation is an important
parameter for standardization of Agrobacterium
transformation. Our study indicates that bacterial
treatment of the explants for 5 minutes; followed by
co-cultivation for 24 hours or till light growth of the
bacteria visible around the co-cultivated tissue is
optimum for T-DNA transfer from the Ti-plasmid
of the Agrobacterium strain 2147. Response of
explants with respect to bacterial treatment duration
and co-cultivation, and tissue performances after
co-cultivation are presented in Table 1.
All regenerated shoots from one single organogenic
co-cultivated tissue were collected (Figure 2d).
Total DNA from the regenerated plants, gall tissue
and the Agrobacterium strain used for cocultivation were isolated following the protocols
described in material and methods. These DNAs
were used as template for PCR amplification using
the tms2 gene specific primers as described in
materials and methods. PCR amplification results
showed that out of 6 regenerated plantlets from a
single co-cultivated explant, only 2 were tms2
positive, although all six plants were regenerated
from the tissue in hormone free medium. PCR
amplification revealed that the desired amplicon
was present in regenerated plants corresponding to
lanes 7 & 8, whereas there was no amplification in
the plants corresponding to lanes 4-6 & 9 (Figure 3).
Absence of the desired amplicon shows no T-DNA
integration in the genome of these plants, although
they were regenerated from the same
Agrobacterium co-cultivated explant. The obtained
amplicons were purified, sequenced and with
homology with the T-DNA tms2 was established
nucleotide BLAST tool of NCBI. It was observed
that the co-cultivated tissue transformed in to
organogenic calli which regenerated into shoots.
Figure 3. PCR amplification of 617bp products with DNA of
regenerated plantlets and Agrobacterium strain used for
transformation. Negative in case of non-transformed plant.
Legends: Lane 1: Molecular weight 1Kb ladder; Lane 2:
Agrobacterium tumefaciens NCIM 2147 (positive control);
Lane 3: N. tobaccum plant (negative control); Lane 4-9:
Regenerated plants from the Agrobacterium co-cultivated
explant
It is known that callus proliferation and shoot
regeneration from calli takes place due to the
interactions of plant growth regulators; especially
auxin and cytokinin [36, 37, 38]. There was no plant
regeneration from the tissue treated with YE broth
without bacteria, so also from the explants
cultivated in hormone free MS medium with or
without Carbenicillin. Hence, it indicated that plant
regeneration from the co-cultivated tobacco
explants in MS medium without hormone
supplementation was due to co-cultivation with
Agrobacterium. In the expected lines, tms2 positive
regenerants had tms1 and tms2 transcripts that
encodes iaaM and iaaH respectively, conferring
biosynthesis of Indole acetic acid (IAA) from Ltryptophan [18, 19].
The tms1 gene encodes for tryptophan-2monooxygenase gene which helps in conversion of
tryptophan to indoleacetamide (IAM) precursor of
IAA. Further, conversion of IAM to IAA is
governed by tms2 gene that encodes
indoleacetamide hydrolase (iaaH) (Pacurar et al.
[20]). Whereas, the other regenerants which were
also considered to be transformants, turned tms2
negative, which indicated they were false positives.
82
J. Plant Bio. Res. 2014, 3(2): 78-86
Lane 1
2
3
4
209
KDa
124
80
49.1
34.8
28.9
20.6
7.1
49.9KDa
Figure 4. Total protein profile of the two PCR positive tms2 regenerated plants in SDS-PAGE Lane 1: Pre stained
broad range SDS PAGE molecular weight markers (209 ~ 7.1 KDa); Lane 2: Protein of proliferated gall; Lane 3:
Transformed N. tobaccum plant (PCR positive tms2); Lane 4: Non-transformed N. tobaccum plant
Such situation is often encountered in genetic
transformation methods due to complexity of the
process where a number of factors contribute to the
gene transfer process. Due to such situations, many
Agrobacterium transformation experiments turn out
to be inefficient and fail at late stage although plants
are regenerated and selected with selectable marker
trait due to appearance of false transformation
positives. In most of such cases, the genes are not
transferred to the host cell or does not express. On
the other hand, the positive transformants survive
by virtue of the acquired traits conferred by the
transgene. It is presumed that regeneration and
survival of putative transformants and false positive
in the selection medium is due to cross feed of
growth hormones and creation of favorable
conditions by the transformed tissue to the nontransformed tissues that is adjoined to the nontransformed tissue as both of them are produced
from a common parent tissue. Such scenarios are
also encountered in many cases in spite of using a
selection agent such as; an antibiotic, herbicide or
some other agent in the selection media to eliminate
non-transformed tissue. In our study out of the six
regenerates only two tms2 positives were identified
presumably due to such a situation. Hence, selection
of true transformants is most important for the
success of Agrobacterium mediated transformation
as the efficiency of successful transformation is
very low in spite of many attempts, which is
imperative from the literature review. Similar to
other such transformation procedures, this study
also indicate that there are many uncertainties in the
Agrobacterium mediated transformation cocultivation protocol which needs to be optimized on
case to case basis even in a highly responding plant
species like tobacco.
Successful transformation depends not only on gene
transfer and integration, but also expression of the
foreign gene in the host system. Expression of the
tms2 gene encoded indolyl-3-acetamide hydrolase
was analyzed through SDS-PAGE in the two PCR
positive transformants to confirm gene expression.
The total protein profile of two tms2 positive plants
is presented in Figure 4, which shows a prominent
49.9KDa protein resembling to the indolyl-3acetamide hydrolase that mediates biosynthesis of
Indole-3-actic acid (Auxin) from L-tryptophan [21].
However, out of the two tms2 positive regenerate
the 49.9KDa protein was present only in one of
them showing expression of the tms2 gene.
Whereas, in case of the other plant, which is
although positive for the tms2 the gene it is not
expressed. The results of our study shows that from
a single transformation event although six plants
were regenerated, the tms2 gene was integrated in
two of them, and out of the two recipients the gene
83
J. Plant Bio. Res. 2014, 3(2): 78-86
was functional only in one which was true
transformant out of the six regenerated plants.
CONCLUSION
Agrobacterium mediated genetic transformation
for selection of true transgenic plant depends on a
variety of factors during bacterial co-cultivation.
Profuse plant regeneration from the bacterial
infected tissue may be obtained due to crosstalk
between transformed and non-transformed cell line
in the tissue. Our investigation shows that durations
of bacterial infection and co-cultivation are not
insignificant factors for efficient gene transfer in the
selection of transformants. Further, expression of
the transgene in the recipient plant is an independent
event that does not necessarily depend on
integration of the foreign gene. The results of our
investigation are established through genomic and
proteomic analysis with the N. tobaccum plant
system which is an established plant system for
efficient Agrobacterium transformation and
complete plant regeneration. Based on our research
evidences and selection of one true transgenic plant
out of the six individual shoots, it is concluded that
transformation efficiency was about 16.67% from
single co-cultivated explants.
ACKNOWLEDGENT
The authors acknowledge DST (Department of
Science & Technology, Government of India) for
the award of DST INSPIRE fellowship to Anusha
Pulavarty. We would also like to acknowledge the
support and encouragement of Director, CSIRNEERI, Nagpur to conduct this research work.
REFERENCES
[1] Lee. K., Yi. B.Y., Kim. K.H., Kim. J.B., Suh. S.C.,
Woo. H.J., Shin. K. S and Kweon. S.J. 2011.
Development of efficient transformation protocol
for soybean (Glycine max L.) and characterization of
transgene expression after Agrobacterium-mediated
gene transfer. J. Korean Soc. Appl. Biol. Chem.
54(1): 37-45.
[2] Sumithra. S., Katageri. I. S and Vamadevaiah. H.M.
2010. Factors influencing regeneration and
Agrobacterium mediated
transformation of
Gossypium herbaceaum and Gossypium hirsutum
cotton genotypes. Karnataka J. Agric. Sci. 23 (2) :
222-226
[3] Ishida.J.K., Yoshida.S., Ito.M., Namba.S and
Shirasu.
K.
2011.
Agrobacterium
rhizogenesMediated transformation of the Parasitic
Plant Phtheirospermum japonicum. Plos
One.
6(10):1-8.
[4] Kubota.A., Ishizaki.K., Hosaka.M and Kohchi.T.
2013.
Efficient
Agrobacterium
mediated
transformation of liverwork Marchantia polymorpha
using regenerating thalli. Biosci. Biotecnol.
Biochem. 77(1):167-172.
[5] Ribas. A. F., Dechamp. E., Champion. A., Bertrand.
B., Combes. M.C., Verdeil. J.L., Lapeyre. F.,
Lashermes. P and Etienne. H. 2011. Agrobacteriummediated genetic transformation of Coffea arabica
(L.) is greatly enhanced by using established
embryogenic callus cultures. BMC Plant Biol.
11(92):1-15.
[6] Chilton. M.D., Tepfer. D.A., Petit.A., David. C.,
Delbart. F.C and Tempe. J. 1982. Agrobacterium
rhizogenes inserts T-DNA into the genomes of the
host plant root cells. Nature. 295:432-434.
[7] Gohlke. J and Deeken. R. 2014. Plant responses to
Agrobacterium tumefaciens and crown gall
development. Front. in Plant Scien. 155(5):1-11.
[8] Galambos. A., Zok. A., Kuczmog. A., Olah. R.,
Putnoky. P., Ream. W and Szegedi. E. 2013.
Silencing Agrobacterium oncogenes in transgenic
grapevine results in strain-specific crown gall
resistance. Plant Cell Rep. 32:1751-1757.
[9] Lacroix. B., Gizatullina. D.I., Babst. B.A., Gifford.
A.N and Citovsky. V. 2014. Agrobacterium T-DNAencoded protein Atu6002 interferes with the host
Auxin response. Molecu. Plant Pathol. 15(3):275283.
[10] Pitzschke. A and Hirt.H. 2010. New insights into an
old story: Agrobacterium
induced tumour
formation in plants by plant transformation. The
EMBO Jour. 29(6): 1021-1032.
[11] Smith. E.F., Brown.N.A and Townsend.C.O.1911.
Crown gall of plants: its cause and remedy. US
Government printing office.
[12] Leemans. J., Deblaere. R., Willmitzer. L.,
Greve.H.D., Hernalsteens. J.P., Van Montagu. M
and Schell.J. 1982. Genetic Identification of
functions of TL-DNA transcripts in octopine crown
galls. The EMBO J. 1(1): 147-152.
84
J. Plant Bio. Res. 2014, 3(2): 78-86
[13] Gheysen. G., Montagu. M.V., and Zambrysk.P.
1987. Integration of Agrobacterium tumefaciens
DNA (T-DNA) involves rearrangements of target
plant DNA sequences. Proc. Natl. Acad.
Sci.84:6169-6173.
[14] Gelvin. S.B. 2000. Agrobacterium and plant genes
involved in T-DNA transfer and integration. Annu.
Rev. Plant Physiol. Plant Mol. Biol. 51:223-256.
[15] Gelvin. S.B. 2003. Agrobacterium- mediated plant
transformation: the biology behind the “genejockeying” tool. Microbiol. Mol. Biol. Rev. 67:1637.
[16] Gelvin. S.B. 2010. Plant proteins involved in
Agrobacterium- mediated genetic transformation.
Annu. Rev. Phytopathol.48:45-68.
[17] Barton. K.A., Binns. A.N., Matzke. A.J and
Chilton.D.D. 1983. Regeneration of intact tobacco
plants containing full length copies of genetically
engineered T-DNA, and transmission of T-DNA to
Ri progeny. Cell. 32(4):1033-1043.
[18] Bulgakov.V.P., Shkryl. Y.N., Veremeichik. G.N.,
Gorpenchenko. T.Y and Vereshchagina. Y.V. 2013.
Recent advances in the understanding of
Agrobacterium rhizogenes- derived genes and their
effects on stress resistance and plant metabolism.
Adv. Biochem. Eng. Biotechnol. 134: 1-22.
[19] Escobar. M.A and Dandekar. A.M. 2003.
Agrobacterium tumefaciens as an agent of disease.
Trends Plant Sci. 8:380-386.
[20] Pacurar. D.I., Christensen. T.H., Pacurar. M.L.,
Pamfil. D., Botez. C and Bellini. C. 2011.
Agrobacterium tumefaciens: from crown gall tumors
to genetic transformation. Physiol. Mol. Plant
Pathol. 76: 76-81.
[21] Ueda. N., Kojima. M., Suzuki. K and Sakakibara. H.
2012.
Agrobacterium
tumefaciens
tumor
morphology root plastid localization and preferential
usage of hydroxylated prenyl donor is important for
efficient gall formation. Plant Physiol. 159:10641072.
[22] Inze, D., Follin. A., Lijsebettens. M.V., Simoens.C.,
Genetello.C., Montago. M.V and Schell.J. 1984.
Genetic Analysis of the Individual T-DNA Genes of
Agrobacterium tumefaciens: Further evidence that
two Genes are involved in Indole-3-Acetic Acid
Synthesis. Mol. and Gene. Genet. MGG. 194(1,2):
265–274.
[23] Thomashow. L.S., Reeves. S and Thomashow. M.F.
1984. Crown Gall Oncogenesis: Evidence that a TDNA gene from the Agrobacterium Ti plasmid
PTiA6 encodes an enzyme that catalyses synthesis
of Indoleacetic acid. Proc. Natl. Acad. Sci.USA. 81:
5071–5075.
[24] Akiyoshi. D.E., Klee. H., Amasino. R.M., Nester.
E.W and Gordon. M.P. 1984. T-DNA of
Agrobacterium tumefaciens encodes an enzyme of
cytokinin biosynthesis. Proc. Natl. Acad. Sci. USA.
81: 5994-5998.
[25] Barry. G.F., Rogers. S.G., Fraley. R.T and Brand. L.
1984. Identification of a cloned cytokinin
biosynthesis gene. Proc. Natl. Acad. Sci. USA.
81:4776-4780.
[26] Klee. H.J., Romano. C.P and Binns. A. 1994. The
roles of phytohormones in development as studied in
transgenic plants. Crit. Rev. Plant Sci. 13(4): 311–
324.
[27] Sakakibara. H. 2006. Cytokinins: Activity,
biosynthesis and translocation. Annu. Rev. Plant
Biol. 57:431-449.
[28] Sakakibara. H., Kasahara. H., Ueda. N., Kojima. M.,
Takei.K.,
Hishiyama.
S.,
Asami.T.,Okada.
K.,Kamiya.Y.,Yamaya. T and Yamaguchi. S. 2005.
Agrobacterium tumefaciens increases cytokinin
production in plastids by modifying the biosynthetic
pathway in the nost plant. Pro. Natl. Acad. Sci. USA.
102:9972-9977.
[29] Chakravarthy. R., Prashanti. S and Sadanandam. A.
2011. Genetic transformation studies in Nicotiana
tobaccum. Advan. Biotech. 11:15-17.
[30] Suzuki.K.,Yamashita. I and Tanaka.N.2002.Tobacc
o plants were transformed by Agrobacterium
rhizogenes infection during their evolution. The
Plant jour. 32:775-787.
[31] Han. Z.F., Hunter. D.M., Sibbald. S., Zhang. J.S and
Tian. L. 2013. Biological Acitivity of the tzs gene of
Nopaline Agrobacterium tumefaciens GV3101 in
plant regeneration and genetic transformation. Mol.
Plant- Mico. Interac. 11:1359-1365.
[32] Pathi. K.M., Tula. S and Tuteja. N. 2013. High
frequency regeneration via direct somatic
embryogenesis and efficient Agrobacterium –
mediated genetic transformation of tobacco. Plant
Signal & Behav. 8(6):1-8.
85
J. Plant Bio. Res. 2014, 3(2): 78-86
[33] Murashige. T. & Skoog F. 1962. A revised medium
for rapid growth and bioassay with tobacco tissue
cultures. Physiol. Plant. 15: 473–497.
[34] Doyle. J.J and Doyle. J.L.1990. Isolation of plant
DNA from fresh tissue. FOCUS 12:13–15.
[35] Bradford. M.M. 1976. A Rapid and sensitive method
for the quantification of microgram quantities of
protein utilizing the principle of protein dye binding.
Anal. Biochem. 72:248-254.
[36] Endress. R. 1994. Plant Cell Biotechnology.
Springer Verlag, Berlin.
[37] Castillo. A.M., Egana. B., Sanz. J.M and Cistue. L.
1998. Somatic Embryogenesis and plant
regeneration from barley cultivars grown in Spain.
Plant Cell Rep. 17(11):902-906.
[38] Choudhary. A.K., Barman. P., Subramanian. S.,
Pathi. K.M and Kaushik. S. 2014. In vitro culture of
economically important plant: Solanum nigrum. The
Scit. Jou. ISSN 2347-7318. 1(4):23-25.
86