Download PDF

RESEARCH ARTICLE 1543
Development 137, 1543-1551 (2010) doi:10.1242/dev.047696
© 2010. Published by The Company of Biologists Ltd
Ets1 is required for proper migration and differentiation of
the cardiac neural crest
Zhiguang Gao1, Gene H. Kim1, Alexander C. Mackinnon2, Alleda E. Flagg3, Brett Bassett1, Judy U. Earley1 and
Eric C. Svensson1,3,*
SUMMARY
Defects in cardiac neural crest lead to congenital heart disease through failure of cardiac outflow tract and ventricular septation. In
this report, we demonstrate a previously unappreciated role for the transcription factor Ets1 in the regulation of cardiac neural
crest development. When bred onto a C57BL/6 genetic background, Ets1–/– mice have a nearly complete perinatal lethality.
Histologic examination of Ets1–/– embryos revealed a membranous ventricular septal defect and an abnormal nodule of cartilage
within the heart. Lineage-tracing experiments in Ets1–/– mice demonstrated that cells of the neural crest lineage form this cartilage
nodule and do not complete their migration to the proximal aspects of the outflow tract endocardial cushions, resulting in the
failure of membranous interventricular septum formation. Given previous studies demonstrating that the MEK/ERK pathway
directly regulates Ets1 activity, we cultured embryonic hearts in the presence of the MEK inhibitor U0126 and found that U0126
induced intra-cardiac cartilage formation, suggesting the involvement of a MEK/ERK/Ets1 pathway in blocking chondrocyte
differentiation of cardiac neural crest. Taken together, these results demonstrate that Ets1 is required to direct the proper migration
and differentiation of cardiac neural crest in the formation of the interventricular septum, and therefore could play a role in the
etiology of human congenital heart disease.
INTRODUCTION
The Ets family of transcription factors, of which there are now
almost 30 members, are characterized by a winged helix-turn-helix
DNA-binding domain termed the ‘Ets’ domain (Oikawa and
Yamada, 2003). Ets1, the founding member of the Ets transcription
factor family, is widely expressed in the developing embryo,
including the heart (Kola et al., 1993). There is evidence to support
a role for Ets1 during cardiovascular development in multiple
animal model systems. Recent work in Ciona intestinalis has
demonstrated that FGF signaling activates Ci-Ets1/2, the Ets1
homolog in Ciona, and directs cardiac lineage specification.
Blockage of FGF signaling or inhibition of Ets1/2 leads to the failure
of heart formation, whereas the ectopic activation of Ets1/2 expands
the population of cells specified to the cardiac fate (Davidson et al.,
2006). In Drosophila, the Ets1 homolog pointed has been shown to
regulate the cardioblast/pericardial cell fate decision. Flies that lack
pointed generate an excess of cardioblasts at the expense of
pericardial cell number in the posterior aspect of the developing
heart tube (Alvarez et al., 2003). Finally, in chick embryos,
intravenous injection of a retrovirus encoding an antisense RNA
directed against Ets1 and Ets2 resulted in embryos with a thin
epicardium, disorganized coronary arteries and ventricular septal
defects (Lie-Venema et al., 2003). Taken together, these
observations suggest the importance of Ets factors for the
development of the cardiovascular system.
Given these results, we were interested in the role of Ets1 in
mammalian heart morphogenesis. Ets1-deficient mice have been
previously generated and have defects in natural killer (NK) cell, T1
Department of Medicine, 2Department of Pathology and 3the Committee on
Developmental Biology, The University of Chicago, Chicago, IL 60637, USA.
*Author for correspondence ([email protected])
Accepted 23 February 2010
cell, and B-cell development, as well as in vascular inflammation
and remodeling (Barton et al., 1998; Bories et al., 1995; Clements
et al., 2006; Eyquem et al., 2004a; Eyquem et al., 2004b; Wang et
al., 2005; Zhan et al., 2005). In addition, a p51-isoform specific
disruption of the murine Ets1 gene has also been generated and
found to cause defects in lymphoid maturation (Higuchi et al.,
2007). Interestingly, in each of these reports, a perinatal lethality of
Ets1-deficient mice was observed at variable penetrance. To date,
however, this perinatal lethality has not been further characterized.
Given the evidence in other model organisms for the role of Ets1
in cardiovascular development, we hypothesized that the perinatal
lethality observed in the Ets1-deficient mice was due to a defect in
cardiac development. To investigate this possibility, we backcrossed
Ets1-deficient mice for eight generations onto the C57BL/6 genetic
background, making this perinatal lethality nearly completely
penetrant. An analysis of these mice revealed cardiac
malformations, including a membranous ventricular septal defect
and a nodule of intra-cardiac cartilage. We show that cardiac neural
crest fails to migrate appropriately and contribute to the
membranous ventricular septum, suggesting a cause for the
membranous ventricular septal defects seen in these mice. We also
demonstrate that the intra-cardiac cartilage is derived from cells of
the cardiac neural crest lineage and that the MEK/ERK signaling
pathway upstream of Ets1 is required to block this cartilage
formation. Together, these results suggest the importance of Ets1 in
regulation of the migration and differentiation of a subset of the
cardiac neural crest.
MATERIALS AND METHODS
Mouse strains
The previously described Ets1-deficient mice were backcrossed to C57BL/6
mice for eight generations (Barton et al., 1998). Genomic DNA was prepared
from the tails of mice or the yolk sac of embryos using a commercially
available kit (Purgene, Qiagen, Valencia, CA, USA). Genotyping was
DEVELOPMENT
KEY WORDS: Ets1, Neural Crest, Cartilage, Mouse
1544 RESEARCH ARTICLE
Histological analysis
Embryonic day (E) 18.5 embryos and newborn pups were sacrificed,
skinned, fixed in 10% formalin at 4°C for 48 hours, dehydrated and then
embedded in paraffin. Transverse sections (7 mm) were stained with
Hematoxylin and Eosin for morphology. Similarly, embryos at E14.5E18.5 were fixed, dehydrated and embedded in paraffin. Transverse
sections were stained with Alcian Blue at pH 0.5 and counterstained with
Neutral Red.
In situ hybridization
In situ hybridizations were performed on E10.5-E16.5 embryo sections as
described previously (Flagg et al., 2007). cDNA fragments specific to Ets1,
Sox5, cartilage link protein (CLP; Hapln1 – Mouse Genome Informatics)
and elastin were generated using RT-PCR and the following primers:
Ets1, 5⬘-GATATCCTGTGGGAGCATCTAGAGATC and 5⬘-CAGCTGGATCGGCCCACTTCCTGTGTAG;
Sox5, 5⬘-ATGGTGACAAGCAGACAGAAAGTG and 5⬘-GATCTGCTCCTGTTGCTGCTTGG;
CLP, 5⬘-TGCAGTACCCAATCACCAAACC and 5⬘-TTCACGTAACTCAAGAACTGAC; and
elastin, 5⬘-CTGGATCGCTGGCTGCATCC and 5⬘-CAGGGCTCCAAGGGCTCCTC.
Fragments were cloned into the pGEM-T-Easy vector (Promega,
Madison, WI, USA) and the resultant vectors were used to generate 35Slabeled riboprobes. The Sox9 and Pax3 in situ hybridization probes have
been previously described (Flagg et al., 2007; Milewski et al., 2004).
b-galactosidase staining
Mouse embryos or hearts from newborn pups were harvested and
incubated in b-galactosidase fix (0.2% glutaraldehyde, 5 mM EGTA, 100
mM MgCl2, and 100 mM sodium phosphate, pH 7.3) for 30 minutes at
4°C. Samples were then washed three times for 20 minutes each wash in
wash buffer (0.01% sodium deoxycholate, 0.02% Nonidet-P40, 2 mM
MgCl2, and 100 mM sodium phosphate, pH 7.3), followed by three
washes in PBS. Subsequently, samples were incubated in 15% sucrose in
PBS for 1 hour at 4°C, followed by overnight incubation in 30% sucrose
in PBS. Samples were then embedded in OCT and 7 mm sections prepared
using a Leica CM1850 cryostat. Sections were re-fixed in 0.2%
glutaraldehyde in PBS for 10 minutes at 4°C, then washed three times for
5 minutes each wash in wash buffer. Sections were then incubated in bgalactosidase staining solution (1 mg/ml X-Gal, 5 mM potassium
ferrocyanide, 5 mM potassium ferricyanide, 0.01% sodium deoxycholate,
0.02% Nonidet-P40, 2 mM MgCl2, and 100 mM sodium phosphate, pH
7.3) for 4 to 6 hours at 37°C. Following b-galactosidase staining, sections
were washed three times with PBS and then counterstained with Nuclear
Fast Red.
Immunofluorescence
Frozen sections were prepared from E12.5 mouse embryos and fixed for 30
minutes in 100% methanol. Sections were then washed with PBS and
blocked in blocking buffer (PBS + 5% BSA + 0.2% Triton X-100) for 1 hour
at room temperature. Sections were then incubated with a 1:100 dilution of
a rabbit anti-Ets1 antibody (N-276, Santa Cruz Biotechnology) and a 1:200
dilution of a chicken anti-b-galactosidase antibody (ab3961, Abcam) for 2
hours at room temperature. Subsequently, sections were washed with PBS
and incubated with a 1:500 dilution of an Alexa-488-conjugated goat antirabbit IgG antibody (A11008, Invitrogen, Carlsbad, CA, USA) and a 1:500
dilution of a Cy3-conjugated goat anti-chicken IgG antibody (103-165-155,
Jackson ImmunoResearch). Sections were washed and immunofluorescence
visualized with a Zeiss Axiophot fluorescence microscope.
Quantitative RT-PCR analysis
Total RNA from wild-type and Ets1–/– newborn pup hearts were isolated
using Trizol (Invitrogen) and first-strand cDNA was synthesized using
Superscript reverse transcriptase (Invitrogen). Quantitative RT-PCR was
performed using primers specific to:
Sox4,
5⬘-AGTGAAGCGCGTCTACCTGTTTGG
and
5⬘CATGCTCTCAAAGTTTGAGCTGGG;
Adam19, 5⬘-CTGGGGCTCGAATAGAAAGAAAGG and 5⬘-TATTGCTCCAACCCTCTGTGATCG;
Pdgfra, 5⬘-ACCTGAACCCAGACCATCG and 5⬘-CACGGAGGAGGACAAAGACC;
Sox5, 5⬘-ATGGTGACAAGCAGACAGAAAGTG and 5⬘-TTCCGCCTTCTGAGGTGAGGTAG;
Sox6, 5⬘-AACAGATCCAGCGGGAGCAACAAC and 5⬘-CTGGCCGAGTGAGATCGATGACAC;
connexin 43 (Gja1 – Mouse Genome Informatics), 5⬘TTCCTTTGACTTCAGCCTCCAAGG and 5⬘-AACCGGGTTGTTGAGTGTTACAGC;
Gapdh, 5⬘-TGACAAGCTTCCCATTCTCG and 5⬘-GTGAAGGTCGGTGTGAACG;
CLP, 5⬘-TGCAGTACCCAATCACCAAACC and 5⬘-CCACTTTCGCGATCTGAGCACC; and
aggrecan, 5⬘-GGAGCGAGTCCAACTCTTCAAGC and 5⬘-GCAGTACCACCTCCTTTTCCTTGG.
Primers for Meox1, Msx-2, Smad6, Snail, Notch1, Gata4, Gata6, FOG2 (Zfpm2 – Mouse Genome Informatics), and Sox9 have been described
previously (Flagg et al., 2007). Data were analyzed and normalized to results
obtained with primers specific to Gapdh (Tichopad et al., 2003).
Whole heart organ culture
Whole heart organ culture was carried out as described previously (Lavine
et al., 2006). E13.5 mouse hearts were harvested and cultured in 5-ml glass
scintillation vials containing 1 ml of DMEM supplemented with 10% FBS
and 2 mg/ml heparin at 37°C, 5% CO2. The heart cultures were treated with
DMSO or the MEK inhibitor U0126 (Calbiochem, San Diego, CA, USA) at
a final concentration of 10 mm for 72 hours. Subsequently, the hearts were
either fixed with 4% paraformaldehyde for Alcian Blue staining, used for
western analysis, or used for quantitative RT-PCR analysis, as described
above.
Western analysis
Fifty micrograms of whole heart lysate from hearts cultured in the absence
or presence of U0126 were resolved by 10% SDS-PAGE and transferred to
a nitrocellulose membrane (Whatman, Piscataway, NJ). The membrane was
blocked with Blotto [10 mM Tris (pH 7.5), 140 mM NaCl, 0.05% Tween20, and 5% instant milk] and then incubated with a 1:1000 dilution of a
rabbit anti-phospho-Erk1/2 antibody (#9101, Cell Signaling Technology).
The membrane was washed and incubated with a 1:5000 dilution of a HRPcoupled goat anti-rabbit IgG. The membrane was developed using
autoradiography and a commercially available kit (ECL-plus, Amersham),
and quantitated using Quantity One software. Subsequently, the membrane
was stripped and re-probed with a 1:1000 dilution of an antibody directed
against total Erk1/2 (#4695, Cell Signaling Technology).
RESULTS
Perinatal lethality of Ets1–/– mice
Two groups have previously generated Ets1-deficient mice and a
third group has generated an isoform specific disruption of the
Ets1 gene (Barton et al., 1998; Eyquem et al., 2004b; Higuchi et
al., 2007). In all three of these lines, a significant perinatal
lethality was observed but not further characterized. To determine
the cause of this lethality, we obtained Ets1+/– mice originally
generated by Barton et al. on a mixed genetic background and
DEVELOPMENT
performed using PCR and the primers 5⬘-GTCTTCTTCTCTAGTTTCTGAGTGCTC, 5⬘-GTCCTGCTTACAACACTCTGAATCCTG
and 5⬘-GCCTGCTCTTTACTGAAGGCTCTTT. Under these conditions,
the wild-type allele will generate a 438-bp fragment and mutant allele a 350bp fragment. Tie2-Cre transgenic mice [B6.Cg-Tg(Tek-cre)12Flv/J] and
ROSA26RlacZ reporter mice [B6.129S4-Gt(ROSA)26Sortm1Sor/J], both on a
C57BL/6 background, were obtained from Jackson Laboratories. Wnt1-Cre
transgenic mice were obtained from Dr Akira Imamoto (University of
Chicago, Chicago, IL, USA). All mice were cared for and experiments
performed in accordance with the policies of the University of Chicago
Animal Care and Use committee.
Development 137 (9)
Ets1 and the cardiac neural crest
RESEARCH ARTICLE 1545
Table 1. Genotype analysis of Ets1+/– crosses
Genotype
Embryonic
P0 pups
P3 pups
P21 pups
+/+
+/–
–/–
26 (29%)
13 (21%)
12 (36%)
39 (39%)
45 (49%)
37 (60%)
21 (63%)
59 (60%)
20 (22%)
12 (19%)
0
1 (1%)
Ets1+/– mice were crossed and E14.5-E18.5 embryos (embryonic), animals at birth
(P0), at the third day after birth (P3), or at weaning (P21) were genotyped by PCR.
Multiple cardiac defects in Ets1–/– mice
To investigate the cause of the perinatal lethality observed in the
Ets1-deficient mice, we performed histological analysis on twelve
E16.5 to postnatal day (P) 0 Ets1–/– animals (Fig. 1). Eleven of the
twelve animals examined showed a membranous ventricular septal
defect, which was likely to contribute to the perinatal lethality (Fig.
1B). Also, right ventricular dilation was noted in all the P0 animals
examined. Other cardiac malformations were also present, but at
incomplete penetrance, including an atrial septal defect (8/12), a
muscular ventricular septal defect (6/12), dilated left and right atria
(5/12), and a thin left ventricular wall (3/12) (Table 2). Finally, in all
of the Ets1–/– hearts examined (n=12), we observed an abnormal
structure in the peri-aortic area, which had a histological appearance
similar to cartilage (Fig. 1D). Mason’s trichrome and Alcian Blue
staining of this structure supported the notion that this was indeed
cartilage (Fig. 1E,F). This structure was adjacent to the aorta at the
level of the aortic valve, but was clearly outside of and distinct from
the wall of the aorta. No direct continuity between the aortic valve
leaflets and this abnormal focus of cartilage could be appreciated.
We also observed a small nodule of peri-aortic cartilage in 50% of
the heterozygous Ets1 hearts examined (n=4; see Fig. S1 in the
supplementary material). To examine the development of the
remainder of the skeleton of the Ets1–/– embryos, we prepared
Alcian Blue and Alizarin Red stained bone preparations from wildtype and Ets1–/– newborn pups (see Fig. S2 in the supplementary
material). We observed no significant difference in the ossification
of the skull or the rest of the embryo.
To determine the time at which this nodule of cartilage formed in
the hearts of Ets1–/– mice, embryos from heterozygous intercrosses
were harvested at E14.5 to E18.5, embedded, sectioned transversely,
and stained with Alcian Blue (Fig. 2). The results reveal that this
focus of cartilage first developed between E14.5 and E16.5 in Ets1–/–
mice, a period in mouse embryonic development in which
significant maturation of the endocardial cushions and the
interventricular septum is occurring.
Fig. 1. Ventricular septal defects and peri-aortic cartilage
formation in Ets1-deficient mice. (A-F) Hematoxylin and Eosin (A-D),
Mason’s Trichrome (E), or Alcian Blue (F) staining on transverse sections
of wild-type (A,C) and Ets1–/– (B,D-F) newborn pups. The membranous
ventricular septum in a wild-type mouse is indicated (A, arrow), as well
as a membranous ventricular septal defect in the Ets1–/– mice (B,
arrow). In C-F, transverse sections at the level of the aortic valve leaflets
reveal an abnormal structure in the aortic area in Ets1–/– mice (arrows).
Ao, aorta; LV, left ventricle; RV, right ventricle.
Expression of Ets1 in developing endocardial
cushions of the mouse heart
As a first step towards understanding the molecular pathways
perturbed in the Ets1-deficient mice, we sought to further define the
pattern of expression of Ets1 in the heart during cardiac
development. Although previous reports demonstrated via northern
analysis that Ets1 is expressed in the developing mouse heart
(Maroulakou et al., 1994), the temporal and cell-type-specific
pattern of expression was not examined. Work in chick embryos
suggested Ets1 is initially expressed in the endocardium and
epicardium at Hamburger and Hamilton stage 16, with increased
expression in areas of endothelial-to-mesenchymal transformation
in the endocardium, the epicardium and the subepicardial matrix by
stage 33 (Macias et al., 1998). To examine the pattern of expression
of Ets1 in mouse embryos during these stages of heart development,
we performed in situ hybridization using an Ets1-specific probe on
sections of mouse embryos from E10.5 to E14.5 (Fig. 3). Consistent
with observations in the chick heart, Ets1 expression in the murine
heart was detected in the developing endocardial cushions of the
Table 2. Frequency of cardiac defects in Ets1–/– embryos
Cardiac defect
Peri-aortic cartilage
Membranous VSD
Atrial septal defect
Muscular VSD
Dilated atria
Thin ventricular wall
VSD, ventricular septal defect.
n (%)
12/12 (100%)
11/12 (92%)
8/12 (67%)
6/12 (50%)
5/12 (42%)
3/12 (25%)
DEVELOPMENT
backcrossed this line to C57BL/6 mice for eight generations. We
then intercrossed these Ets1 heterozygous mice and genotyped 99
offspring at weaning (Table 1). We found a nearly complete
absence of Ets1–/– offspring at weaning with only one Ets1–/–
mouse identified, consistent with previous reports of a perinatal
lethality. To determine the timing of lethality of the Ets1–/– mice,
we sacrificed and then genotyped embryos and neonatal pups of
Ets1 heterozygous crosses. Embryos from E14.5 to E18.5 were
present in nearly the expected Mendelian ratio (Table 1). The
genotypes of pups harvested on the day of birth also appeared to
be in a nearly Mendelian ratio. However, by postnatal day 3, no
Ets1–/– pups were found in the 33 harvested, suggesting that
nearly all of the Ets1-deficient mice were dying within the first 72
hours after birth.
Fig. 2. Cartilage forms between E14.5 and E16.5 in the peri-aortic
region of Ets1-deficient hearts. (A-F) Transverse sections of wild-type
(left) and Ets1–/– (right) mouse embryos at E14.5 (A,B), E16.5 (C,D) and
E18.5 (E,F) stained with Alcian Blue and Neutral Red. Arrows indicate
positive Alcian Blue staining within the hearts of Ets1–/– mice.
outflow tract at E10.5 (Fig. 3D), a time at which the migration of
cardiac neural crest into the outflow tract endocardial cushions has
begun. At E12.5, high-level expression of Ets1 was localized to the
epicardium and to the endocardium overlying the endocardial
cushions (Fig. 3E, arrow). Notably, Ets1 expression was not detected
in the myocardium at this time in development. At E14.5, a similar
expression pattern was observed. Of note, Ets1 was highly expressed
at the junctions between the endocardial cushions that fuse to form
the membranous interventricular septum (Fig. 3F, arrow).
Given that cells derived from the cardiac neural crest are known
to contribute to the endocardial cushions during early cardiac
development (Stoller and Epstein, 2005), we wanted to determine
whether Ets1 was expressed in this cell population. To address this
question, we performed immunofluorescence using antibodies
specific to b-galactosidase and Ets1 on sections of outflow tract
endocardial cushions from E12.5 ROSA-26RlacZ; Wnt1-Cre+
transgenic embryos. In these embryos, cells derived from the neural
crest lineage are genetically marked by b-galactosidase expression
(Jiang et al., 2000). Consistent with our in situ hybridization data
shown in Fig. 3E, immunofluorescence using an anti-Ets1 antibody
revealed expression in the endocardium overlying the endocardial
cushions (Fig. 3G). In addition, a fraction of mesenchymal cells
within the cushion were also positive for Ets1 expression and these
cells also expressed b-galactosidase (Fig. 3H,I), demonstrating their
neural crest origin. Taken together, these results establish that Ets1
is expressed in the endocardium and in neural crest-derived cells of
the endocardial cushions at the precise time in development at which
to play a role in the maturation of the outflow tract and the
membranous ventricular septum.
Sox9, aggrecan and CLP are upregulated in Ets1deficient hearts
As an approach towards understanding the molecular basis for the
morphological defects seen in the hearts of the Ets1–/– mice, we used
quantitative RT-PCR to screen candidate genes for altered levels of
Development 137 (9)
Fig. 3. Ets1 is expressed in the developing mouse heart. In situ
hybridization was performed on transverse sections of wild-type mouse
embryos at E10.5 (A,D), E12.5 (B,E) and E14.5 (C,F) with sense (A-C)
and antisense (D-F) 35S-labeled riboprobes specific to Ets1. Expression is
indicated by the intensity of white staining. All sections were
counterstained with DAPI to show nuclei (blue). Arrows in D and E
indicate expression of Ets1 in the endocardial cushions; arrow in F
indicates expression of Ets1 and the junction between the endocardial
cushion and the interventricular septum. (G-I) Immunofluorescence of a
section of E12.5 embryonic heart stained with anti-Ets1 (green, G) and
anti-b-galactosidase (red, H) antibodies. (I) Merged image; arrows
indicate double-positive cells. The section was counterstained with DAPI
to show nuclei (blue). Ao, aorta; EC, endocardial cushion; LV, left
ventricle; OFT, outflow tract; RA, right atrium; RV, right ventricle.
expression (Table 3). We chose genes known to be important
regulators of endothelial-to-mesenchymal transformation during
endocardial cushion development (Meox1, Msx2, Smad6, Snail,
Gata4), genes known to regulate neural crest whose deficiency leads
to ventricular septal defects (Sox4, Adam19, Gata6, Pdgfra), or
genes known to be involved in cartilage development (Sox9, Sox5,
Sox6, CLP, aggrecan) (Komatsu et al., 2007; Morrison-Graham et
al., 1992; Schilham et al., 1996; Tullio et al., 1997; Ya et al., 1998).
In Ets1–/– hearts, we found no difference in expression of genes
involved in the regulation of endothelial-to-mesenchymal
transformation, but did observe that genes involved in the migration
and differentiation of cardiac neural crest (i.e. Gata6 and Sox4) were
modestly, yet significantly, downregulated. However, Pax3, a
crucial marker of the neural crest, was still highly expressed in the
neural tube of E12.5 Ets1–/– embryos (see Fig. S3 in the
supplementary material). We also found statistically significant
increases in CLP, aggrecan, and Sox9, a transcription factor that is
crucial for the formation of chondrocytes (Akiyama et al., 2005).
Because our histological analysis of the Ets1-deficient mice
suggested the presence of an abnormal focus of cartilage in the periaortic region within the heart, we hypothesized that this increase in
Sox9, aggrecan and CLP expression was due to local, high-level
expression within this area. To confirm this, we performed in situ
hybridization using probes specific to Sox9 and CLP on sections of
E16.5 hearts (Fig. 4). Sox9 was expressed in a similar fashion in the
lung and bronchial cartilage in both wild-type and Ets1–/– mice (data
DEVELOPMENT
1546 RESEARCH ARTICLE
Ets1 and the cardiac neural crest
RESEARCH ARTICLE 1547
Table 3. Quantitative RT-PCR gene expression analysis in
Ets1–/– hearts
Gene
Meox1
Msx2
Smad6
Snail
Notch1
Gata4
FOG-2
Sox4
Gata6
Adam19
Pdgfra
Cx43
Sox9
Sox5
Sox6
CLP
Aggrecan
Mean ± s.e.m.
1.09±0.07
1.16±0.10
1.18±0.13
0.97±0.04
0.96±0.06
0.84±0.14
0.86±0.12
0.75±0.07*
0.80±0.02*
0.93±0.09
0.82±0.08
0.93±0.08
1.27±0.10*
1.11±0.10
1.33±0.32
1.88±0.21*
3.34±0.36*
Results are expressed as the ratio of mutant to wild-type expression levels and are
normalized to the level of Gapdh expression.
Asterisks indicate statistical significance (P<0.05).
Cells of the neural crest lineage give rise to the
abnormal focus of intra-cardiac cartilage
In order to gain further insight into the mechanism leading to the
formation of the intra-cardiac cartilage observed in the Ets1–/– mice,
we next sought to determine the cellular origin of this cartilage. As
the outflow tract endocardial cushions contain cells derived from
both the endocardium, through endocardial-to-mesenchymal
transformation (EMT), and the cardiac neural crest, we undertook
lineage-tracing experiments using genetic markers of either the
endocardium or cardiac neural crest lineages. In our first series of
experiments, we used transgenic expression of Cre recombinase
driven by the Tie2 promoter (Tie2-Cre) to mark cells derived from
the endocardium. We bred Ets1+/– mice with the Cre reporter line
ROSA-26RlacZ to generate Ets1+/–; ROSA-26RlacZ/lacZ mice. These
mice were then crossed with Ets1+/–; Tie2-Cre+ to yield Ets1–/–;
ROSA-26RlacZ; Tie2-Cre+ pups. These pups were harvested at birth,
their hearts sectioned and then stained for b-galactosidase
expression (Fig. 5). In these sections, cells that are derived from the
endocardium or endothelial cells will stain blue. As expected, the
endocardium and many of the cells within the developing valve
stained positively for b-galactosidase expression. However, the
abnormal focus of peri-aortic cartilage did not, demonstrating that
these cells are not derived from the endocardium through
endothelial-to-mesenchymal transformation (Fig. 5B, arrow). To
Fig. 4. Sox9, Sox5 and CLP are expressed in the peri-aortic region
of Ets1–/– hearts. (A-H) In situ hybridization was performed on
transverse sections of E16.5 wild-type (left) and Ets1–/– (right) embryos
using 35S-labeled riboprobes against Sox9 (A,B), Sox5 (C,D), CLP (E,F)
and elastin (G,H) as indicated. Arrowheads in right panels indicate the
location of the abnormal peri-aortic tissue in the Ets1–/– mice. Ao, aorta.
assess whether this focus of cartilage is derived from the cardiac
neural crest, we used transgenic expression of Cre recombinase
driven by the Wnt1 promoter (Wnt1-Cre) to mark cells derived from
the neural crest. We crossed the Ets1+/–; ROSA-26RlacZ/lacZ mice with
Ets1+/–; Wnt1-Cre+ mice to generate Ets1–/–; ROSA-26RlacZ; Wnt1Cre+ pups. When hearts from these mice were stained for bgalactosidase expression, we observed blue cells within the wall of
the aorta, as well as in the peri-aortic mesenchyme. Importantly, all
of the cells in the ectopic focus of cartilage were blue (Fig. 5D,
arrow), indicating that this cartilage was derived from cells of the
neural crest lineage.
Neural crest migration defects in Ets1–/– mice
Neural crest cells are known to migrate into both the distal and
proximal regions of the outflow tract endocardial cushions (Jiang
et al., 2000; Waldo et al., 1998), where they are thought to direct
the fusion of the opposing endocardial cushions in the outflow
tract. Failure of fusion of the conal endocardial cushions with the
superior atrioventricular cushion will result in a membranous
ventricular septal defect. Failure of complete migration of the
cardiac neural crest has been described in mice with a neural
crest-specific deletion of Gata6 (Lepore et al., 2006), a gene that
is significantly downregulated in the Ets1–/– mice (Table 3). Thus,
we hypothesized that neural crest migration might be perturbed in
Ets1–/– mice, resulting in a ventricular septal defect. Our first
indication that neural crest cells might be perturbed was provided
DEVELOPMENT
not shown). However, we also found high-level expression of Sox9
in the focus of aberrant cartilage in Ets1–/– hearts. Expression of CLP
gave a similar pattern (Fig. 4F, arrowhead). We also examined the
expression of Sox5, another crucial transcriptional regulator in
chondrocytes. As with Sox9 and CLP, Sox5 was also expressed in
this structure (Fig. 4D, arrowhead). Finally, we examined the
expression of elastin, a gene that is highly expressed in the wall of
the aorta and in the developing heart valves. We found that this
abnormal peri-aortic structure did not express elastin (Fig. 4H,
arrowhead). Together with the histological analysis shown in Fig. 1,
these results confirm that this aberrant tissue within the peri-aortic
region of the heart is indeed cartilage. Furthermore, this tissue
appears to be distinct from that of the wall of the aorta and the aortic
valve, given its lack of elastin expression.
1548 RESEARCH ARTICLE
Development 137 (9)
Fig. 5. Neural crest origin of the peri-aortic cartilage in Ets1–/–
hearts. (A-D) Serial sections of hearts from Ets1–/–;Tie2-Cre+;ROSA26RlacZ mice (A,B) or Ets1–/–;Wnt1-Cre+;ROSA-26RlacZ mice (C,D) stained
with Alcian Blue (A,C) or X-gal to detect b-galactosidase (blue; B,D).
The location of the peri-aortic cartilage is outlined in B and indicated by
arrows in each panel. Ao, aorta.
Inhibition of MEK activity results in cardiac
cartilage formation
As a final step in our characterization of the aberrant cartilage found
in Ets1-deficient hearts, we sought to place Ets1 within the
molecular pathways regulating chondrocyte differentiation. Sox9 is
Fig. 6. Attenuated neural crest cell migration in Ets1-deficient
mice. (A) Photograph of 8-week old wild-type (right), Ets1+/– (middle)
and Ets1–/– (left) mice, demonstrating a large ventral white patch in the
Ets1–/– mouse and a small ventral white spot in the Ets1+/– mouse.
(B-E) Sections of E13.0 Wnt1-Cre+;ROSA-26RlacZ (left) or Ets1–/–;Wnt1Cre+;ROSA-26RlacZ (right) mice stained for b-galactosidase expression
(blue) at the level of the distal (B,C) and proximal (D,E) outflow tract.
Arrows in D indicate b-galactosidase-positive cells in the developing
interventricular septum. Ao, aorta; EC, endocardial cushion.
a crucial regulator of this process (Kawamura and Urist, 1988),
whereas FGF signaling through the MEK/ERK pathway has been
shown to inhibit cartilage formation (Bobick and Kulyk, 2004). It is
also well established that ERK can directly phosphorylate Ets1 and
increase its transcriptional activity on target promoters (Brent and
Tabin, 2004). Therefore, we speculated that MEK and ERK might
function upstream of Ets1 to block cartilage formation during the
differentiation of neural crest within the endocardial cushions. If this
were the case, inhibiting MEK activity within the developing heart
would lead to the loss of activated Ets1 and the formation of aberrant
cartilage, similar to that seen in Ets1-deficient mice. To test this
notion, we harvested wild-type E13.5 hearts and cultured them in
the absence or presence of the MEK inhibitor U0126 for 72 hours.
Western analysis of heart lysates revealed that ERK phosphorylation
was blocked 85.5±2.5% by treatment with U0126 (Fig. 7A). A
second preparation of cultured hearts was fixed, sectioned, and
stained for cartilage using Alcian Blue. As seen in Fig. 7B, hearts
treated with vehicle alone showed no evidence for cartilage
formation, whereas hearts cultured in the presence of U0126
developed a focus of Alcian Blue-positive staining near the aorta,
indicative of cartilage formation (n=3/3). Quantitative RT-PCR was
performed on similarly cultured hearts and demonstrated a 56±4%
induction of Sox9 expression (P=0.006) and a 2.9±0.4-fold
induction of aggrecan (P=0.005, Fig. 7C), further supporting the
observation that cartilage forms in these MEK-inhibited hearts.
DEVELOPMENT
by visual inspection of our only Ets1–/– mouse to survive to
adulthood (Fig. 6A). In addition to this mouse being growth
retarded, it also had a large patch of white fur on its ventral aspect,
reminiscent of the pigmentation defects seen in splotch mice
(Epstein et al., 2000). In addition, a careful inspection of Ets1
heterozygotes revealed that they were slightly smaller than their
wild-type littermates (see Fig. S1B,C in the supplementary
material) and that approximately 60% of them also had a small
ventral pigmentation defect. As the pigmentation defects seen in
the splotch mice are known to be due to defects in the neural crest,
this observation suggested that the neural crest in Ets1–/– mice
might be perturbed.
To examine the migration of cardiac neural crest cells in the Ets1deficient mice, we harvested Ets1–/–; ROSA-26RlacZ; Wnt1-Cre+
embryos at E13 and stained sections of both the distal and proximal
outflow tract of these embryos for b-galactosidase expression to
highlight cells of neural crest origin (Fig. 6B-E). As the transcription
factor Sox10 is also known to mark cells of the neural crest lineage
(Hong and Saint-Jeannet, 2005), immunofluorescence using
antibodies to Sox10 further confirmed that these b-galactosidasepositive cells were of neural crest origin (see Fig. S4 in the
supplementary material). Consistent with previous reports, we
observed cardiac neural crest cells in wild-type embryos in the distal
and proximal portions of the outflow tract endocardial cushions (Fig.
6B,D, arrows). In the Ets1–/– hearts, cells of the cardiac neural crest
lineage were present in the distal portion of the outflow tract (Fig.
6C), although there appeared to be less cells of the cardiac neural
crest contributing to the aortic valve leaflets. In the proximal outflow
tract, where the conal endocardial cushions, the muscular ventricular
septum and the superior atrioventricular cushion converge, there was
a complete absence of cardiac neural crest cells in the Ets1–/– heart
(Fig. 6E), suggesting that their migration to this region was
disrupted.
Fig. 7. The MEK inhibitor U0126 induces cartilage formation in
cultured embryonic hearts. Wild-type E13.5 mouse hearts were
cultured in the absence or presence of the MEK inhibitor U0126 for
72 hours. (A) Western analysis of heart lysates from four independent
hearts (a-d) cultured in the presence of DMSO (left) or U0126 (right)
using an antibody to phospho-Erk1/2 (top) or total Erk1/2 (bottom).
(B) Cultured hearts were sectioned and stained with Alcian Blue and
Neutral Red to detect cartilage formation (arrow in right panel).
(C) Quantitative RT-PCR to determine relative Sox9 and aggrecan
expression in vehicle-treated and U0126-treated heart organ cultures
(n=3). (D) Proposed molecular pathway modulating cardiac neural crest
cell migration and differentiation.
Taken together, these results suggest that Ets1 is downstream of
MEK signaling and functions to block the differentiation of neural
crest cells into chondrocytes.
DISCUSSION
In this report, we describe the cardiac defects present in Ets1deficient mice. These mice have an abnormal focus of peri-aortic
cartilage derived from cells of the cardiac neural crest. In addition,
they have a membranous ventricular septal defect due to the failure
of fusion of the outflow tract cushions below the level of the
semilunar valves, which is likely to be secondary to a subtle
migration defect of the cardiac neural crest. The ventricular septal
defect probably contributed to the death of the Ets1–/– pups shortly
after birth. As has been reported for other mouse models of
congenital heart disease, the penetrance of this phenotype is
dependent on the genetic background of the mice. On a mixed
129/SVJ and C57BL/6 background, the incidence of perinatal
lethality was less than 50%, but on a nearly pure C57BL/6
background, the penetrance of this perinatal lethality approached
100%. This observation suggests the presence of a modifier gene(s)
present in the 129SVJ background that can compensate for the loss
of Ets1 and allow the animals to survive to adulthood.
RESEARCH ARTICLE 1549
The defects seen in Ets1-deficient mice are similar to some of
the cardiac developmental abnormalities observed in chick
embryos in which both Ets1 and Ets2 expression was reduced
using a retroviral-mediated antisense strategy (Lie-Venema et al.,
2003). In these treated chick embryos, 25% had sub-aortic
ventricular septal defects similar those described in this report.
The lower incidence of these septal defects in the chick system as
compared with our results might be due to the difficulty in
achieving complete loss of Ets expression in vivo using an
antisense strategy. The presence of an ectopic focus of cartilage
was also not reported in this system, perhaps because the chick
embryos did not survive long enough to allow the development of
the cartilage in the peri-aortic region.
Targeted disruption of many different genes in mice has
resulted in mutants with ventricular septal defects. Some of these
genes appear to function in cardiomyocytes to promote the
development of the endocardial cushion tissue (e.g. Hey2,
Myh10), whereas others are expressed specifically within cells of
the endocardial cushions (Sakata et al., 2002; Tullio et al., 1997).
Genes expressed within the endocardial cushions can affect
endothelial-to-mesenchymal transformation (e.g. Sox9, Nf1,
Gata4), while others affect the function of the cardiac neural crest
(e.g. Pax3, Adam19 or Gata6) (Akiyama et al., 2004; Epstein et
al., 2000; Gitler et al., 2003; Komatsu et al., 2007; Lepore et al.,
2006; Rivera-Feliciano et al., 2006). In order to properly remodel
the outflow tract, neural crest cells must first migrate to the
correct positions within the conotruncal cushions (Waldo et al.,
1998). The neural crest cells within the most proximal part of the
conal cushions are believed to direct the fusion of this cushion
with the superior atrioventricular cushion. Failure of fusion leads
to a membranous ventricular septal defect, as seen in the Ets1deficient mice. This fusion failure is similar to that observed in
Adam19-deficient mice (Komatsu et al., 2007). However, in those
embryos, the neural crest migrated to the correct position within
the conal cushions, but failed to promote fusion. In the Ets1–/–
mice, the neural crest cells failed to complete migration to the
most proximal aspect of the cushions and were therefore unable
to direct cushion fusion. The fur pigmentation defect observed in
the Ets1–/– mice (Fig. 6A) is also consistent with a defect in neural
crest cell migration, as melanocytes are also derived from
migratory cells of the neural crest lineage (Crane and Trainor,
2006). Importantly, the remodeling of the rest of the outflow tract
occurred normally in Ets1-deficient mice, consistent with our
observation that the neural crest cells were present in the distal
outflow tract to direct this remodeling.
What was the fate of the neural crest cells that failed to migrate to
the proximal outflow tract endocardial cushions? We propose that
these neural crest cells differentiated into the nodule of cartilage seen
in the peri-aortic area of the Ets1–/– mice. The results of our lineagetracing experiments shown in Fig. 6 demonstrate that this cartilage
nodule is derived from neural crest. Therefore, we feel it is plausible
that these chondrocytes are derived from those neural crest cells that
should have migrated to the developing interventricular septum and
directed fusion of the endocardial cushions during the later stages of
heart development. However, we cannot rule out the possibility that
the neural crest cells that formed the cartilage nodule in the Ets1–/–
mice were derived from a population of neural crest not destined for
the membraneous ventricular septum.
It is clear that normal neural crest cells have the potential to
differentiate into chondrocytes, as shown during jaw development
and by chick-quail chimera studies (Chai et al., 2000; Kirby, 1989).
The results reported here suggest that Ets1 functions to block the
DEVELOPMENT
Ets1 and the cardiac neural crest
differentiation of cardiac neural crest into cartilage. Consistent with
this notion, Ets1 has been previously shown not to be expressed in
cartilage (Dhordain et al., 1995). Moreover, we would also suggest
that MEK and ERK are directly upstream of Ets1 in this pathway,
given that Ets1 is a known target of ERK-mediated signaling and
that the MEK/ERK pathway is a negative regulator of chondrocyte
differentiation (Bobick and Kulyk, 2004; Paumelle et al., 2002;
Yang et al., 1996). This hypothesis is supported by our results
showing the formation of cartilage within hearts treated with the
MEK inhibitor U0126 (Fig. 7). Taken together, these observations
suggest a molecular pathway of MEK, ERK and Ets1 that blocks the
development of chondrocytes from cells of the neural crest lineage
(Fig. 7D).
Interestingly, an intra-cardiac focus of cartilage has also been
reported in transgenic mice expressing a dominant-negative form of
Cx43 (Sullivan et al., 1998). Similar to the cartilage seen in the
Ets1–/– mice, the cartilage seen in these mice was localized near to
the semilunar valves and was suggested to be due to the disruption
of Cx43 function in the cardiac neural crest. Moreover, Cx43 has
also been shown to activate the MEK/ERK pathway (Plotkin et al.,
2002; Stains and Civitelli, 2005). Thus, it is possible that in the
neural crest, Cx43 signals to Ets1 via the MEK/ERK pathway to
block the formation of chondrocytes during the neural crest-directed
remodeling of the cardiac outflow tract. However, other activators
of MEK might also be important in the activation of this pathway.
Finally, although we and others have demonstrated that Ets1 is
expressed in neural crest (Kola et al., 1993), it is also expressed in
other cell types within the developing heart (see Fig. 3). Given this,
we cannot currently distinguish whether Ets1 plays a cell
autonomous or a non-cell autonomous role in regulating the
migration and/or differentiation of the cardiac neural crest. The
answer to this question must await the generation of a mouse line
with the Ets1 gene specifically ablated in cells of the neural crest.
Acknowledgements
We thank Dr Kevin Barton for providing the Ets1-deficient mice, Dr Akira
Imamoto for providing the Wnt1-Cre mice, Dr Jonathan Epstein for providing
the Pax3 in situ probe, Dr Debroah Lang for providing the Sox10 antibody, and
Dr Andy Wessels for his insightful discussions. This work was supported by NIH
grant R01-HL071063 (to E.C.S.) and a post-doctoral fellowship from the
American Heart Association (to Z.G.). Deposited in PMC for release after 12
months.
Competing interests statement
The authors declare no competing financial interests.
Supplementary material
Supplementary material for this article is available at
http://dev.biologists.org/lookup/suppl/doi:10.1242/dev.047696/-/DC1
References
Akiyama, H., Chaboissier, M. C., Behringer, R. R., Rowitch, D. H., Schedl, A.,
Epstein, J. A. and de Crombrugghe, B. (2004). Essential role of Sox9 in the
pathway that controls formation of cardiac valves and septa. Proc. Natl. Acad.
Sci. USA 101, 6502-6507.
Akiyama, H., Kim, J. E., Nakashima, K., Balmes, G., Iwai, N., Deng, J. M.,
Zhang, Z., Martin, J. F., Behringer, R. R., Nakamura, T. et al. (2005). Osteochondroprogenitor cells are derived from Sox9 expressing precursors. Proc. Natl.
Acad. Sci. USA 102, 14665-14670.
Alvarez, A. D., Shi, W., Wilson, B. A. and Skeath, J. B. (2003). pannier and
pointedP2 act sequentially to regulate Drosophila heart development.
Development 130, 3015-3026.
Barton, K., Muthusamy, N., Fischer, C., Ting, C. N., Walunas, T. L., Lanier, L. L.
and Leiden, J. M. (1998). The Ets-1 transcription factor is required for the
development of natural killer cells in mice. Immunity 9, 555-563.
Bobick, B. E. and Kulyk, W. M. (2004). The MEK-ERK signaling pathway is a
negative regulator of cartilage-specific gene expression in embryonic limb
mesenchyme. J. Biol. Chem. 279, 4588-4595.
Development 137 (9)
Bories, J. C., Willerford, D. M., Grevin, D., Davidson, L., Camus, A., Martin,
P., Stehelin, D. and Alt, F. W. (1995). Increased T-cell apoptosis and terminal Bcell differentiation induced by inactivation of the Ets-1 proto-oncogene. Nature
377, 635-638.
Brent, A. E. and Tabin, C. J. (2004). FGF acts directly on the somitic tendon
progenitors through the Ets transcription factors Pea3 and Erm to regulate
scleraxis expression. Development 131, 3885-3896.
Chai, Y., Jiang, X., Ito, Y., Bringas, P., Jr, Han, J., Rowitch, D. H., Soriano, P.,
McMahon, A. P. and Sucov, H. M. (2000). Fate of the mammalian cranial
neural crest during tooth and mandibular morphogenesis. Development 127,
1671-1679.
Clements, J. L., John, S. A. and Garrett-Sinha, L. A. (2006). Impaired generation
of CD8+ thymocytes in Ets-1-deficient mice. J. Immunol. 177, 905-912.
Crane, J. F. and Trainor, P. A. (2006). Neural crest stem and progenitor cells.
Annu. Rev. Cell Dev. Biol. 22, 267-286.
Davidson, B., Shi, W., Beh, J., Christiaen, L. and Levine, M. (2006). FGF
signaling delineates the cardiac progenitor field in the simple chordate, Ciona
intestinalis. Genes Dev. 20, 2728-2738.
Dhordain, P., Dewitte, F., Desbiens, X., Stehelin, D. and DuterqueCoquillaud, M. (1995). Mesodermal expression of the chicken erg gene
associated with precartilaginous condensation and cartilage differentiation.
Mech. Dev. 50, 17-28.
Epstein, J. A., Li, J., Lang, D., Chen, F., Brown, C. B., Jin, F., Lu, M. M.,
Thomas, M., Liu, E., Wessels, A. et al. (2000). Migration of cardiac neural
crest cells in Splotch embryos. Development 127, 1869-1878.
Eyquem, S., Chemin, K., Fasseu, M. and Bories, J. C. (2004a). The Ets-1
transcription factor is required for complete pre-T cell receptor function and
allelic exclusion at the T cell receptor beta locus. Proc. Natl. Acad. Sci. USA 101,
15712-15717.
Eyquem, S., Chemin, K., Fasseu, M., Chopin, M., Sigaux, F., Cumano, A. and
Bories, J. C. (2004b). The development of early and mature B cells is impaired in
mice deficient for the Ets-1 transcription factor. Eur. J. Immunol. 34, 3187-3196.
Flagg, A. E., Earley, J. U. and Svensson, E. C. (2007). FOG-2 attenuates
endothelial-to-mesenchymal transformation in the endocardial cushions of the
developing heart. Dev. Biol. 304, 308-316.
Gitler, A. D., Zhu, Y., Ismat, F. A., Lu, M. M., Yamauchi, Y., Parada, L. F. and
Epstein, J. A. (2003). Nf1 has an essential role in endothelial cells. Nat. Genet.
33, 75-79.
Higuchi, T., Bartel, F. O., Masuya, M., Deguchi, T., Henderson, K. W., Li, R.,
Muise-Helmericks, R. C., Kern, M. J., Watson, D. K. and Spyropoulos, D. D.
(2007). Thymomegaly, microsplenia, and defective homeostatic proliferation of
peripheral lymphocytes in p51-Ets1 isoform-specific null mice. Mol. Cell. Biol. 27,
3353-3366.
Hong, C. S. and Saint-Jeannet, J. P. (2005). Sox proteins and neural crest
development. Semin. Cell Dev. Biol. 16, 694-703.
Jiang, X., Rowitch, D. H., Soriano, P., McMahon, A. P. and Sucov, H. M. (2000).
Fate of the mammalian cardiac neural crest. Development 127, 1607-1616.
Kawamura, M. and Urist, M. R. (1988). Growth factors, mitogens, cytokines,
and bone morphogenetic protein in induced chondrogenesis in tissue culture.
Dev. Biol. 130, 435-442.
Kirby, M. L. (1989). Plasticity and predetermination of mesencephalic and trunk
neural crest transplanted into the region of the cardiac neural crest. Dev. Biol.
134, 402-412.
Kola, I., Brookes, S., Green, A. R., Garber, R., Tymms, M., Papas, T. S. and
Seth, A. (1993). The Ets1 transcription factor is widely expressed during murine
embryo development and is associated with mesodermal cells involved in
morphogenetic processes such as organ formation. Proc. Natl. Acad. Sci. USA
90, 7588-7592.
Komatsu, K., Wakatsuki, S., Yamada, S., Yamamura, K., Miyazaki, J. and
Sehara-Fujisawa, A. (2007). Meltrin beta expressed in cardiac neural crest cells
is required for ventricular septum formation of the heart. Dev. Biol. 303, 82-92.
Lavine, K. J., White, A. C., Park, C., Smith, C. S., Choi, K., Long, F., Hui, C. C.
and Ornitz, D. M. (2006). Fibroblast growth factor signals regulate a wave of
Hedgehog activation that is essential for coronary vascular development. Genes
Dev. 20, 1651-1666.
Lepore, J. J., Mericko, P. A., Cheng, L., Lu, M. M., Morrisey, E. E. and
Parmacek, M. S. (2006). GATA-6 regulates semaphorin 3C and is required in
cardiac neural crest for cardiovascular morphogenesis. J. Clin. Invest. 116, 929939.
Lie-Venema, H., Gittenberger-de, Groot, A. C., van Empel, L. J., Boot, M. J.,
Kerkdijk, H., de Kant, E. and DeRuiter, M. C. (2003). Ets-1 and Ets-2
transcription factors are essential for normal coronary and myocardial
development in chicken embryos. Circ. Res. 92, 749-756.
Macias, D., Perez-Pomares, J. M., Garcia-Garrido, L., Carmona, R. and
Munoz-Chapuli, R. (1998). Immunoreactivity of the ets-1 transcription factor
correlates with areas of epithelial-mesenchymal transition in the developing
avian heart. Anat. Embryol. (Berl.) 198, 307-315.
Maroulakou, I. G., Papas, T. S. and Green, J. E. (1994). Differential expression of
ets-1 and ets-2 proto-oncogenes during murine embryogenesis. Oncogene 9,
1551-1565.
DEVELOPMENT
1550 RESEARCH ARTICLE
Milewski, R. C., Chi, N. C., Li, J., Brown, C., Lu, M. M. and Epstein, J. A.
(2004). Identification of minimal enhancer elements sufficient for Pax3
expression in neural crest and implication of Tead2 as a regulator of Pax3.
Development 131, 829-837.
Morrison-Graham, K., Schatteman, G. C., Bork, T., Bowen-Pope, D. F. and
Weston, J. A. (1992). A PDGF receptor mutation in the mouse (Patch) perturbs
the development of a non-neuronal subset of neural crest-derived cells.
Development 115, 133-142.
Oikawa, T. and Yamada, T. (2003). Molecular biology of the Ets family of
transcription factors. Gene 303, 11-34.
Paumelle, R., Tulasne, D., Kherrouche, Z., Plaza, S., Leroy, C., Reveneau, S.,
Vandenbunder, B. and Fafeur, V. (2002). Hepatocyte growth factor/scatter
factor activates the ETS1 transcription factor by a RAS-RAF-MEK-ERK signaling
pathway. Oncogene 21, 2309-2019.
Plotkin, L. I., Manolagas, S. C. and Bellido, T. (2002). Transduction of cell
survival signals by connexin-43 hemichannels. J. Biol. Chem. 277, 8648-8657.
Rivera-Feliciano, J., Lee, K. H., Kong, S. W., Rajagopal, S., Ma, Q., Springer,
Z., Izumo, S., Tabin, C. J. and Pu, W. T. (2006). Development of heart valves
requires Gata4 expression in endothelial-derived cells. Development 133, 36073618.
Sakata, Y., Kamei, C. N., Nakagami, H., Bronson, R., Liao, J. K. and Chin, M.
T. (2002). Ventricular septal defect and cardiomyopathy in mice lacking the
transcription factor CHF1/Hey2. Proc. Natl. Acad. Sci. USA 99, 16197-16202.
Schilham, M. W., Oosterwegel, M. A., Moerer, P., Ya, J., de Boer, P. A., van
de Wetering, M., Verbeek, S., Lamers, W. H., Kruisbeek, A. M., Cumano,
A. et al. (1996). Defects in cardiac outflow tract formation and pro-Blymphocyte expansion in mice lacking Sox-4. Nature 380, 711-714.
Stains, J. P. and Civitelli, R. (2005). Gap junctions regulate extracellular signalregulated kinase signaling to affect gene transcription. Mol. Biol. Cell 16, 6472.
RESEARCH ARTICLE 1551
Stoller, J. Z. and Epstein, J. A. (2005). Cardiac neural crest. Semin. Cell Dev. Biol.
16, 704-715.
Sullivan, R., Huang, G. Y., Meyer, R. A., Wessels, A., Linask, K. K. and Lo, C.
W. (1998). Heart malformations in transgenic mice exhibiting dominant negative
inhibition of gap junctional communication in neural crest cells. Dev. Biol. 204,
224-234.
Tichopad, A., Dilger, M., Schwarz, G. and Pfaffl, M. W. (2003). Standardized
determination of real-time PCR efficiency from a single reaction set-up. Nucleic
Acids Res. 31, e122.
Tullio, A. N., Accili, D., Ferrans, V. J., Yu, Z. X., Takeda, K., Grinberg, A.,
Westphal, H., Preston, Y. A. and Adelstein, R. S. (1997). Nonmuscle myosin
II-B is required for normal development of the mouse heart. Proc. Natl. Acad.
Sci. USA 94, 12407-12412.
Waldo, K., Miyagawa-Tomita, S., Kumiski, D. and Kirby, M. L. (1998). Cardiac
neural crest cells provide new insight into septation of the cardiac outflow tract:
aortic sac to ventricular septal closure. Dev. Biol. 196, 129-144.
Wang, D., John, S. A., Clements, J. L., Percy, D. H., Barton, K. P. and GarrettSinha, L. A. (2005). Ets-1 deficiency leads to altered B cell differentiation,
hyperresponsiveness to TLR9 and autoimmune disease. Int. Immunol. 17, 11791191.
Ya, J., Schilham, M. W., de Boer, P. A., Moorman, A. F., Clevers, H. and
Lamers, W. H. (1998). Sox4-deficiency syndrome in mice is an animal model for
common trunk. Circ. Res. 83, 986-994.
Yang, B. S., Hauser, C. A., Henkel, G., Colman, M. S., Van Beveren, C., Stacey,
K. J., Hume, D. A., Maki, R. A. and Ostrowski, M. C. (1996). Ras-mediated
phosphorylation of a conserved threonine residue enhances the transactivation
activities of c-Ets1 and c-Ets2. Mol. Cell. Biol. 16, 538-547.
Zhan, Y., Brown, C., Maynard, E., Anshelevich, A., Ni, W., Ho, I. C. and
Oettgen, P. (2005). Ets-1 is a critical regulator of Ang II-mediated vascular
inflammation and remodeling. J. Clin. Invest. 115, 2508-2516.
DEVELOPMENT
Ets1 and the cardiac neural crest