Download Novel Regulation of Cardiac Metabolism and Homeostasis by the

Novel Regulation of Cardiac Metabolism and
Homeostasis by the Adrenomedullin-Receptor
Activity-Modifying Protein 2 System
Takahiro Yoshizawa, Takayuki Sakurai, Akiko Kamiyoshi, Yuka Ichikawa-Shindo, Hisaka Kawate,
Yasuhiro Iesato, Teruhide Koyama, Ryuichi Uetake, Lei Yang, Akihiro Yamauchi, Megumu Tanaka,
Yuichi Toriyama, Kyoko Igarashi, Tsutomu Nakada, Toshihide Kashihara, Mitsuhiko Yamada,
Hayato Kawakami, Hiroki Nakanishi, Ryo Taguchi, Tsuyoshi Nakanishi, Hiroshi Akazawa, Takayuki Shindo
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Abstract—Adrenomedullin (AM) was identified as a vasodilating and hypotensive peptide mainly produced by the
cardiovascular system. The AM receptor calcitonin receptor-like receptor associates with receptor activity-modifying
protein (RAMP), one of the subtypes of regulatory proteins. Among knockout mice (−/−) of RAMPs, only RAMP2−/− is
embryonically lethal with cardiovascular abnormalities that are the same as AM−/−. This suggests that the AM-RAMP2
system is particularly important for the cardiovascular system. Although AM and RAMP2 are highly expressed in the
heart from embryo to adulthood, their analysis has been limited by the embryonic lethality of AM−/− and RAMP2−/−. For
this study, we generated inducible cardiac myocyte-specific RAMP2−/− (C-RAMP2−/−). C-RAMP2−/− exhibited dilated
cardiomyopathy-like heart failure with cardiac dilatation and myofibril disruption. C-RAMP2−/− hearts also showed changes
in mitochondrial structure and downregulation of mitochondria-related genes involved in oxidative phosphorylation, βoxidation, and reactive oxygen species regulation. Furthermore, the heart failure was preceded by changes in peroxisome
proliferator-activated receptor-γ coactivator 1α (PGC-1α), a master regulator of mitochondrial biogenesis. Metabolome
and matrix-assisted laser desorption/ionization-time-of-flight mass spectrometry (MALDI-TOF-MS) imaging analyses
revealed early downregulation of cardiolipin, a mitochondrial membrane-specific lipid. Furthermore, primary-cultured
cardiac myocytes from C-RAMP2−/− showed reduced mitochondrial membrane potential and enhanced reactive oxygen
species production in a RAMP2 deletion–dependent manner. C-RAMP2−/− showed downregulated activation of cAMP
response element binding protein (CREB), one of the main regulators of mitochondria-related genes. These data
demonstrate that the AM-RAMP2 system is essential for cardiac metabolism and homeostasis. The AM-RAMP2 system
is a promising therapeutic target of heart failure. (Hypertension. 2013;61:341-351.) ● Online Data Supplement
Key Words: cardiac failure ■ cardiac myocytes ■ metabolism ■ mitochondria ■ mouse mutants
A
drenomedullin (AM) was identified as a vasodilating and
hypotensive peptide mainly produced by the cardiovascular system.1 AM is primarily secreted by vascular cells, and
it is also secreted from kidney, lung, and heart.2 AM functions
as a local autocrine/paracrine mediator,3 as well as a circulating hormone,4 exerting natriuretic,5 antioxidative,6,7 and other
effects. AM levels in the blood are increased in hypertension,4,8 heart failure,9 and myocardial infarction,10 which suggests its involvement in cardiovascular disease. Homozygotic
AM knockout (AM−/−) mice were dead in utero because of
abnormal cardiovascular development.11 On the other hand,
heterozygotic AM knockout (AM±) mice were apparently
normal, although they exhibited higher blood pressure and cardiac hypertrophy when subjected to cardiovascular stress.6,12
Conversely, transgenic mice overexpressing AM have shown
lower blood pressure and resistance to various forms of organ
damage,13,14 suggesting that AM exerts organ protective as well
as hypotensive effects.15–18
The AM receptor calcitonin receptor-like receptor is a
7-transmembrane domain G protein–coupled receptor19
that associates with an accessory protein, receptor activitymodifying protein (RAMP), which is composed of ≈160
amino acids and includes a single membrane-spanning
domain. So far, 3 RAMP isoforms have been identified, but
Received November 14, 2012; first decision December 4, 2012; revision accepted December 6, 2012.
From the Departments of Cardiovascular Research (T.Y., T.S., A.K., Y.I.-S., H.K., Y.I., T.K., R.U., L.Y., A.Y., M.T., Y.T., K.I., T.S.) and Molecular
Pharmacology (T.N., T.K., M.Y.), Shinshu University Graduate School of Medicine, Shinshu, Japan; Department of Anatomy, Kyorin University School of
Medicine, Tokyo, Japan (H.K.); Department of Metabolome, Graduate School of Medicine, University of Tokyo, Tokyo, Japan (H.N., R.T.); Applications
Development Center, Shimadzu Corporation, Kyoto, Japan (T.N.); and Department of Cardiovascular Regenerative Medicine, Osaka University Graduate
School of Medicine, Osaka, Japan (H.A.).
The online-only Data Supplement is available with this article at http://hyper.ahajournals.org/lookup/suppl/doi:10.1161/HYPERTENSIONAHA.
111.00647/-/DC1.
Correspondence to Takayuki Shindo, Department of Cardiovascular Research, Shinshu University Graduate School of Medicine, Asahi 3-1-1, Matsumoto,
Nagano, 390-8621, Japan. E-mail [email protected]
© 2013 American Heart Association, Inc.
Hypertension is available at http://hyper.ahajournals.org
DOI:10.1161/HYPERTENSIONAHA.111.00647
341
342 Hypertension February 2013
only RAMP2 homozygotic knockout (RAMP2−/−) is lethal in
utero and reproduces the phenotypes observed in AM−/− mice.20
This suggests that AM signaling via the calcitonin receptorlike receptor/RAMP2 heterodimer (AM-RAMP2 system)
is particularly important for the cardiovascular system. In a
rat hypertension model induced by inhibition of nitric oxide
synthase, AM and the AM receptor components were reported
to be upregulated in the heart, probably as a compensatory
response against cardiac hypertrophy.21 Although AM and
RAMP2 are highly expressed in the heart from embryo to
adulthood, analysis of the pathophysiological functions
has been limited by the lethality of both the AM−/− and
RAMP2−/− genotypes. We speculated that we can overcome this
limitation by using cardiac myocyte-specific conditional gene
targeting. For this study, we generated an inducible cardiac
myocyte-specific RAMP2 knockout (C-RAMP2−/−) mouse,
which enabled us to induce RAMP2 gene deletion in the adult
and to directly assess the involvement of the AM-RAMP2
system in the pathophysiology of cardiovascular disease.
Methods
For experimental procedures not described herein, please refer to the
online-only Data Supplement Methods section.
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Figure 1. Cardiac myocyte-specific receptor activity-modifying protein 2 knockout (C-RAMP2−/−) mice exhibit dilated cardiomyopathylike heart failure. A, Transverse (top) and longitudinal (bottom) sections showing ventricular enlargement in a C-RAMP2−/− heart. B,
Open chest view showing enlargement of the heart in a C-RAMP2−/− mouse. C, Cardiothoracic ratio (CTR) and heart weight/body weight
ratio (HW/BW) were higher and systolic blood pressure (SBP) was lower in C-RAMP2−/− mice. *P<0.05, **P<0.01. D, Representative
transthoracic M-mode echocardiogram. E, Hematoxylin and eosin staining of heart sections showing myocyte hypertrophy. Scale
bars, 25 µm. F, Transmission electron micrographs showing enhanced perivascular fibrosis (*; top) and myofibrillar disarray (bottom)
in C-RAMP2−/− hearts. Scale bars, 2 µm. G, Cross-sectional width of cardiac myocytes was significantly higher in C-RAMP2−/− hearts.
**P<0.01. H, Cardiac expression of the indicated genes. Expression levels in C-RAMP2−/− hearts were normalized to the control, which
was assigned a value of 1. **P<0.01, ***P<0.001. Bars in C, G, and H show mean±SEM.
Yoshizawa et al AM-RAMP2 in Cardiac Homeostasis 343
Animals
A mouse line exhibiting cardiac myocyte-specific RAMP2 deletion
was generated by cross-breeding RAMP2 flox mice20 with α-myosin
heavy chain (MHC)-MerCreMer transgenic (Tg) mice.22 To induce
Cre recombination, RAMP2 flox/flox-αMHC-MerCreMer Tg/+ mice
(male, 8–12 weeks old) were administered tamoxifen (Sigma) IP
once a day for 5 days at a dose of 30 mg/kg per day followed by a
2-day interval without drug administration. For the study of chronic
stage after the gene deletion, the treatment was followed by a 23-day
interval without drug administration.
All of the experiments were performed in accordance with the
Declaration of Helsinki and were approved by the Shinshu University
Ethics Committee for Animal Experiments.
Isolation of Embryonic Cardiac Myocytes
Embryonic cardiac myocytes were isolated from embryos at E14.5 to
E16.5. Cardiac myocytes from RAMP2 flox/flox-αMHC-MerCreMer
Tg/+ embryos or αMHC-MerCreMer (without loxP) embryos were
treated with 500 nmol/L of 4-OH-tamoxifen (SIGMA).
Table 1. Echocardiographic Data of Control and C-RAMP2−/−
Mice (Acute Phase of the Gene Deletion).
Parameters
Control
LVDd, mm
3.81±0.09
4.35±0.29
LVDs, mm
2.56±0.11
3.82±0.48*
LVPWd, mm
0.73±0.03
0.74±0.07
LVPWs, mm
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Ca2+ Imaging
Ca2+ imaging was performed as described previously.24 Fluorescence
images were acquired with a laser scanning microscopy 7 LIVE laser
scanning microscope (Zeiss). Ca2+ transient was assessed from fluorescence changes in individual cardiac myocytes in the presence or
absence of 10–7 mol/L AM.
Mitochondrial Function
Mitochondrial membrane potential was assessed using fluorescent
tetramethylrhodamine ethyl ester (TMRE; Molecular Probes) staining. Cardiac myocytes were stained with 100 nmol/L of TMRE for
15 minutes, after which the culture medium was replaced with fresh
medium. Mitochondrial reactive oxygen species (ROS) production
was assessed using MitoSOX Red (Molecular Probes) staining. The
cells were then visualized using a Zeiss laser scanning microscopy 5
EXCITER fluorescence microscope system.
Analysis of Phospholipid Molecular Species
Phospholipids such as cardiolipin were extracted by the Bligh and
Dyer method25 and analyzed according to the online-only Data
Supplement Methods section.
On-Tissue Matrix-Assisted Laser Desorption/
Ionization-Time-of-Flight Mass Spectrometry
Imaging Analysis
A frozen section of the heart was placed on an indium tin oxide
coated glass slide (578274; Sigma-Aldrich) and stored at −80°C.
9-Aminoacridine at a concentration of 5 mg/mL dissolved in 70%
ethanol was used for matrix. Matrix deposition was performed by
a chemical printer (CHIP-1000, Shimadzu Corporation) and dried
up. Matrix-assisted laser desorption/ionization mass spectra were
acquired using AXIMA Performance (Shimadzu) with a 337-nm
nitrogen laser, operating in the reflectron/negative mode.
Statistics
Quantitative values are expressed as the mean±SE. Student t test was
used to determine significant differences between 2 groups. One-way
ANOVA followed by Fisher protected least significant difference was
used to determine significant differences between 3 groups. Dunnett
test was used to determine significant differences between >3 groups.
Values of P<0.05 were considered significant.
0.93±0.10
EF, %
61.68±2.84
26.93±11.68**
FS, %
32.82±1.90
14.36±6.83*
EF indicates ejection fraction; FS, fractional shortening; LVDd, diastolic
left ventricular dimension; LVDs, systolic left ventricular dimension; LVPWd,
diastolic left ventricular posterior wall thickness; and LVPWs, systolic left
ventricular posterior wall thickness. n=6–7.
*P<0.05.
**P<0.01.
Results
Isolation of Adult Cardiac Myocytes
Adult cardiac myocytes were isolated from RAMP2 flox/flox-αMHCMerCreMer Tg/+ mice treated with tamoxifen or vehicle. Ventricular
myocytes were enzymatically isolated from the heart of adult mice,
as described previously.23
1.07±0.04
C-RAMP2−/−
C-RAMP2−/− Mice Exhibit Dilated Cardiomyopathy
To induce cardiac myocyte-specific deletion of RAMP2,
RAMP2 flox/flox-αMHC-MerCreMer Tg mice were treated
with tamoxifen. It has been reported that a high oral dose of
tamoxifen (80 mg/kg body weight for 7 days; total dose, 560
mg/kg) can induce MerCreMer nuclear translocation and dilated
cardiomyopathy in mice.22 To avoid the spontaneous occurrence
of heart failure, we used a lower dose of tamoxifen (30 mg/
kg body weight administered IP daily for 5 days; total dose,
150 mg/kg) and withdrawal for 2 days. After this procedure,
the level of RAMP2 gene expression within whole-heart specimens (including both myocytes and nonmyocytes) was reduced
to ≈60% of control. We designated tamoxifen-treated RAMP2
flox/flox-αMHC-MerCreMer Tg mice as C-RAMP2−/−. We also
confirmed that this dosage does not cause spontaneous heart
failure in αMHC-MerCreMer Tg mice without the RAMP2flox region (Figure S1 in the online-only Data Supplement).
C-RAMP2−/− hearts showed enlargement of ventricles
(Figure 1A), with significant increases in the cardiothoracic
ratio and heart weight/body weight ratio, although blood
pressure was reduced (Figure 1B and 1C). Echocardiography
showed C-RAMP2−/− hearts to have dilated left ventricles
with diminished systolic function (Figure 1D and Table 1),
Table 2. Echocardiographic Data of Control and C-RAMP2−/−
Mice (Chronic Phase of the Gene Deletion).
Parameters
Control
LVDd, mm
3.93±0.11
4.20±0.16
LVDs, mm
2.75±0.06
3.14±0.12*
LVPWd, mm
0.77±0.02
0.77±0.04
LVPWs, mm
C-RAMP2−/−
1.00±0.03
0.99±0.05
EF, %
57.67±1.23
49.92±2.06*
FS, %
29.91±0.88
25.10±1.26*
EF indicates ejection fraction; FS, fractional shortening; LVDd, diastolic left
ventricular dimension; LVDs, systolic left ventricular dimension; LVPWd, diastolic
left ventricular posterior wall thickness; and LVPWs, systolic left ventricular
posterior wall thickness. n=5.
*P<0.05.
344 Hypertension February 2013
Figure 2. Cardiac changes had not
recovered in the 23 days after the receptor
activity-modifying protein (RAMP) 2 gene
deletion. A, Transverse sections showing
ventricular enlargement in a cardiac myocytespecific RAMP2 knockout (C-RAMP2−/−)
RAMP2 heart. B, Hematoxylin and eosin
staining of heart sections showing myocyte
hypertrophy. Scale bars, 25 µm. C, Crosssectional width of cardiac myocytes was
significantly higher in C-RAMP2−/− hearts.
*P<0.05. D, Representative transthoracic
M-mode echocardiogram.
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
which suggests that C-RAMP2−/− mice experience dilated
cardiomyopathy-like heart failure. Histological analysis
revealed enlargement of the cardiac myocytes (Figure 1E and
1G). Electron microscopic observation revealed myofibril
disarray and Z-line dislocation, as well as enhanced perivascular
fibrosis (Figure 1F). In addition, quantitative reversetranscription polymerase chain reaction (Figure 1H) showed
that brain natriuretic peptide (BNP) and sarcoendoplasmic
reticulum calcium ATPase 2 (SERCA2) expressions were
upregulated and downregulated, respectively, in C-RAMP2−/−
hearts. These alterations in gene expression are consistent with
the dilated cardiomyopathy-like changes in C-RAMP2−/−.
We further analyzed the chronic phase of the gene deletion.
We analyzed C-RAMP2−/− at 23 days after tamoxifen administration. At this stage, C-RAMP2−/− still showed dilatation of
ventricles (Figure 2A) with enlargement of cardiac myocytes
(Figure 2B and 2C). Echocardiography showed partial recovery of cardiac function; however, compared with control mice,
C-RAMP2−/− still showed significantly reduced systolic function with left ventricular dilatation (Figure 2D and Table 2).
Increased Oxidative Stress in C-RAMP2−/− Hearts
We next attempted to identify the cause of the heart failure in
C-RAMP2−/−. Immunostaining of 4-hydroxynonenal (HNE), a
peroxidized lipid, showed that levels of oxidative stress were
elevated in C-RAMP2−/− hearts (Figure 3A, center).
We orally administered the antioxidant 4-hydroxy-2,2,6,6tetramethylpiperidine-N-oxyl (TEMPOL) to analyze whether
the elevated ROS is the primary cause of heart failure in
C-RAMP2−/−. TEMPOL treatment reduced ROS levels in
the hearts of C-RAMP2−/− (Figure 3A, right). Moreover, the
enlargement of cardiac myocytes was reversed (Figure 3B). On
the other hand, the altered expression of BNP and SERCA2 was
unaffected (Figure 3C), which suggests that mechanisms other
than ROS elevation are also involved in the onset of failure in
C-RAMP2−/− hearts.
Downregulation of Mitochondrial MembraneSpecific Lipid in C-RAMP2−/− Hearts
To further clarify the mechanisms involved in the failure
of C-RAMP2−/− hearts, we used metabolome analysis
Figure 3. Enhanced oxidative stress in
cardiac myocyte-specific receptor activitymodifying protein 2 knockout (C-RAMP2−/−)
hearts and the effect of antioxidant
treatment. A, Heart section immunostained
with anti–4-hydroxynonenal (HNE), a marker
of peroxidized lipids, which represents
oxidative stress level. C-RAMP2−/− hearts
showed an enhanced oxidative stress level,
whereas Tempol treatment suppressed it.
Scale bars, 50 µm. B, Cross-sectional width
of cardiac myocytes and (C) heart failurerelated gene brain natriuretic peptide (BNP)
and sarcoendoplasmic reticulum calcium
ATPase (SERCA) 2 expression in control
and C-RAMP2−/− hearts, with and without
Tempol. Tempol treatment suppressed the
enlargement of cardiac myocytes, whereas
it did not change expression of heart failurerelated gene. *P<0.05, **P<0.01, ***P<0.001
vs control. #P<0.05 vs C-RAMP2−/− without
Tempol by Fisher protected least significant
difference (PLSD). Bars in B and C show
mean±SEM.
Yoshizawa et al AM-RAMP2 in Cardiac Homeostasis 345
to comprehensively evaluate the metabolic changes in
C-RAMP2−/− hearts. The lipid analysis revealed a distribution
shift from phosphatidylcholines to lysophosphatidylcholines
(data not shown). Lysophosphatidylcholines derive from
the partial degradation of phosphatidylcholines through
the removal of 1 of their 2 fatty acids. We speculated that
the enhanced oxidative stress in C-RAMP2−/− hearts might
promote the degradation of phospholipids.
Furthermore, we found that several forms of cardiolipin were
downregulated in C-RAMP2−/− hearts (Figure 4A). Cardiolipin
is a mitochondrial inner membrane-specific lipid that binds to
cytochrome C, anchoring it in the inner mitochondrial membrane,
and is essential for ATP production. To confirm that this downregulation was a result of myocyte abnormalities, we performed
matrix-assisted laser desorption/ionization-Time-of-flight mass
spectrometry imaging analysis, which enabled us to analyze
the metabolome directly using ionized cells from frozen sections and to exclude fibrotic areas and blood vessels. Using this
approach, we confirmed that cardiolipins were downregulated
in myocytes (Figure 4B). Cardiolipins containing docosahexaenoic acid were downregulated beginning early (day 2) after
RAMP2 deletion (Figure 4C). Taken together, these findings
suggest mitochondrial changes involving the abnormal distribution of cardiolipin are the earliest events in the heart failure
seen after RAMP2 deletion.
Structural and Functional Mitochondrial
Abnormalities in C-RAMP2−/− Hearts
Consistent with the results above, electron microscopic observation showed the presence of mitochondrial changes after
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Figure 4. Cardiolipin (CL) is downregulated in cardiac myocyte-specific receptor activity-modifying protein 2 knockout (C-RAMP2−/−)
hearts. A, Metabolome analysis showing changes of the levels of cardiolipin containing the indicated fatty acids in C-RAMP2−/− hearts.
B, Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF-MS) imaging analysis of cardiac myocytes.
Four regions in each section were ionized by direct laser radiation for analysis. Arrows 1 and 2 point to the CL (18:2/18:2/18:2/18:2) and
CL (18:2/18:2/18:2/18:1) peaks, respectively, both of which are reduced in C-RAMP2−/− hearts. C, Metabolome analysis of cardiolipin on
day 2 after starting tamoxifen administration. (Mice were treated with 30 mg/kg per day tamoxifen for 2 days.) Cardiolipins containing
docosahexaenoic acid (22:6) tended to be downregulated early. Bars in A and C show mean±SEM.
346 Hypertension February 2013
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
RAMP2 deletion (Figure 5A). The mitochondrial cristae
formations were disrupted. In addition, mitophagy, the phenomena of removing damaged mitochondria, was observed
in C-RAMP2−/− hearts (Figure 5A, right). The mitochondrial
DNA content was not changed in C-RAMP2−/− hearts (Figure
5B), but quantitative reverse-transcription polymerase chain
reaction showed that expression of mitochondria-related
genes, including peroxisome proliferator-activated receptor-γ
coactivator-1α, β (PGC-1α, β), peroxisome proliferator-activated receptor-α, estrogen-related receptor-α (in charge of
mitochondria regulation), carnitine palmitoyl transferase 1α, 2,
medium-chain acyl dehydrogenase (in charge of β-oxidation),
ATP synthase F1 complex-β subunit, cytochrome C oxidase (in
charge of oxidative phosphorylation), uncoupling protein 3, and
superoxide dismutase 2 (in charge of mitochondria ROS regulation), were all downregulated in C-RAMP2−/− hearts (Figure
5C). This suggests that heart failure in C-RAMP2−/− is related to
mitochondrial dysfunction rather than mitochondrial volume.
We next examined the time course of the gene expression in
C-RAMP2−/− hearts. PGC-1α is one of the master regulators of
mitochondrial biogenesis. Although we detected no cardiac dysfunction during the period of tamoxifen treatment (from day 0 to
5), gene expression of PGC-1α was transiently upregulated on
day 3 and downregulated thereafter (Figure 5D). On the other
hand, BNP expression was unaffected during days 0 to 5, and
it was upregulated from day 7 onward. This suggests that mitochondrial changes occur before the development of heart failure.
In Vitro Analysis of Cardiac Myocytes From
C-RAMP2−/−
To further confirm that mitochondrial dysfunction is the primary cause of heart failure but not secondary to the contractile
dysfunction, we cultured primary cardiac myocytes isolated
from RAMP2 flox/flox-αMHC-MerCreMer Tg embryos.
We then treated the cells with 4-OH-tamoxifen and directly
analyzed mitochondrial function. 4-OH-tamoxifen-treated
C-RAMP2−/− myocytes showed weak TMRE staining, which
indicates depolarization of the mitochondrial membrane
(Figure 6A). In addition, Mito SOX red staining revealed
mitochondrial ROS levels to be elevated in C-RAMP2−/− myocytes (Figure 6B). We also confirmed that 4-OH-tamoxifen
treatment itself did not affect mitochondrial function, because
4-OH-tamoxifen-treated αMHC-MerCreMer without loxP
cells showed no changes in TMRE or Mito SOX Red staining
(right panels of Figure 6A and 6B). Gene expression of the
mitochondrial regulatory factors PGC-1α and β was also suppressed in the C-RAMP2−/− myocytes (Figure 6C).
Furthermore, we analyzed adult cardiac myocytes. In
TMRE and Mito SOX Red staining, cardiac myocytes isolated
from C-RAMP2−/− showed weaker mitochondrial membrane
potential and increased mitochondrial ROS production (Figure
6D). Next, to clarify robustness of the adult cardiac myocytes,
we analyzed the Ca2+ transient of the isolated adult myocytes
(transient cytosol Ca2+ elevation in response to electric pacing)
using a Ca2+ imaging system. Peak twitch amplitude of the
Figure 5. Mitochondria in cardiac myocytespecific receptor activity-modifying protein
2 knockout (C-RAMP2−/−) hearts exhibit
structural and functional abnormalities.
A, Transmission electron micrographs
showing cardiac mitochondria. C-RAMP2−/−
showed damaged mitochondria and
appearance of mitophagy (arrow at right).
Scale bar, 1 µm. B, Relative mitochondrial
DNA/nuclear DNA ratios. Data are shown
as the ratio when mean of the control
group = 1. C, Relative cardiac gene
expression of mitochondria-related
molecules involved in overall mitochondrial
regulation (peroxisome proliferatoractivated receptor-γ coactivator [PGC]-1α,
PGC-1β, peroxisome proliferator-activated
receptor [PPAR]-α, and estrogen-related
receptor [ERR-α]), β-oxidation carnitine
palmitoyl transferase ([CPT]-1α, CPT-2,
and medium-chain acyl dehydrogenase
[MCAD]), oxidative phosphorylation (ATP
synthase F1 complex β subunit and
cytochrome C oxidase [COX IV]), and
mitochondrial reactive oxygen species
(ROS) regulation (uncoupling protein
3 [UCP3] and superoxide dismutase 2
[SOD2]). Expression levels in C-RAMP2−/−
hearts were normalized to the control,
which was assigned a value of 1. *P<0.05,
**P<0.01, ***P<0.001. D, Relative cardiac
expression of PGC-1α, BNP on the
indicated days. Expression levels were
normalized to the level on day 0, which
was assigned a value of 1. *P<0.05 vs day
0; Dunnett test. Bars in B through D show
mean±SEM.
Yoshizawa et al AM-RAMP2 in Cardiac Homeostasis 347
cytosol Ca2+ fluorescent after the pacing was significantly lower
in C-RAMP2−/− compared with control (Figure 6E). In addition,
the decay speed of the transiently elevated Ca2+ fluorescent was
slowed, and the half-life of the decay tended to be longer in
C-RAMP2−/− than control (Figure 6F). These results suggest that
failing cardiac myocytes of C-RAMP2−/− exhibited abnormal
Ca2+ handling. With AM stimulation, the amplitude of the Ca2+
transient was elevated in control cardiac myocytes; however, the
response was blunted in C-RAMP2−/− myocytes (Figure 6G).
CREB Activation Is Suppressed in
C-RAMP2−/− Hearts
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Figure 6. In vitro analysis of cardiac myocytes. A, Effect of
4-OH-tamoxifen (4-OH-Tam.) on mitochondrial membrane
potential in cardiac myocytes from α−major histocompatibility
complex (MHC)-MerCreMer receptor activity-modifying protein
knockout receptor activity-modifying protein (RAMP) 2 flox/flox
and αMHC-MerCreMer (without loxP) embryos visualized using
tetramethylrhodamine ethyl ester (TMRE) staining. The weak
TMRE signal in RAMP2-deleted myocytes (middle) indicates
membrane depolarization. Scale bar, 10 µm. B, Mitochondriaspecific reactive oxygen species (ROS) production visualized
by Mito SOX Red staining in cardiac myocytes. The strong
Mito SOX Red signal from the RAMP2 gene-deleted myocytes
(middle) indicates mitochondria-specific elevation of ROS. Scale
bar, 50 µm. C, Effect of 4-OH-tamoxifen on PGC-1α and β gene
expression in cardiac myocytes from αMHC-MerCreMer RAMP2
flox/flox embryos. Bars show mean±SEM. *P<0.05 vs control;
Fisher protected least significant difference (PLSD). D, TMRE
and Mito SOX Red staining in adult cardiac myocytes isolated
from C-RAPM2−/− and control mice. Scale bar, 50 µm. E through
G, Results of Ca2+ transient analysis in isolated adult myocytes
using Ca2+ imaging system. E, The peak twitch ratio (△F/F0) of
the increase in cytosol Ca2+ fluorescence in response to electric
stimulation (△F) to the basal cytosol Ca2+ fluorescence without
stimulation (F0) F, Half-life of the Ca2+ fluorescent decay. G, A
percentage increase in the peak twitch Ca2+ transient amplitude in
response to 10–7 mol/L adrenomedullin stimulation (AM stim.). Bars
in E through G show mean±SEM. **P<0.01 vs control.
AM was originally identified through its ability to increase
intracellular cAMP levels. Therefore, to assess signaling
pathways involved in the mitochondrial abnormalities in
C-RAMP2−/− hearts, we first analyzed intracellular cAMP
levels in cultured myocytes from C-RAMP2−/− hearts. cAMP
was reduced in C-RAMP2−/− myocytes (Figure 7A). Moreover,
Western blot analysis showed that the level of cAMP response
element binding (CREB) protein activation was significantly
reduced in C-RAMP2−/− hearts (Figure 7B and 7C).
Forskolin stimulates adenylate cyclase directly, thereby
increasing intracellular cAMP levels. In C-RAMP2−/− hearts,
forskolin treatment partially recovered CREB phosphorylation (data not shown) and mediated repolarization of the mitochondrial membrane in cardiac myocytes (Figure 7D). When
we tested its effects in vivo, we found that forskolin reduced
ROS levels in C-RAMP2−/− hearts (Figure 7E). In addition,
forskolin partially recovered the heart failure-related changes
in BNP and sarcoendoplasmic reticulum calcium ATPase 2
expression (Figure 7F). Gene expression of various mitochondria-related factors was downregulated in C-RAMP2−/− compared with control. However, with forskolin treatment, some
factors that were related to mitochondria regulation (PGC-1α,
PGC-1β, peroxisome proliferator-activated receptor -α, and
estrogen-related receptor-α) were significantly upregulated in
C-RAMP2−/−. Other factors (CPT-2, medium-chain acyl dehydrogenase, ATP synthase F1 complex β subunit, cytochrome
C oxidase, uncoupling protein 3, and superoxide dismutase 2)
were also partially restored (Figure 7G).
Discussion
AM is a circulating peptide and its level in blood is increased
in heart failure,9 perhaps as a compensatory response.
Although it is known that AM is upregulated in response to
various stresses, it is difficult to evaluate the role of AM within
the heart using conventional knockout mice, because hemodynamic changes caused by systemic AM deficiency would
likely affect cardiac function. Conditional gene targeting is
a novel way to solve this problem; however, cardiomyocytespecific AM knockout mice are also problematic, because AM
is secreted from both myocytes and nonmyocytes in the heart,
and the secreted AM may work between each other. In the
present study, therefore, we chose to disrupt the AM receptor
system in cardiac myocytes by generating an inducible conditional RAMP2 gene-targeted mouse.
Figure 8 summarizes our findings for the AM-RAMP system
in cardiac homeostasis. We found that cardiomyocyte-specific
348 Hypertension February 2013
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Figure 7. cAMP and cAMP response element binding protein (CREB) activation are suppressed in cardiac myocyte-specific
receptor activity-modifying protein (RAMP) 2 knockout (C-RAMP2−/−) hearts. A, Effect of RAMP2 deletion induced by 4-OH-tamoxifen
(Tam) treatment on intracellular cAMP levels in primary cultured cardiac myocytes stimulated with 10−7 mol/L adrenomedullin (AM).
Measurements were made using an enzyme immunoassay. B, Western blot analysis of CREB and phosphorylated CREB (p-CREB).
C, Effect of RAMP2 deletion on CREB activation indicated by its phosphorylation ratio (pCREB/CREB). D, Tetramethylrhodamine
ethyl ester (TMRE) staining of cardiac myocytes showing the forskolin-induced restoration of mitochondrial membrane potential after
RAMP2 deletion. Scale bar, 10 µm. E, 4-Hydroxynonenal (HNE) immunostaining of heart sections. Forskolin treatment reversed reactive
oxygen species (ROS) in C-RAMP2−/− hearts. Scale bar, 50 µm. F, Relative gene expression of heart failure–related molecules (brain
natriuretic peptide [BNP] and sarcoendoplasmic reticulum calcium ATPase [SERCA] 2). *P<0.05, **P<0.01 vs control; Fisher protected
least significant difference (PLSD). G, Relative gene expression of the mitochondria-related molecules. *P<0.05, **P<0.01, ***P<0.001 vs
control. #P<0.05 vs C-RAMP2−/−; Fisher PLSD. Bars in A, C, F, and G show mean±SEM.
RAMP2 deletion evoked dilated cardiomyopathy-like heart
failure with cardiac dilatation in the adult heart. This heart failure was associated with high levels of oxidative stress. In previous studies using AM± mice, AM was shown to exert strong
antioxidant effects in the heart through activation of endothelial
nitric oxide synthase and regulation of NADPH oxidase.6,7 As
expected, C-RAMP2−/− hearts showed increased oxidative stress,
and the superoxide dismutase mimic TEMPOL reversed the
Yoshizawa et al AM-RAMP2 in Cardiac Homeostasis 349
Previously reported
pathway
AM
Newly found
pathway
CLR
RAMP2
NOX
PI3K/Akt
PI3K/Akt
CaMKII
Erk
CREB
eNOS
ROS
CREB
PGC-1
PPAR-
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
ERR-
Mit. ROS
Figure 8. Schema of adrenomedullin (AM)receptor activity-modifying protein (RAMP)
2 system in cardiac homeostasis. Previous
finding of AM-RAMP2 function (antioxidant
effects through regulation of nicotinamide
adenine dinucleotide phosphate oxidase) and
our new findings (regulation of mitochondrial
function) are summarized.
lipid oxidation
ROS regulation
OXPHOS
increases in ROS. However, because the heart failure caused by
RAMP2 deletion was not fully reversed by the ROS reduction,
we speculated that other critical factors were involved.
The mitochondria in C-RAMP2−/− hearts showed structural changes that were associated with reduced expression of
various mitochondria-related molecules. Furthermore, lipid
metabolome analysis and matrix-assisted laser desorption/
ionization-time-of-flight mass (MALDI-TOF-MS) spectrometry imaging analysis, which are novel strategies enabling
clarification of tissue-specific metabolic alterations, revealed
that levels of cardiolipin, a mitochondrial inner membranespecific lipid, were decreased beginning early after RAMP-2
deletion. Cardiolipin binds to enzymes involved in oxidative
phosphorylation, anchoring them to the mitochondrial inner
membrane,26 and regulating their activity.27 It is essential
for mitochondrial function, and dysregulation of cardiolipin
induces heart failure.28 To further confirm that mitochondrial
dysfunction is the primary cause of heart failure but not secondary to the contractile dysfunction, we cultured primary
cardiac myocytes isolated from RAMP2 flox/flox-αMHCMerCreMer Tg embryos. We then induced RAMP2 deletion
in vitro and proved mitochondrial dysfunction and enhanced
ROS production occurred in a RAMP2 deletion-dependent
manner. We also confirmed poor Ca2+-handling in cardiac
myocytes isolated from adult C-RAMP2−/−.
We found that the altered expression of BNP after RAMP2
deletion was preceded by altered expression of the transcriptional coactivator PGC-1α, which governs mitochondrial biology through broad regulation of genes in both the
nuclear and mitochondrial genomes. Induction of PGC-1α
is regulated by multiple signaling molecules, including p38
mitogen-activated protein kinase,29,30 Ca2+ calcineurin,31 AMPactivated protein kinase,32 Sirt1,33,34 and CREB.35 In the liver,
CREB regulates PGC-1α by binding to the cAMP responsive
element in the PGC-1α promoter and inducing expression of
the gluconeogenic program.35 Downregulation of CREB is
associated with aging, hypertension, insulin resistance, and
vascular disease.36 Moreover, transgenic mice overexpressing a dominant-negative CREB in their hearts exhibit dilated
cardiomyopathy-like heart failure37 with mitochondrial abnormalities.38 These reports suggest that regulation of PGC-1α by
CREB plays a pivotal role in cardiovascular homeostasis. In
the present study, we found that CREB activation was reduced
in C-RAMP2−/− hearts and speculated that CREB suppression
underlies the observed mitochondrial dysfunction and heart
failure. Downstream effects mediated by the AM-RAMP2
system include cAMP production, Ca2+ mobilization,39 and
activation of Akt and other signaling molecules.40 All of these
molecules are involved in CREB activation,41–43 suggesting
that RAMP2 deletion suppresses CREB by altering several
signaling pathways.
Consistent with that idea, forskolin, which directly stimulates
adenylyl cyclase and cAMP production, reversed the mitochondrial membrane depolarization and mitochondrial ROS elevation seen in cultures of primary C-RAMP2−/− cardiomyocytes.
In vivo, forskolin ameliorated the oxidative stress and fibrosis in
C-RAMP2−/− hearts, reversed the heart failure-related changes
in BNP and SERCA2 expression, and restored expression of
PGC-1α, estrogen-related receptor-α, (ERR-α) and other mitochondrial genes. These data show that the AM-RAMP2 system
is essential for appropriate regulation of cardiac function and
homeostasis and that it acts via CREB and PGC-1 to affect
mitochondrial ATP production, lipid metabolism, and ROS
regulation.
Perspectives
AM is a peptide originally found as a vasodilating and
hypotensive peptide secreted from various cells and tissues,
including the cardiovascular system. In this study, we directly
assessed the roles of the AM-RAMP2 system in cardiac
myocytes and its pathophysiological significance in heart
failure. These data show that the AM-RAMP2 system may
be a promising therapeutic target of heart failure. On the
other hand, the clinical applicability of AM, like that of other
350 Hypertension February 2013
bioactive endogenous peptides, has 2 serious limitations:
AM has a very short half-life in the blood, and the cost of
the recombinant protein is very high, which together make the
use of AM impractical for treatment of chronic diseases. It is,
therefore, noteworthy that we are able to affect the cardiac
activity of AM by modulating RAMP2. In fact, we would
expect that greater specificity can be achieved by targeting
RAMP2 than by targeting calcitonin receptor-like receptor,
which can also function as a receptor for α-calcitonin generelated peptide, β-calcitonin gene-related peptide, amylin, and
intermedin. In this study, we have shown that the AM-RAMP2
system is essential for cardiac homeostasis. Our findings could
potentially provide the critical basis for developing medicines
targeting the AM-RAMP2 system, which could directly
promote both energy production and ROS suppression in
cardiac myocytes.
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Sources of Funding
This study was supported by the Funding Program for Next
Generation World-Leading Researchers (NEXT Program) from the
Cabinet Office, Government of Japan and Grant-in-Aid for Japan
Society for the Promotion of Science (JSPS) Fellows.
Disclosures
None.
References
1. Kitamura K, Kangawa K, Kawamoto M, Ichiki Y, Nakamura S, Matsuo H,
Eto T. Adrenomedullin: a novel hypotensive peptide isolated from human
pheochromocytoma. Biochem Biophys Res Commun. 1993;192:553–560.
2.Minamino N, Kikumoto K, Isumi Y. Regulation of adrenomedullin
expression and release. Microsc Res Tech. 2002;57:28–39.
3. Michibata H, Mukoyama M, Tanaka I, Suga S, Nakagawa M, Ishibashi R,
Goto M, Akaji K, Fujiwara Y, Kiso Y, Nakao K. Autocrine/paracrine role
of adrenomedullin in cultured endothelial and mesangial cells. Kidney Int.
1998;53:979–985.
4. Kitamura K, Ichiki Y, Tanaka M, Kawamoto M, Emura J, Sakakibara S,
Kangawa K, Matsuo H, Eto T. Immunoreactive adrenomedullin in human
plasma. FEBS Lett. 1994;341:288–290.
5. Jougasaki M, Wei CM, Aarhus LL, Heublein DM, Sandberg SM, Burnett
JC Jr. Renal localization and actions of adrenomedullin: a natriuretic peptide. Am J Physiol. 1995;268(4 pt 2):F657–F663.
6. Shimosawa T, Shibagaki Y, Ishibashi K, Kitamura K, Kangawa K, Kato
S, Ando K, Fujita T. Adrenomedullin, an endogenous peptide, counteracts
cardiovascular damage. Circulation. 2002;105:106–111.
7. Shimosawa T, Ogihara T, Matsui H, Asano T, Ando K, Fujita T. Deficiency
of adrenomedullin induces insulin resistance by increasing oxidative
stress. Hypertension. 2003;41:1080–1085.
8.Kakishita M, Nishikimi T, Okano Y, Satoh T, Kyotani S, Nagaya N,
Fukushima K, Nakanishi N, Takishita S, Miyata A, Kangawa K, Matsuo
H, Kunieda T. Increased plasma levels of adrenomedullin in patients with
pulmonary hypertension. Clin Sci (Lond). 1999;96:33–39.
9. Nishikimi T, Saito Y, Kitamura K, Ishimitsu T, Eto T, Kangawa K, Matsuo
H, Omae T, Matsuoka H. Increased plasma levels of adrenomedullin in
patients with heart failure. J Am Coll Cardiol. 1995;26:1424–1431.
10. Nagaya N, Nishikimi T, Yoshihara F, Horio T, Morimoto A, Kangawa K.
Cardiac adrenomedullin gene expression and peptide accumulation after
acute myocardial infarction in rats. Am J Physiol Regul Integr Comp
Physiol. 2000;278:R1019–R1026.
11. Shindo T, Kurihara Y, Nishimatsu H, et al. Vascular abnormalities and elevated blood pressure in mice lacking adrenomedullin gene. Circulation.
2001;104:1964–1971.
12.Niu P, Shindo T, Iwata H, Iimuro S, Takeda N, Zhang Y, Ebihara A,
Suematsu Y, Kangawa K, Hirata Y, Nagai R. Protective effects of endogenous adrenomedullin on cardiac hypertrophy, fibrosis, and renal damage.
Circulation. 2004;109:1789–1794.
13. Shindo T, Kurihara H, Maemura K, Kurihara Y, Kuwaki T, Izumida T,
Minamino N, Ju KH, Morita H, Oh-hashi Y, Kumada M, Kangawa K,
Nagai R, Yazaki Y. Hypotension and resistance to lipopolysaccharideinduced shock in transgenic mice overexpressing adrenomedullin in their
vasculature. Circulation. 2000;101:2309–2316.
14. Nishimatsu H, Hirata Y, Shindo T, Kurihara H, Kakoki M, Nagata D,
Hayakawa H, Satonaka H, Sata M, Tojo A, Suzuki E, Kangawa K, Matsuo
H, Kitamura T, Nagai R. Role of endogenous adrenomedullin in the regulation of vascular tone and ischemic renal injury: studies on transgenic/
knockout mice of adrenomedullin gene. Circ Res. 2002;90:657–663.
15.Fujii T, Nagaya N, Iwase T, Murakami S, Miyahara Y, Nishigami K,
Ishibashi-Ueda H, Shirai M, Itoh T, Ishino K, Sano S, Kangawa K, Mori
H. Adrenomedullin enhances therapeutic potency of bone marrow transplantation for myocardial infarction in rats. Am J Physiol Heart Circ
Physiol. 2005;288:H1444–H1450.
16. Nagaya N, Mori H, Murakami S, Kangawa K, Kitamura S. Adrenomedullin:
angiogenesis and gene therapy. Am J Physiol Regul Integr Comp Physiol.
2005;288:R1432–R1437.
17. Rademaker MT, Charles CJ, Lewis LK, Yandle TG, Cooper GJ, Coy DH,
Richards AM, Nicholls MG. Beneficial hemodynamic and renal effects of adrenomedullin in an ovine model of heart failure. Circulation. 1997;96:1983–1990.
18. Tsuruda T, Kato J, Kitamura K, Kuwasako K, Imamura T, Koiwaya Y,
Tsuji T, Kangawa K, Eto T. Adrenomedullin: a possible autocrine or
paracrine inhibitor of hypertrophy of cardiomyocytes. Hypertension.
1998;31(1 pt 2):505–510.
19. McLatchie LM, Fraser NJ, Main MJ, Wise A, Brown J, Thompson N, Solari
R, Lee MG, Foord SM. RAMPs regulate the transport and ligand specificity of the calcitonin-receptor-like receptor. Nature. 1998;393:333–339.
20. Ichikawa-Shindo Y, Sakurai T, Kamiyoshi A, Kawate H, Iinuma N, Yoshizawa
T, Koyama T, Fukuchi J, Iimuro S, Moriyama N, Kawakami H, Murata T,
Kangawa K, Nagai R, Shindo T. The GPCR modulator protein RAMP2 is
essential for angiogenesis and vascular integrity. J Clin Invest. 2008;118:29–39.
21.Bell D, Zhao YY, Kelso EJ, McHenry EM, Rush LM, Lamont VM,
Nicholls DP, McDermott BJ. Upregulation of adrenomedullin and its
receptor components during cardiomyocyte hypertrophy induced by
chronic inhibition of nitric oxide synthesis in rats. Am J Physiol Heart
Circ Physiol. 2006;290:H904–H914.
22. Sohal DS, Nghiem M, Crackower MA, Witt SA, Kimball TR, Tymitz KM,
Penninger JM, Molkentin JD. Temporally regulated and tissue-specific
gene manipulations in the adult and embryonic heart using a tamoxifeninducible Cre protein. Circ Res. 2001;89:20–25.
23. Horiuchi-Hirose M, Kashihara T, Nakada T, Kurebayashi N, Shimojo H,
Shibazaki T, Sheng X, Yano S, Hirose M, Hongo M, Sakurai T, Moriizumi
T, Ueda H, Yamada M. Decrease in the density of t-tubular L-type Ca2+
channel currents in failing ventricular myocytes. Am J Physiol Heart Circ
Physiol. 2011;300:H978–H988.
24. Nakada T, Flucher BE, Kashihara T, Sheng X, Shibazaki T, HoriuchiHirose M, Gomi S, Hirose M, Yamada M. The proximal C-terminus of
α1C subunits is necessary for junctional membrane targeting of cardiac
L-type calcium channels. Biochem J. 2012;448:221–231.
25. Bligh EG, Dyer WJ. A rapid method of total lipid extraction and purification. Can J Biochem Physiol. 1959;37:911–917.
26. Haines TH, Dencher NA. Cardiolipin: a proton trap for oxidative phosphorylation. FEBS Lett. 2002;528:35–39.
27.Eble KS, Coleman WB, Hantgan RR, Cunningham CC. Tightly
associated cardiolipin in the bovine heart mitochondrial ATP synthase as
analyzed by 31P nuclear magnetic resonance spectroscopy. J Biol Chem.
1990;265:19434–19440.
28. Schlame M, Ren M. Barth syndrome, a human disorder of cardiolipin
metabolism. FEBS Lett. 2006;580:5450–5455.
29. Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X,
Floering LM, Spiegelman BM, Collins S. p38 mitogen-activated protein
kinase is the central regulator of cyclic AMP-dependent transcription of the
brown fat uncoupling protein 1 gene. Mol Cell Biol. 2004;24:3057–3067.
30. Pogozelski AR, Geng T, Li P, Yin X, Lira VA, Zhang M, Chi JT, Yan Z.
p38gamma mitogen-activated protein kinase is a key regulator in skeletal
muscle metabolic adaptation in mice. PLoS ONE. 2009;4:e7934.
31. Wu H, Kanatous SB, Thurmond FA, Gallardo T, Isotani E, Bassel-Duby
R, Williams RS. Regulation of mitochondrial biogenesis in skeletal muscle by CaMK. Science. 2002;296:349–352.
32. Jäger S, Handschin C, St-Pierre J, Spiegelman BM. AMP-activated protein kinase (AMPK) action in skeletal muscle via direct phosphorylation
of PGC-1alpha. Proc Natl Acad Sci USA. 2007;104:12017–12022.
33. Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM, Puigserver P.
Nutrient control of glucose homeostasis through a complex of PGC1alpha and SIRT1. Nature. 2005;434:113–118.
Yoshizawa et al AM-RAMP2 in Cardiac Homeostasis 351
34. Gerhart-Hines Z, Rodgers JT, Bare O, Lerin C, Kim SH, Mostoslavsky R,
Alt FW, Wu Z, Puigserver P. Metabolic control of muscle mitochondrial
function and fatty acid oxidation through SIRT1/PGC-1alpha. EMBO J.
2007;26:1913–1923.
35. Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz
G, Yoon C, Puigserver P, Spiegelman B, Montminy M. CREB regulates hepatic
gluconeogenesis through the coactivator PGC-1. Nature. 2001;413:179–183.
36. Schauer IE, Knaub LA, Lloyd M, Watson PA, Gliwa C, Lewis KE, Chait A,
Klemm DJ, Gunter JM, Bouchard R, McDonald TO, O’Brien KD, Reusch
JE. CREB downregulation in vascular disease: a common response to cardiovascular risk. Arterioscler Thromb Vasc Biol. 2010;30:733–741.
37. Fentzke RC, Korcarz CE, Lang RM, Lin H, Leiden JM. Dilated cardiomyopathy in transgenic mice expressing a dominant-negative CREB transcription factor in the heart. J Clin Invest. 1998;101:2415–2426.
38. Watson PA, Birdsey N, Huggins GS, Svensson E, Heppe D, Knaub L.
Cardiac-specific overexpression of dominant-negative CREB leads to
increased mortality and mitochondrial dysfunction in female mice. Am J
Physiol Heart Circ Physiol. 2010;299:H2056–H2068.
39. Shimekake Y, Nagata K, Ohta S, Kambayashi Y, Teraoka H, Kitamura
K, Eto T, Kangawa K, Matsuo H. Adrenomedullin stimulates two signal
transduction pathways, cAMP accumulation and Ca2+ mobilization, in
bovine aortic endothelial cells. J Biol Chem. 1995;270:4412–4417.
40. Yanagawa B, Nagaya N. Adrenomedullin: molecular mechanisms and its
role in cardiac disease. Amino Acids. 2007;32:157–164.
41. Du K, Montminy M. CREB is a regulatory target for the protein kinase
Akt/PKB. J Biol Chem. 1998;273:32377–32379.
42. Sheng M, Thompson MA, Greenberg ME. CREB: a Ca(2+)-regulated
transcription factor phosphorylated by calmodulin-dependent kinases.
Science. 1991;252:1427–1430.
43.Gonzalez GA, Montminy MR. Cyclic AMP stimulates somatostatin
gene transcription by phosphorylation of CREB at serine 133. Cell.
1989;59:675–680.
Novelty and Significance
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
What Is New?
What Is Relevant?
• By generating cardiac myocyte-specific RAMP2 deletion model mouse
• AM is a promising therapeutic molecule for treating hypertensive diseases
(C-RAMP2−/−), we directly proved the critical roles of AM-RAMP2 system
in the heart.
• C-RAMP2−/− developed dilated cardiomyopathy-like heart failure.
• We found novel regulation of cardiac mitochondrial function by the AMRAMP2 system.
through its well-known vasodilative function. In this study, we proved that
the AM-RAMP2 system also directly regulates cardiac metabolism and homeostasis.
Summary
AM-RAMP2 system is a promising therapeutic target for heart failure in addition to hypertension.
Downloaded from http://hyper.ahajournals.org/ by guest on June 18, 2017
Novel Regulation of Cardiac Metabolism and Homeostasis by the
Adrenomedullin-Receptor Activity-Modifying Protein 2 System
Takahiro Yoshizawa, Takayuki Sakurai, Akiko Kamiyoshi, Yuka Ichikawa-Shindo, Hisaka
Kawate, Yasuhiro Iesato, Teruhide Koyama, Ryuichi Uetake, Lei Yang, Akihiro Yamauchi,
Megumu Tanaka, Yuichi Toriyama, Kyoko Igarashi, Tsutomu Nakada, Toshihide Kashihara,
Mitsuhiko Yamada, Hayato Kawakami, Hiroki Nakanishi, Ryo Taguchi, Tsuyoshi Nakanishi,
Hiroshi Akazawa and Takayuki Shindo
Hypertension. 2013;61:341-351; originally published online January 7, 2013;
doi: 10.1161/HYPERTENSIONAHA.111.00647
Hypertension is published by the American Heart Association, 7272 Greenville Avenue, Dallas, TX 75231
Copyright © 2013 American Heart Association, Inc. All rights reserved.
Print ISSN: 0194-911X. Online ISSN: 1524-4563
The online version of this article, along with updated information and services, is located on the
World Wide Web at:
http://hyper.ahajournals.org/content/61/2/341
Data Supplement (unedited) at:
http://hyper.ahajournals.org/content/suppl/2013/01/07/HYPERTENSIONAHA.111.00647.DC1
Permissions: Requests for permissions to reproduce figures, tables, or portions of articles originally published
in Hypertension can be obtained via RightsLink, a service of the Copyright Clearance Center, not the Editorial
Office. Once the online version of the published article for which permission is being requested is located,
click Request Permissions in the middle column of the Web page under Services. Further information about
this process is available in the Permissions and Rights Question and Answer document.
Reprints: Information about reprints can be found online at:
http://www.lww.com/reprints
Subscriptions: Information about subscribing to Hypertension is online at:
http://hyper.ahajournals.org//subscriptions/
Novel Regulation of Cardiac
Adrenomedullin-RAMP2 System
Metabolism
and
Homeostasis
by
the
Takahiro Yoshizawa1,7, Takayuki Sakurai Ph.D.1, Akiko Kamiyoshi Ph.D. 1, Yuka
Ichikawa-Shindo M.D., Ph.D.1, Hisaka Kawate1, Yasuhiro Iesato M.D.1, Teruhide
Koyama1,7, Ryuichi Uetake1, Lei Yang1, Akihiro Yamauchi1, Megumu Tanaka1, Yuichi
Toriyama1, Kyoko Igarashi1, Tsutomu Nakada Ph.D.2, Toshihide Kashihara Ph.D.2,
Mitsuhiko Yamada M.D., Ph.D.2, Hayato Kawakami M.D., Ph.D.3, Hiroki Nakanishi
Ph.D.4, Ryo Taguchi Ph.D.5, Tsuyoshi Nakanishi Ph.D.5, Hiroshi Akazawa M.D.,
Ph.D.6, Takayuki Shindo M.D., Ph.D.1
1
Department of Cardiovascular Research, Shinshu University Graduate School of
Medicine
2
Department of Molecular Pharmacology, Shinshu University Graduate School of
Medicine
3
Department of Anatomy, Kyorin University School of Medicine
4
Department of Metabolome, Graduate School of Medicine, The University of Tokyo
5
Applications Development Center, Shimadzu Corporation
6
Department of Cardiovascular Regenerative Medicine, Osaka University Graduate
School of Medicine
7
Research Fellow of the Japan Society for the Promotion of Science
Short title: AM-RAMP2 in cardiac homeostasis
Address for correspondence
Takayuki Shindo, MD, PhD
Department of Cardiovascular Research,
Shinshu University Graduate School of Medicine
Asahi 3-1-1, Matsumoto, Nagano, 390-8621, Japan
Tel: +81-263-37-3192
Fax: +81-263-37-3437
Email: [email protected]
Supplementary Methods
Echocardiography
Mice were set in a supine position.
Two-dimensional (2D) guided M-mode
echocardiography was performed using a Vevo 2100 imaging system (VisualSonics,
Toronto, Canada). The heart at the level of the left ventricle (LV) papillary muscle was
imaged in the 2D mode using a parasternal short-axis view at a depth setting of 13 mm.
Histological examination
Heart sections were fixed in 10% formalin neutral buffer, embedded in paraffin, and
cut into 5 µm thick sections.
Some samples were used for H&E staining.
Immunohistochemical staining of 4-hydroxy-2-nonenal (4HNE) was preformed using
an anti-4-HNE antibody (NOF Corporation, Japan).
A biotin-conjugated goat
anti-mouse antibody, a Histofine MOUSESTAIN KIT (mouse on mouse system,
Nichirei, Japan), and 3,3’-diaminobenzidine (DAB) were used to visualize labeling. To
quantify cardiac interstitial fibrosis, images of Masson trichrome staining were captured
with a digital camera and analyzed using Scion Image software.
Transmission electron microscopy
Specimens were fixed in 2% glutaraldehyde (pH 7.2) and 4% osmium tetroxide,
embedded in epoxy resin (Epok) 812 (Oken Shoji, Japan), cut into ultrathin sections,
double-stained with uranyl acetate and lead citrate, and examined in an electron
microscope (JEM-1010; Jeol, Japan).
TEMPOL and Forskolin treatment
For TEMPOL experiments, mice were administered TEMPOL (10 mmol/L; Alexis
Biochemicals) in drinking water for 7 days. Control mice received tap water. For the
forskolin experiments, mice were administered forskolin (Calbiochem) intrapleurally
once a day for 7 days at a dose of 0.4 mg/kg/day. Forskolin was dissolved in DMSO
and then further diluted in PBS. Control mice received the vehicle. For in vitro
analysis, cultured cardiac myocytes were treated with 20 nM forskolin.
Quantitative reverse transcriptase PCR analysis
Total RNA was extracted from tissues using Trireagent (Molecular Research Center,
Inc.), after which the RNA was treated with DNA-free (Ambion) to remove
contaminating DNA and subjected to reverse transcription using a High Capacity cDNA
Reverse Transcription Kit (Applied Biosystems).
Quantitative reverse transcriptase
PCR analysis was carried out using an ABI Prism 7300 Sequence Detection System
(Applied Biosystems) with SYBER Green (Toyobo, Japan). Values were normalized to
GAPD (TaqMan Ribosomal RNA Control Reagents VIC probe; Applied Biosystems).
The primers and probes used are listed in Table S1.
Analysis of phospholipid molecular species
The mouse hearts were homogenized with chloroform/methanol (1:2), and
phospholipids such as cardiolipin (CL) were extracted by the Bligh and Dyer method25.
The total lipid extracts were dried under a gentle stream of nitrogen gas and were
re-dissolved in 1 mL of chloroform/methanol (1:1).
Lipid extracts were separated on a Develosil C30 (3.0 µm, 150 mm × 1.0 mm i.d.)
column (Nomura Chemical Co. Ltd., Japan) using a liquid chromatography system
consisting of two Shimadzu LC10ADvp micro-pumps, an SCL-10Avp controller
(Shimadzu, Japan), an HTC PAL autosampler (CTC Analysis, Switzerland), and
Chromeleon software (Dionex, CA), and were measured by a full scan of precursor ions
(MS1) within m/z 400–2000 in negative ion mode using an LTQ Orbitrap mass
spectrometer (Thermo-Fisher Scientific, MA), as described previously with several
modifications.
CL species were identified by the exact mass value (within 5 ppm accuracy) and LC
retention time. MS/MS (MS2) and MS/MS/MS (MS3) measurements at a collision
energy setting of 35% were performed as needed. An LTQ-Orbitrap analyzer was used
for quantification of each precursor ion, and an LTQ-IT analyzer was used for MS3
measurement.
On-Tissue MALDI-MS imaging analysis
Mass spectra were obtained with an accelerating voltage of 20 kV, a mass range of
1–2,000 Da, and “pulsed extraction mass” set to 1,500 Da. The mass spectrometer was
calibrated with spotted angiotensin II and 9-aminoacridine, which had a mass-to-charge
ratio (m/z) of 1,044.52 and 193.07, respectively, in the negative mode.
Western blot analysis
Heart tissue was lysed in an ice-cold RIPA Lysis Buffer System (Santa Cruz)
supplemented with PosSTOP phosphatase inhibitor (Roche Applied Science) and then
sonicated. Samples of the resultant lysate (40-60 µg) were subjected to SDS-PAGE,
and the resolved proteins were transferred to cellulose nitrate membranes (GE
Healthcare). After blocking in 5% skim milk, the membranes were incubated with
primary antibodies against CREB (Abcam) and phospho-CREB (Abcam), followed by
appropriate secondary antibodies (Santa Cruz). The bound antibodies were visualized
using chemiluminescent HRP substrate (MILLIPORE), and the chemiluminescence was
analyzed using an Image Quant LAS 4000 system (GE Healthcare). Levels of CREB
activation were determined based on the ratio of band intensities after blotting with
antibodies specific for the phosphorylated and unphosphorylated proteins.
For
quantification, Western blot images were captured and analyzed using Scion Image
software.
cAMP measurement
The cAMP content of cardiac myocytes was measured using a cAMP Biotrak
Enzyme Immunoassay System (Amersham).
Isolation of embryonic cardiac myocytes
Collected embryonic heart was washed in PBS, minced, and incubated with 0.05%
trypsin-EDTA (GIBCO) for 10 min at 37°C with agitation. During this period, the
digestion buffer was replaced 3 times. The dispersed cells were filtered through 40-µm
nylon mesh (BD Falcon) and then incubated in culture dishes for 60 min to remove
non-myocytes. Unattached viable cells were collected and cultured on gelatin-coated
dishes at 37°C in MEM supplemented with 10% FBS and penicillin/streptomycin.
Using this protocol, we consistently obtained cell populations containing at least 80%
cardiac myocytes.
Isolation of adult cardiac myocytes
A heart mounted on a Langendorff apparatus was digested with Ca2+-free Tyrode
solution containing 0.80 mg/ml collagenase, 0.06 mg/ml protease (Sigma-Aldrich, Inc.),
1.20 mg/ml hyaluronidase (Sigma-Aldrich, Inc.), 0.03 mg/ml DNase I (F. Hoffmann-La
Roche Ltd., Basel, Switzerland), and 0.50 mg/ml bovine serum albumin at 37°C for 2
min. Isolated ventricular myocytes were suspended in Ca2+-free Tyrode solution
containing 1 mg/ml bovine serum albumin at room temperature, and the Ca2+
concentration was gradually increased to 1.8 mmol/L.
Ca2+ imaging
Ca2+ imaging was performed as previously described (Nakada et al, 2012, Biochem.
J. 448: 221-231). Briefly, cardiac myocytes plated on laminin-coated glass bottom
dishes were incubated with 5 µM Fluo-4-AM (Dojindo) plus 0.01% Cremophore EL
(Sigma) and 0.02% bovine serum albumin (Sigma) in serum-free DMEM for 45 min at
37ºC followed by de-esterification. Cardiac myocytes were superfused with the
modified Tyrode solution (136.5 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 0.53 mM
MgCl2, 5.5 mM HEPES, and 5.5 mM glucose, pH 7.4) at room temperature and paced
with 1-ms pulses of 50 V at 0.5 Hz. Fluorescence images were acquired with an LSM 7
LIVE laser scanning microscope (Zeiss). Ca2+ transient was assessed from the changes
in fluorescence in individual cardiac myocytes in the presence or absence of 10-7 M
AM.
Mitochondrial DNA determination
Heart tissue was collected and treated in 0.5 mL of 0.25 mg/mL proteinase K
(Invitrogen) solution at 55°C for 3 h. The lysate was mixed in phenol/chloroform
(Wako, Japan) for 1 h. The supernatant was transferred to a 2 mL Eppendorf tube
containing 0.5 mL chloroform and mixed. After centrifugation (9000 g for 10 min), the
supernatant was transferred to a 1.5 mL Eppendorf tube containing 1 mL ethanol. The
tube was maintained at -20°C for 1 h and centrifuged (18,000 g, 10 min) to collect the
DNA pellet. The DNA pellet was washed with 1 mL 70% ethanol, dried, and dissolved
in 0.2 mL Tris-EDTA (TE) buffer.
Mitochondrial DNA (mtDNA): The nuclear DNA (nDNA) ratio was determined
using a real-time PCR system (ABI Prism 7300 Sequence Detection System) with
SYBER Green (Toyobo, Japan). The cytochrome c oxidase subunit 1 (COX1) gene of
the mtDNA and the NDUFV1 nDNA gene was measured. The COX1 primers were
5-TGC TAG CCG CAG GCA TTA C-3 (forward primer) and 5-GGG TGC CCA AAG
AAT CAG AAC-3 (reverse primer). The NDUFV1 primers were 5-CTT CCC CAC
TGG CCT CAA G-3 (forward primer) and 5-CCA AAA CCC AGT GAT CCA GC-3
(reverse primer). Values were normalized to NDUFV1.
Table S1
Primers used for quantitative reverse transcriptase PCR analysis.
sequence (5' to 3')
gene
F
TCCAGAGCAATTCAAGATGCA
R
GTCTTTTCATTGCCGCTTCC
F
GGCAGGATGAGGATGTGACAT
R
CTGGGCTGAAGGGCTTAATTC
F
GGCACGCAGCCCTATTCA
R
CGACACGGAGAGTTAAAGGAAGA
F
CCTCTCCAGGCAGGTTCAAC
R
GGCCAGAAGTTCCCTTAGGATAG
F
GGGATTGTGCACGTGCTTAA
R
TTTGGGAAGAGGAAGGTGTCA
F
GTACTGCAGAGTGTGTGGATGGA
R
TCTAGGACCAGGTCCTCAGCAA
F
CGATCATCATGACTATGCGCTACT
R
GCCGTGCTCTGCAAACATC
F
ATCCCCTGGATATGTCCCAATA
R
CATCACGACTGGGTTTGGGTAT
F
CACTTACTATGCCTCGATTGCAA
R
CGGCGTCAGTGGCTAGCT
ATP synthase
F
AGGCTATCTATGTGCCTGCTGAT
(F1 complex β subunit)
R
GCATCCAAATGGGCAAAGG
COX IV
F
GGTGGCCATCGAGACCAA
R
GGCGGAGAAGCCCTGAAT
F
AACGCTCCCCTAGGCAGGTA
R
CCCTCCTGAGCCACCATCT
F
TTACAGATTGCTGCCTGCTCTAAT
R
ATCCCCAGCAGCGGAATAA
BNP
SERCA2
PGC-1α
PGC-1β
PPAR-α
ERR-α
CPT-1α
CPT-2
MCAD
UCP3
SOD2
A
Control
Tam.
100
EF (%)
FS (%)
50
25
0
Control
Tam.
LVDs (mm)
B
50
*
0
Control
Tam.
4
2
0
Control
Tam.
Figure S1 Tamoxifen-treated αMHC-MerCreMer Tg mice without the RAMP2-flox region. (A) Representative
transthoracic M-mode echocardiogram. (B) Tamoxifen-treated mice (Tamox) showed no changes in the fractional
shortening (FS), ejection fraction (EF), and systolic left ventricular dimension (LVDs) compared with control mice.