Download View - OhioLINK Electronic Theses and Dissertations Center

The Regulation of Ontogenetic Diversity in Papaveraceae Compound Leaf Development
A thesis presented to
the faculty of
the College of Arts and Sciences of Ohio University
In partial fulfillment
of the requirements for the degree
Master of Science
Alastair R. Plant
August 2013
© 2013 Alastair R. Plant. All Rights Reserved.
2
This thesis titled
The Regulation of Ontogenetic Diversity in Papaveraceae Compound Leaf Development
by
ALASTAIR R PLANT
has been approved for
the Department of Environmental and Plant Biology
and the College of Arts and Sciences by
Stefan Gleissberg
Assistant Professor of Environmental and Plant Biology
Robert Frank
Dean, College of Arts and Sciences
3
ABSTRACT
PLANT, ALASTAIR R., M.S., August 2013, Plant Biology
The Regulation of Ontogenetic Diversity in Papaveraceae Compound Leaf Development
Director of Thesis: Stefan Gleissberg
The leaf is almost ubiquitous throughout land plants but due to its complex and
flexible developmental program is highly morphologically variable between taxa.
Description of the functions of regulatory genes key to leaf development in different
evolutionary lineages allows the study of changes in developmental mechanisms through
evolutionary time as a means for anatomical and morphological diversification. The
roles of homologs of CINCINNATA-like TCP family genes, ARP genes, and Class I
KNOX genes were investigated in two members of the Papaveraceae, a basal eudicot
lineage positioned in between major angiosperm groups, by phylogenetic analysis, in situ
hybridization, expression profiling by quantitative polymerase chain reaction, and virusinduced gene silencing in Eschscholzia californica and Cysticapnos vesicaria.
Expression data were similar to those for homologous genes in core eudicot species,
however, some gene functions found in core eudicots were not associated with basal
eudicot homologs, and so have either been gained or lost from the ancestral state. This
reflects the dynamism of the leaf developmental plan and its diversification through
evolution.
4
DEDICATION
This thesis is dedicated to curiosity.
5
ACKNOWLEDGMENTS
I would like to thank those who have contributed to this body of research: Anandi
Bhattacharya cloned the TCP domain of Eschscholzia californica CINCINNATA
(EcCIN), Stefan Gleissberg cloned EcPHAN and performed the EcPHAN expression
profile RT-PCR, and Andrea Scholz produced the Eschscholzia californica
PHANTASTICA (EcPHAN) VIGS construct.
I would also like to thank my advisor Stefan Gleissberg and my committee
members Harvey Ballard, and Sarah Wyatt for their assistance and guidance, Oriane
Hidalgo and Conny Bartholmes for training and advice, and undergraduate researchers
Celeste Taylor, Avery Tucker, Brooke Johnson, Ben Imbus, Chi Zhang, Emily Usher,
Jennifer Leetch, and Abby Pugel for their help in data collection and in being a source of
new ideas and inspiration. This research was funded in part by an Ohio University
Research Committee Grant.
6
TABLE OF CONTENTS
Page
Abstract ............................................................................................................................... 3
Dedication ........................................................................................................................... 4
Acknowledgments............................................................................................................... 5
List of Tables ...................................................................................................................... 8
List of Figures ..................................................................................................................... 9
Chapter 1: Introduction ..................................................................................................... 12
References ..................................................................................................................... 20
Chapter 2: Regulation of dissected leaf architecture in Eschscholzia californica By a
CIN-TCP gene .................................................................................................................. 28
Abstract ......................................................................................................................... 28
Introduction ................................................................................................................... 29
Methods ........................................................................................................................ 33
Results ........................................................................................................................... 44
Discussion ..................................................................................................................... 56
References ..................................................................................................................... 59
Chapter 3: Eschscholzia californica PHANTASTICA (EcPHAN) regulates petal
morphogenesis in the California Poppy ............................................................................ 65
Abstract ......................................................................................................................... 65
Introduction ................................................................................................................... 65
Methods ........................................................................................................................ 69
Results ........................................................................................................................... 71
Discussion ..................................................................................................................... 77
References ..................................................................................................................... 80
Chapter 4: Duplicated STM-like KNOX I genes act in floral meristem activity in
Eschscholzia californica (Papaveraceae) .......................................................................... 86
Authors.......................................................................................................................... 86
Abstract ......................................................................................................................... 86
Introduction ................................................................................................................... 87
7
Materials and Methods.................................................................................................. 91
Results ........................................................................................................................... 95
Discussion ................................................................................................................... 110
Acknowledgements ..................................................................................................... 117
Author Contributions .................................................................................................. 117
References ................................................................................................................... 118
Supplementary Data ................................................................................................ 128
Chapter 5: Laser microdissection of Eschscholzia californica leaf primordia for
comparison of gene expression between developmental stages ..................................... 134
Abstract ....................................................................................................................... 134
Introduction ................................................................................................................. 134
Method ........................................................................................................................ 138
Results ......................................................................................................................... 141
Discussion ................................................................................................................... 143
Acknowledgements ..................................................................................................... 146
References ................................................................................................................... 146
Chapter 6: Discussion ..................................................................................................... 149
References ................................................................................................................... 151
Appendix I: Cloning of putative microRNA319 homologs from Eschscholzia californica
......................................................................................................................................... 153
References ................................................................................................................... 156
Appendix II: Cloning of gibberellic acid and cytokinin metabolic genes from
Eschscholzia californica ................................................................................................. 158
References ................................................................................................................... 162
8
LIST OF TABLES
Page
Table 1: Primers used for cloning, in situ hybridization probe preparation and quantitative
PCR for CIN-TCP genes .................................................................................................43
Table 2: Primers used for amplification of KNOX genes.............................................132
Table 3: Sequence IDs for KNOX genes used in phylogenetic analyses ......................133
9
LIST OF FIGURES
Page
Figure 1: Summary of interactions between selected major regulators of leaf development
.........................................................................................................................................17
Figure 2: Eschscholzia TCP gene structures ...................................................................44
Figure 3: Phylogeny of amino acid sequences putatively translated from Papaveraceae
and Arabidopsis thaliana CIN-TCP genes .....................................................................46
Figure 4: Expression profiles of EcCIN, EcTCP2-LIKE and EcTCP5-LIKE in wild-type
Eschscholzia californica tissues .....................................................................................47
Figure 5: In situ hybridization of EcCIN mRNA in wild type Eschscholzia
californica .......................................................................................................................48
Figure 6: Box and violin plots of total leaflets per node in plants infiltrated with pTRV2empty (control), pTRV2-3’-specific and pTRV2 –TCP-domain constructs
.........................................................................................................................................49
Figure 7: Phenotypic effects of silencing EcCIN with TCP-domain-specific and
unconserved 3’-end-specific VIGS constructs................................................................50
Figure 8: pTRV2-control and pTRV2-CvCIN plants......................................................52
Figure 9: Box and violin plots for leaflets per node in pTRV2-empty and pTRV2-CvCIN
plants ...............................................................................................................................53
Figure 10: Quantitative PCR shows decreased expression of CvCIN in pTRV2-CvCINtreated VIGS plants .........................................................................................................54
Figure 11: Box and violin plots of total leaflets per node for pTRV2-EcCIN-3’, pTRV2EcTCP2-LIKE, and pTRV2-EcTCP5-LIKE plants. ........................................................55
10
Figure 12: Phylogeny of ASYMMETRIC LEAVES 1, ROUGH SHEATH 2 and
PHANTASTICA and their homologs in the Papaveraceae and in the basal angiosperm
Amborella trichopoda .....................................................................................................72
Figure 13: RT-PCR expression profile of EcPHAN .......................................................73
Figure 14: VIGS-induced EcPHAN knockdown phenotypes ..........................................75
Figure 15: Scanning electron microscopy of petals exhibiting the EcPHAN knockdown
phenotype ........................................................................................................................76
Figure 16: Domain structure of the hypothetical proteins encoded by the four class I
KNOX genes in Eschscholzia californica. ......................................................................96
Figure 17: Phylogram of angiosperm KNOX I genes .....................................................98
Figure 18: Expression profiles of Eschscholzia californica class I KNOX genes using
semi-quantitative RT-PCR. .............................................................................................99
Figure 19 Floral phenotypes of EcSTM1, EcSTM2, and EcSTM1+2 silenced Eschscholzia
californica plants
.......................................................................................................................................101
Figure 20: Scanning electron micrographs and longitudinal sections of EcSTM-VIGS
floral buds.
.......................................................................................................................................102
Figure 21: Reduced gynoecium and flowers in EcSTM-silenced Eschscholzia plants.
.......................................................................................................................................103
Figure 22: Stamen numbers in EcSTM-silenced Eschscholzia flowers.
.......................................................................................................................................104
Figure 23: Spectrum of floral organ initiation defects in EcSTM-VIGS flowers.
.......................................................................................................................................107
Figure 24: Homeotic organ transformations in EcSTM-VIGS plants.
.......................................................................................................................................108
11
Figure 25: Additional pseudowhorls in Eschscholzia shoots.
.......................................................................................................................................109
Figure 26: Phylogram of selected angiosperm KNOX nucleotide sequences
(supplemental)
.......................................................................................................................................128
Figure 27: Phylogram of poppy and few selected other eudicot KNOX I deduced amino
acid sequences (supplemental).
.......................................................................................................................................129
Figure 28: Semi-quantitative RT-PCR of STM-like genes in floral terminal flower buds of
VIGS-treated Eschscholzia californica (supplemental).
.......................................................................................................................................129
Figure 29: Distribution of stamen numbers in EcSTM-silenced and control flowers
(supplemental).
.......................................................................................................................................130
Figure 30: Degree of leaf dissection in KNOX I-silenced and control leaves
(supplemental)...............................................................................................................131
Figure 31: Laser microdissection enables profiling of gene expression at different stages
of leaf development.......................................................................................................142
Figure 32. 2-D centroid model for an Eschscholzia californica premiRNA319 sequence
.......................................................................................................................................154
12
CHAPTER 1: INTRODUCTION
The establishment of macroscopic form and structure from a multitude of
interactions between the molecular agents of the cell is a remarkable, if not elegant
process. For evolution to render but a single form would be considered an achievement,
yet morphological and anatomical diversity extend far beyond the single plan. The
source of such diversity is development, the four-dimensional product of genetic,
molecular and biomechanical interactions at the cellular, tissue and organismal levels,
and its malleability. Modification of the hereditary aspects of developmental processes
through evolution has borne the array of phenotypic diversity visible today, and is the
subject of the field entitled evolutionary-developmental biology, or ‘evo-devo’. A
primarily genetic approach has been taken; changes to the expression, functions and/or
interactions between genes involved in development have the potential to modify existing
architecture or to produce entirely new arrangements. The broader question asks which
changes were necessary to the evolution of new forms and structures, the more specific
asking what subtle changes must occur to produce diversity over short periods of
evolutionary time, even at the species level. This original thesis places emphasis on the
latter, and explores how the differing employment of certain genes may result in
development differences between taxa and lineages, commenting upon the importance of
regulatory genes in development.
The development of the plant leaf shares with other developmental processes an
abundance of characteristics: founder cells arising from a source of indeterminate cells
must divide, expand and differentiate along axes (proximodistal, mediolateral, and
13
dorsiventral), and assemble into gross morphological structures (the blade and any
marginal appendages, and the petiole) while establishing histological patterns within, to
render an adaptive structure to the benefit of its host organism. Its roles in gas exchange
and transpiration, thermoregulation, and photosynthesis doubtlessly offer selective
advantages, to the extent that the bladed, vascularized leaves often termed megaphylls
have evolved independently in multiple lineages of the plant kingdom (Tomescu, 2009).
In the majority of plant species, leaves are determinate structures, and the morphology of
the leaf is sculpted in its primordial stages. Primordia that will become compound leaves
must not only pattern a simple lamina but must also initiate perhaps multiple orders of
dissections that give rise to lobes, leaflets, and serrations at maturity from the margins of
the blade where morphogenetic competency to produce new structures is retained, i.e.
expansion and differentiation are postponed. Formation of the specialized histology of
the leaf begins comparatively late in development during histogenesis, to which
morphogenesis eventually defers.
A host of genes are involved in the initiation of the incipient primordium, the
establishment and maintenance of the axes of growth, the morphogenetic patterning of
the blade, the transition to histogenesis and loss of morphogenetic competency,
histogenesis itself, and the expansion of the leaf to its size at maturity.
At the start of development, accumulation of auxin and downregulation of Class I
KNOX (KNOTTED homeobox) genes at a phyllotactically determined site indicates the
induction of the incipient primordium in the peripheral zone of the shoot apical meristem
(SAM) (Bharathan et al., 2002; Blein et al., 2010). These genes, of which there are four
14
in Arabidopsis, perform partially redundant functions in shoot apical meristem
maintenance (Hay and Tsiantis, 2010). KNOX downregulation by the ARP genes
(named after ASYMMETRIC LEAVES 1, ROUGH SHEATH 2 and PHANTASTICA)
diverts the cells from the meristematic indeterminacy of the SAM (Guo et al., 2008).
Induction is followed by morphogenesis, in which phase cell division is the main mode of
morphological change. In compound leaves, the expression of KNOX genes resumes
after establishment of the primordium (Bharathan et al., 2002, Hay and Tsiantis, 2006).
Proximodistal, dorsiventral and mediolateral axes are established and maintained
by the expression of mutually antagonistic genes in adjacent domains, promoting regionspecific cell identities. In Zea mays, the Class I KNOX gene KNOTTED1 has been
implicated in proximodistal patterning (Ramirez et al., 2009) and mutants of the kinase
LIGULELESS NARROW have disrupted proximodistal and mediolateral patterning
(Moon et al., 2013), but a broad understanding of the genetic specification of these axes
is lacking. In contrast, dorsiventral patterning is better described. The ARP genes
contribute to the specification of adaxial identity (Eckhardt, 2004), although this is
achieved primarily through stable regulation of KNOX gene expression (Guo et al.,
2008); the Class III homeodomain leucine zipper (HD-ZIP) genes PHABULOSA,
PHAVOLUTA and REVOLUTA are more specific contributors (Prigge et al., 2005), and
counteract the abaxial identity genes that include the YABBY family (which also promote
lamina expansion – Sarojam et al., 2010) and KANADI (Kerstetter et al., 2001).
Auxin remains concentrated at the primordial apex as a result of polar auxin
transport, mediated by the arrangement of auxin efflux proteins of the PIN-FORMED
15
family (although pin1 mutants are capable of leaf formation, indicating the involvement
of other mechanisms – Guenot et al., 2012). In compound leaves, auxin also accumulates
at leaflet initiation sites (Kawamura et al., 2010). After such sites are marked, CUPSHAPED COTYLEDONS (CUC) genes, first associated with boundary formation in
embryonic development are expressed in the distal region adjacent to the sinus (Blein,
2010). In numerous species, the CUC genes promote resumed expression of the Class I
KNOX genes that were downregulated upon induction of the leaf primordium. KNOX
expression may maintain the indeterminate fates of those cells at the margin and prolong
cell division (Hay and Tsiantis, 2010), providing additional cells that are funneled into
the developing structures at the margin (Kawamura et al., 2010). An alternate
mechanism for promoting leaflet development exists in the Inverted Repeat Lacking
Clade of the Fabaceae, where UNIFOLIATA, a homologue of the Solanum lycopersicum
gene FALSIFLORA, fulfills a similar function to the KNOX genes (Champagne et al.,
2007; Molinero-Rosales et al., 1999).
Marginal elaboration is not indefinite. Cessation of new leaflet formation and
progression into histogenesis requires the genetically orchestrated reduction in expression
of cytokinins and increased expression of gibberellins to limit cell division and promote
cell elongation and differentiation. One key actor in these events is CINCINNATA
(Antirrhinum majus), homologous to LANCEOLATE in Solanum lycopersicum and TCPs
3, 4, and 10 in Arabidopsis thaliana (Crawford et al., 2004). It is a member of the TCP
transcription factor family, named after TEOSINTE BRANCHED 1, CINCINNATA, and
PROLIFERATING CELL FACTORS 1 & 2. CINCINNATA promotes maturation of leaf
16
primordium via several regulatory pathways: antagonism of cell cycle progression from
G1 to S phase to limit cell division (Aggarwal et al., 2011); prevention of leaflet and
sinus formation by suppression of the CUC genes through miRNA 164 (Koyama et al.,
2010); direct interaction with the ARP genes (Koyama et al., 2010) and their interacting
partner ASYMMETRIC LEAVES 2 to downregulate multiple Class I KNOX genes (Li et
al., 2012); and, hypothetically, limitation of the auxin response via maintenance or
upregulation of INDOLE-3-ACETIC ACID3/SHORT HYPOCOTYL2 (IAA/SHY2) and
SMALL AUXIN UP RNA (SAUR) (Koyama et al., 2010). CINCINNATA itself is
negatively regulated by microRNA 319, which also represses its relatives in the CIN-TCP
(Class II) subclade of the TCP family. A gradual increase in CINCINNATA expression
and the release of miRNA repression herald the onset of maturation (Shleizer-Burko et
al., 2011).
The sustenance of indeterminacy and cell division in the margins of the leaf,
promoted by KNOX but opposed by CINCINNATA and the ARP genes (Figure 1), may
determine the degree of dissection in that leaf, permitting higher orders of dissection or
the formation of more frequent structures (Hagemann and Gleissberg, 1996), and may
therefore offer an explanation for the breadth of leaf morphologies in existence. The
genetic regulatory networks governing leaf development would certainly have been
subject to selective pressure when species expanded into new ranges; numerous authors
have speculated that, in combination with anatomical and morphological characteristics
such as venation pattern and blade depth, dissection of the leaf blade to form a compound
leaf provides an adaptive advantage in new environs where, for example, dissection may
17
reduce mechanical stress in high winds, or conserve moisture by removing tissue that is
more distant from veins (reviewed in Nicotra et al. 2011). Subtle changes in the
expression of these key players may have radical effects. For example, alteration of
PHANTASTICA expression can change the patterning of dissection from pinnate,
palmate, to simple (Kim et al., 2003). Numerous genera exhibit an equal or greater range
of morphological diversity (Nicotra et al., 2011, Jones et al., 2009), despite the similarity
of their developmental plans inherited from their common ancestry, due to differential
integration between genetic regulatory networks and modules (Klingenberg, 2008;
Klingenberg et al., 2011).
YABBYs
Ori et al. (2007)
miRNA319
Sarojam et al.
(2010)
CINCINNATA
Koyama et al.
Koyama et al.
(2010)
(2010)
miRNA164a
Nikovics et al.
(2006)
CUP-SHAPED COTYLEDONS
Kawamura et al.
Guo et al.
(2008)
AS1/RS2/PHAN + AS2
Timmermans
et al. (1999)
Waites et al.
(1998)
(2010)
SHOOTMERISTEMLESS & Class I KNOX
Figure 1. Summary of interactions between selected major regulators of leaf
development.
18
While biologically interesting, such developmental flexibility does not lend itself
to the study of the original application of a given gene regulatory network to a
developmental process such as leaf development. To give an example, the existence of
KNOX genes precedes not only the existence of the leaf but also the existence of the
shoot apical meristem, and the time of the first employment of KNOX in leaf
development is unknown (Bharathan et al., 2002).
One means by which to trace the evolutionary histories and importance of genes
and the importance of their regulatory networks and modules throughout evolutionary
history is to establish new species as phylogenetic landmarks at which the roles of those
genes are described, so that an image of their diversification can be constructed. The
basal angiosperm Amborella trichopoda is an example, being used to describe the
recruitment of genes to angiosperm-specific innovations such as floral organs (Zuccolo et
al., 2011; Vialette-Guiraud et al., 2011), with the caveat that characteristics may be
derived rather than ancestral (Posluszny and Tomlinson, 2003).
The Papaveraceae is the most basal family of the Ranunculales clade of
angiosperms, with the exception of the Eupteleaceae, and is the most basal herbaceous
eudicot family (Kadereit et al., 1997; Worberg et al., 2007 Wang et al., 2009). In
addition to their economic and scientific significance as synthesizers of alkaloids,
particularly opiates (Cahlíková et al., 2012; de Luca et al., 2012), their phylogenetic
position makes the poppies (subfamily Papaveroideae) and fumitories (subfamily
Fumarioideae) important for the study of eudicot evolution and development, and have
19
been the subjects of studies into leaf and flower development in basal eudicots
(Bartholmes et al., 2012; Lange et al., 2013).
This thesis explores the genetic regulation of the development of lateral organs,
leaves and floral organs, in the Papaveraceae. Characterization of the leaf developmental
program in the California poppy Eschscholzia californica and the fumitory Cysticapnos
vesicaria will allow comparisons to be made with the core eudicots, into which several
model species such as Arabidopsis thaliana and Antirrhinum majus fall, as well as the
early-diverging basal angiosperms and the basal monocots (Floyd and Bowman, 2007).
Several candidate genes known for roles in lateral organ development in core eudicot and
monocot models were studied and their functions in basal eudicots compared to their
homologs in model species, with a view to expanding our understanding how
development of the leaf has changed and diversified through evolution.
Chapter 2 investigates the role of homologs of CINCINNATA and related TCP
genes in the leaf development of Eschscholzia californica and Cysticapnos vesicaria,
while Chapter 3 explores the role EcPHAN, the ARP homolog in Eschscholzia
californica petal development. These chapters will be prepared for publication as
research articles. Chapter 4 presents the cloning, phylogenetic, and expression analysis
of four KNOX I genes in Eschscholzia californica, and reports phenotypic effects
following virus-mediated silencing of two STM-like KNOX genes. This chapter has been
accepted for publication in Development Genes and Evolution. Chapter 5 explores the
potential of Laser Microdissection Microscopy (LMD) in the study of multiple gene
expression in various stages of leaf development, using Eschscholzia californica, and
20
shall function as a technical reference. In Chapter 6, the conclusions drawn from this
work are presented with comments on the outlook for evolutionary-developmental
research.
References
Aggarwal P., Padmanabhan B., Bhat A., Sarvepalli K., Sadhale P.P., and Nath
U. (2011). The TCP4 transcription factor of Arabidopsis blocks cell division in yeast at
G1 → S transition. Biochem. Biophys. Res. Commun. 410, 276-281.
Bartholmes C., Hidalgo O., and Gleissberg S. (2012). Evolution of the YABBY gene
family with emphasis on the basal eudicot Eschscholzia californica
(Papaveraceae). 14, 11-23.
Bharathan G., Goliber T.E., Moore C., Kessler S., Pham T., and Sinha N.R. (2002).
Homologies in leaf form inferred from KNOXI gene expression during development.
Science 296, 1858-1860.
Blein T., Hasson A., and Laufs P. (2010). Leaf development: what it needs to be
complex. Curr. Opin. Plant Biol. 13, 75-82.
Cahlíková L., Kučera R., Hošt'Álková A., Klimeš J., and Opletal L. (2012).
Identification of pavinane alkaloids in the genera Argemone and Eschscholzia by GCMS. 7, 1279-1281.
21
Champagne C. and Sinha N. (2004). Compound leaves: equal to the sum of their parts?
Development 131, 4401-4412.
Crawford B.C.W., Nath U., Carpenter R., and Coen E.S. (2004). CINCINNATA
controls both cell differentiation and growth in petal lobes and leaves of antirrhinum.
Plant Physiol. 135, 244-253.
De Luca V., Salim V., Atsumi S.M., and Yu F. (2012). Mining the biodiversity of
plants: A revolution in the making. Science 336,1658-1661.
Eckardt N.A. (2004). The Role of PHANTASTICA in Leaf Development. The Plant
Cell Online 16, 1073-1075.
Floyd S.K. and Bowman J.L. (2007). The ancestral developmental tool kit of land
plants. Int. J. Plant Sci. 168, 1-35.
Guenot B., Bayer E., Kierzkowski D., Smith R.S., Mandel T., Zadnikova P.,
Benkova E., and Kuhlemeier C. (2012). PIN1-independent leaf initiation in Arabidopsis
thaliana. Plant Physiology 159(4), 1501-1510.
22
Guo M., Thomas J., Collins G., and Timmermans M.C.P. (January 2008). Direct
Repression of KNOX Loci by the ASYMMETRIC LEAVES1 Complex of Arabidopsis.
The Plant Cell Online 20, 48-58.
Hagemann W. and Gleissberg S. (1996). Organogenetic capacity of leaves: The
significance of marginal blastozones in angiosperms. Plant Syst. Evol. 199, 121-152.
Hay A. and Tsiantis M. (2010). KNOX genes: versatile regulators of plant development
and diversity. Development 137, 3153-3165.
Jones C.S., Bakker F.T., Schlichting C.D., and Nicotra A.B. (2009). Leaf shape
evolution in the South African genus Pelargonium L’ Hér. (Geraniaceae).
Evolution 63, 479-497.
Kadereit J.W., Schwarzbach A.E. and Jork K.B. (1997). The phylogeny ofPapaver s.
l. (Papaveraceae): Polyphyly or monophyly? Plant Syst. Evol. 204, 75-98
Kawamura E., Horiguchi G., and Tsukaya H. (2010). Mechanisms of leaf tooth
formation in Arabidopsis. Plant J. 62, 429-441.
23
Kerstetter R.A., Bollman K., Taylor R.A., Bomblies K., and Poethig R.S. (2001).
KANADI regulates organ polarity in Arabidopsis. Nature 411, 706-709.
Kim M., McCormick S., Timmermans M., and Sinha N. (2003). The expression
domain of PHANTASTICA determines leaflet placement in compound leaves.
Nature 424, 438-443.
Klingenberg, C. P. 2008. Novelty and ‘‘homology-free’’ morphometrics: What’s in a
name? Evolutionary Biology 35, 186–190.
Klingenberg, C. P. 2010. Evolution and development of shape: integrating quantitative
approaches. Nature Reviews Genetics 11, 623–635.
Koyama T., Mitsuda N., Seki M., Shinozaki K., and Ohme-Takagi M. (2010). TCP
Transcription Factors Regulate the Activities of ASYMMETRIC LEAVES1 and miR164,
as Well as the Auxin Response, during Differentiation of Leaves in Arabidopsis. The
Plant Cell Online 22, 3574-3588.
Lange M., Orashakova S., Lange S., Melzer R., Theißen G., Smyth D.R., and Becker
A. (2013). The seirena B class floral homeotic mutant of California poppy (Eschscholzia
californica) reveals a function of the enigmatic PI motif in the formation of specific
multimeric MADS domain protein complexes. Plant Cell 25, 438-453.
24
Li Z., Li B., Shen W., Huang H., and Dong A. (2012). TCP transcription factors
interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana. Plant
J. 71, 99-107.
Molinero-Rosales N., Jamilena M., Zurita S., Gómez P., Capel J., and Lozano R.
(1999). FALSIFLORA, the tomato orthologue of FLORICAULA and LEAFY, controls
flowering time and floral meristem identity. 20, 685-693.
Moon J., Candela H., and Hake S. (2013). The Liguleless narrow mutation affects
proximal-distal signaling and leaf growth. 140, 405-412.
Nicotra B., Leigh A., Boyce A., Jones C.S., Niklas K., Royer D., and Tsukaya
H. (2011). The evolution and functional significance of leaf shape in the angiosperms.
Functional Plant Biology 38, 535-552.
Nikovics K., Blein T., Peaucelle A., Ishida T., Morin H., Aida M., and Laufs P.
(2006). The balance between the MIR164A and CUC2 genes controls leaf margin
serration in Arabidopsis. Plant Cell 18, 2929-2945.
Ori N., Cohen A.R., Etzioni A., Brand A., Yanai O., Shleizer S., Menda N.,
Amsellem Z., Efroni I., Pekker I., Alvarez J.P., Blum E., Zamir D., and Eshed Y.
25
(2007/06//print). Regulation of LANCEOLATE by miR319 is required for compoundleaf development in tomato. Nat Genet 39, 787-791.
Posluszny, U. and P. B. Tomlinson. 2003. Aspects of inflorescence and floral
development in the putative basal angiosperm Amborella trichopoda (Amborellaceae).
Canadian Journal of Botany 81:28-39.
Prigge M.J., Otsuga D., Alonso J.M., Ecker J.R., Drews G.N., and Clark S.E. (2005).
Class III Homeodomain-Leucine Zipper Gene Family Members Have Overlapping,
Antagonistic, and Distinct Roles in Arabidopsis Development. The Plant Cell
Online17, 61-76.
Ramirez J., Bolduc N., Lisch D., and Hake S. (2009). Distal expression of knotted1 in
maize leaves leads to reestablishment of proximal/distal patterning and leaf dissection.
Plant Physiol. 151, 1878-1888.
Sarojam R., Sappl P.G., Goldshmidt A., Efroni I., Floyd S.K., Eshed Y., and
Bowmana J.L. (2010). Differentiating Arabidopsis shoots from leaves by combined
YABBY activities. Plant Cell 22, 2113-2130.
26
Shleizer-Burko S., Burko Y., Ben-Herzel O., and Ori N. (2011). Dynamic growth
program regulated by LANCEOLATE enables flexible leaf patterning.
Development 138, 695-704.
Timmermans M.C.P., Hudson A., Becraft P.W., Nelson T. (1999). ROUGH
SHEATH2: a Myb protein that represses knox homeobox genes in maize lateral organ
primordia. Science 284:151–53
Tomescu A.M.F. (2009). Megaphylls, microphylls and the evolution of leaf
development. Trends Plant Sci. 14, 5-12.
Vialette-Guiraud A.C.M., Adam H., Finet C., Jasinski S., Jouannic S., and Scutt
C.P. (2011). Insights from ANA-grade angiosperms into the early evolution of CUPSHAPED COTYLEDON genes. 107, 1511-1519.
Waites R., Selvadurai H., Oliver I., and Hudson A. (1998). The PHANTASTICA gene
encodes a MYB transcription factor involved in growth and dorsoventrality of lateral
organs in Antirrhinum. Cell 93, 779-789.
Wang W., Lu A.-., Ren Y., Endress M.E., and Chen Z. (2009). Phylogeny and
classification of Ranunculales: Evidence from four molecular loci and morphological
data. Perspect. Plant Ecol. Evol. Syst. 11, 81-110.
27
Worberg A., Quandt D., Barniske A., Löhne C., Hilu K.W., and Borsch T. (2007).
Phylogeny of basal eudicots: Insights from non-coding and rapidly evolving DNA. 7, 5577.
Zuccolo A., Bowers J.E., Estill J.C., Xiong Z., Luo M., Sebastian A., Goicoechea
J.L., Collura K., Yu Y., Jiao Y., Duarte J., Tang H., Ayyampalayam S., Rounsley S.,
Kudrna D., Paterson A.H., Pires J.C., Chanderbali A., Soltis D.E., Chamala S.,
Barbazuk B., Soltis P.S., Albert V.A., Ma H., Mandoli D., Banks J., Carlson J.E.,
Tomkins J., dePamphilis C.W., Wing R.A., and Leebens-Mack J. (2011). A physical
map for the Amborella trichopoda genome sheds light on the evolution of angiosperm
genome structure. Genome Biol. 12 (5), R48.
28
CHAPTER 2: REGULATION OF DISSECTED LEAF ARCHITECTURE IN
ESCHSCHOLZIA CALIFORNICA BY A CIN-TCP GENE
Abstract
Dissected leaves are characterized by a prolonged organogenetic phase that allows
leaflets and other marginal structures to form before maturation terminates organogenetic
competency of the primordial leaf margins. Dissected leaves are widespread in many
eudicot lineages and are morphologically diverse. In core eudicots, the CINCINNATA
gene promotes tissue differentiation and maturation and antagonizes factors responsible
for marginal organogenesis. Here we present an analysis of EcCIN, a CINCINNATA
homolog in the basal eudicot species Eschscholzia californica. Silencing of EcCIN using
virus-induced gene silencing resulted in increased dissection of the leaf blade. Additional
leaf segments formed particularly in proximal and central portions of the blade, while the
acropetalous initiation of leaflets along the rachis was not affected, suggesting a role for
EcCIN in the termination of later phases of leaf organogenesis. Silencing of a
CINCINNATA homolog in the fumarioid poppy Cysticapnos vesicaria had similar effects,
suggesting conservation of CIN gene function among dissected members of the poppy
family. Further, silencing of the related EcTCP2-LIKE and EcTCP5-LIKE genes in
Eschscholzia indicated that these CIN-TCP genes may contribute to the maturationpromoting role of EcCIN.
29
Introduction
The morphological diversity of plants is evidence for the flexibility of the genetic
pathways that direct the development of plant tissues and organs. Intensive study of
development in core eudicots such as Arabidopsis thaliana has identified many of the
genetic regulatory pathways responsible for organogenesis, and it is now possible to
establish other species as phylogenetic landmarks for evolutionary-developmental
studies, as well as to compare between close relatives with divergent morphological
features.
Leaf development can be considered as the sum of two phases: morphogenesis,
the establishment of growth axes and patterning of the leaf blade, and histogenesis, the
fixation of anatomical structures and the determination of cell fates (Hagemann and
Gleissberg 1996; Shleizer-Burko et al., 2011). Dissected leaves produce lobes, leaflets
and/or other marginal structures during primary morphogenesis by controlled but
indeterminate growth at the undifferentiated edges of the leaf blade, the marginal
blastozone (Hagemann and Gleissberg, 1996).
The duration for which the primordium maintains an organogenetic state strongly
influences leaf morphology (Shleizer-Burko et al. 2011). At the threshold between
morphogenesis and histogenesis, the rate of mitosis falls and cell expansion begins
(Tsukaya, 2006), precluding the formation of additional and/or higher orders of marginal
dissection (Hagemann and Gleissberg, 1996).
The duration for which the primordium maintains an organogenetic state strongly
influences leaf morphology (Shleizer-Burko et al. 2011). Retention of organogenetic
30
competence at the margins of the blade (the marginal blastozone) permits formation of
complex structures. Therefore, prolonged expression of genes promoting and
maintaining cell division would be expected to enhance the complexity of the margin
while expression of those favoring the termination of division and cell expansion would
simplify the margin. Interspecific heterochronic expression of genes controlling cell
division and cell expansion may underlie morphological variation between the dissected
leaves of sister taxa (Hagemann and Gleissberg 1996, Efroni et al., 2008).
Shleizer-Burko et al. (2011) demonstrated that differing spatial-temporal
expression patterns for the gene LANCEOLATE in the Solanaceae were associated with
alternative developmental programs and final leaf morphologies; simple-leafed species
expressed LANCEOLATE early (or maintained their incipient stage for longer before a
brief morphogenetic period), while dissected-leaf species expressed it later or restricted
its activity at the leaf margins for longer. In tomato, dominant mutations preventing
microRNA-mediated degradation render the leaf margins simple (Ori et al., 2007; Nag et
al., 2009).
LANCEOLATE is a member of the TCP (TEOSINTE BRANCHED1,
CINCINNATA and PROLIFERATING CELL FACTORS 1 and 2) family of non-canonical
basic helix-loop-helix (bHLH) transcription factors (Ori et al. 2007, Cubas et al. 1999,
Martin-Trillo and Cubas, 2010). TCP genes have reported roles in stem branching,
zygomorphic flower development, and leaf morphogenesis, and are segregated into two
classes based upon TCP domain-specific differences, as well as the presence or absence
of a binding site for miR319 (Nag et al., 2009) and a conserved, coiled-coil R domain,
31
which are found in Class II (CIN and CYC subfamily) genes (Martin-Trillo and Cubas,
2010). LANCEOLATE is a member of the CIN-like subgroup of Class II.
Studies into LANCEOLATE and its homologs in Arabidopsis thaliana (TCPs 3, 4
and 10) and Antirrhinum majus (CINCINNATA ) indicate a conserved role in lateral
organ development via the suppression of cell division and the promotion of maturation
(Koyama et al., 2007; Nath et al., 2003; Crawford et al., 2004). Loss-of-function
mutations of CINCINNATA that permit uncontrolled mitosis distort surface curvature in
simple Antirrhinum leaves but conversely reduces flower petals (Nath et al. 2003) while
suppression or (multiple) mutations of TCPs 3, 4 and 10 causes disruption the normally
smooth surfaces of Arabidopsis leaves (Koyama et al. 2010) and petals (Koyama et al.
2011). Not only is the rate of cell division affected, but so is the process of
differentiation; in dominant TCP4 mutants, leaf epidermal cell shape is modified
(Sarvepalli and Nath, 2011).
The multiple targets of these genes include: ASYMMETRIC LEAVES 1 (Koyama
et al. 2010) and ASYMMETRIC LEAVES 2 (Li et al. 2012), which are upregulated, form
the main components of a regulatory complex that suppresses the pro-cell division Class I
KNOX genes (Byrne et al., 2002); miR164 (Koyama et al. 2010), suppressor of boundary
genes CUP-SHAPED COTYLEDONS 1 and 2 (Laufs et al. 2004; Koyama et al., 2007)
that are involved in the specification of leaflets and sinuses (Nikovics et al., 2006), is
upregulated; INDOLE-3-ACETIC ACID3/SHORT HYPOCOTYL2 (IAA/SHY2) which
negatively regulates auxin signaling (Tian et al., 2002) and the early auxin response gene
SMALL AUXIN UP RNA (Koyama et al.. 2011, Hagen and Guilfoyle, 2002) are also
32
upregulated. Cellular responses to cytokinin are diminished; Efroni et al. (2013) found
that in Arabidopsis, TCP4 interacts with SWI3C and BRAHMA, a SWI/SNF family
ATPase involved in chromatin remodeling. These act in concert to bind to the promoter
and induce activation of ARR16, an auxin response regulator that suppresses responses to
cytokinin (Efroni et al., 2013).
CINCINNATA more directly affects the cell cycle by targeting Pcl5, which is
downregulated (Aggarwal et al., 2011). Pcl5 is a component of the complex that
represses the cyclin‐dependent kinase inhibitor Sic1 by phosphorylating it, thereby
preserving the CDK complex Cln‐Cdc28, and promoting cell cycle progression
(Aggarwal et al., 2011). TCP4 (and by inference CINCINNATA and LANCEOLATE
proteins also) obstructs cell division by stabilizing Sic1.
Therefore, TCP4/CINCINNATA/LANCEOLATE act upon multiple targets in
different regulatory networks to promote a transition to maturation, and interspecific
differences in mature morphology may be the products of subtle modifications of their
expression, or specificity for and interactions with upstream or downstream partners.
One may hypothesize that developmental control via this regulatory network may be an
ancestral characteristic of plants, repeatedly recycled. A lack of involvement by
CINCINNATA would contradict the notion that dissection is the ancestral characteristic of
the eudicot leaf.
Discovery of the target specificity, expression pattern and regulation of the
homologous genes in basal eudicots (as opposed to the core eudicots Arabidopsis
thaliana or Antirrhinum majus) would be informative as to the evolutionary history of
33
this gene family and its role in patterning the leaf blade. The basal eudicot species
Eschscholzia californica (Papaveraceae, Papaveroideae) and the fumarioid Cysticapnos
vesicaria (Papaveraceae, Fumarioideae) are the subjects of recent evolutionary
developmental studies of lateral organ formation (Wege et al. 2007, Hidalgo et al. 2012).
The species and members of neighbouring subfamilies yet differ in growth habit and leaf
morphology; Eschscholzia produces polyternately dissected leaves with leaflets indistinct
from their petiolules, while Cysticapnos leaves are once-pinnately dissected, and develop
terminal leaflets that are sometimes branched. In both cases, leaflet development is
acropetalous.
We describe the role of a development-regulating gene, CINCINNATA, in these
two species, and make comparisons with core eudicots homologs, and with other CINTCP homologues found in Eschscholzia. Gene structures and virally induced silencing
phenotypes are described for Eschscholzia californica CINCINNATA (EcCIN), EcTCP2LIKE and EcTCP5-LIKE genes, and for Cysticapnos vesicaria CINCINNATA (CvCIN),
and are discussed in the context of the evolutionary-developmental biology of the leaf.
Methods
Sequence identification
Basal eudicots DNA sequences with homology to Class II CIN-TCP genes were
obtained for Eschscholzia californica, Chelidonium majus, Glaucium flavum, Argemone
mexicana, Papaver somniferum, Papaver bracteatum, Papaver setigerum, and Papaver
rhoeas from the Phytometasyn and 1KP transcriptome databases using exhaustive blastn
34
and tblastx searches with Arabidopsis sequences and searches by annotation using
“TCP”, “CINCINNATA”, “LANCEOLATE”, and related key words. Nucleotide sequences
encoding encoding the TCP domain as delineated in Navaud et al. (2007) were translated
using Expasy TRANSLATE (Gasteiger et al., 2003) then aligned by MAFFT v7 G L-insI (Katoh and Standley, 2013) for maximum accuracy to confirm similarity to known TCP
genes. Verified DNA sequences sequences were aligned and the consensus sequences
produced were used to design degenerate primers for cloning of CIN homologs from
Cysticapnos vesicaria and Hypecoum procumbens.
Expression profiling
Eschscholzia californica seeds were stratified at 4°C for three days before
germination under constant light at 22°C. Root, vegetative shoot tip (including shoot
apical meristem and young leaves), mature leaf, floral bud and whole flower tissue was
flash frozen in liquid nitrogen and homogenized, with three biological replicates per
tissue type. RNA was extracted using an RNeasy RNA extraction kit (Qiagen) and
quantified using a Nanodrop ND-1000. Reverse transcription of 200ng per sample of
RNA to cDNA was performed with MMLV reverse transcriptase (Promega). Expression
levels of EcCIN, EcTCP2-LIKE, and EcTCP5-LIKE were assessed by quantitative
polymerase chain reaction by comparison to the control gene actin-2 at 55°C respectively
(one minute elongation) using the primers EcCIN-21F and EcCIN-22R, EcTCP2-6F and
EcTCP2-7R, EcTCP5-6F and EcTCP5-7R, and ACTIN-2-fwd and ACTIN-2-rev.
35
In situ hybridization
Shoot tips from Eschscholzia californica seedlings with two leaves were fixed in
4% paraformaldehyde in PBS buffer, dehydrated by washing with ethanol : DEPC-treated
water solutions of increasing ethanol concentration up to 100%, cleared with Histoclear
and infiltrated with paraffin wax (Tissue-Tek). Infiltrated shoot tips were embedded in
blocks, cut into 10μm sections with a rotary microtome and mounted on poly-lysine
coated glass slides. The sections were probed for the expression of EcCIN using a
digoxygenin-labeled RNA probe. Primers EcCIN-15F and EcCIN-16R, the latter
prefixed with a T3 RNA polymerase binding site, were used to transcribe an antisense
RNA probe in vitro using T3 polymerase (Fisher Scientific). This sequence corresponds
to the EcCIN TCP domain. Signal detection was performed using alkaline phosphataseconjugated Fab fragments with BCPIP as the substrate.
Phylogenetic analysis
Full-length nucleotide coding sequences for Class II CIN-TCP genes from taxa
with multiple unique representatives were translated into amino acid sequences with
Expasy Trasnslate. These were aligned on the MAFFT v7 server using the G L-ins-I
algorithm (Katoh and Standley, 2013). The alignment was checked in MacClade 4 and
converted to Phylip 3.6 format. Model testing with ProtTest 2.4 (Abascal et al., 2005)
recommended the JTT+G model according to the AIC (Akaike Information Criterion),
AICc, and BIC. A consensus phylogenetic tree with branch posterior probabilities were
36
inferred with MrBayes 3.2 (350,000 generations, standard deviation of split frequencies
<0.01; sump burnin = 1000; sumt burnin=1000) (Ronquist et al., 2012).
Cloning and VIGS construct preparation
The TCP domain of EcCIN was amplified by touchdown polymerase chain
reaction (PCR) from oligo-dT primed complementary DNA (cDNA) derived from
Eschscholzia vegetative shoot tips using degenerate primers derived from Antirrhinum
majus CINCINNATA and Arabidopsis thaliana TCP4 sequences (forward primer and
reverse primer) (denaturation at 94°C; initial annealing at 64°C, decreasing 0.5°C per
cycle to 55°C then maintained at 50°C for an additional 25 cycles; one minute elongation
per cycle with a ten minute final elongation period). The size of the amplified fragment
was confirmed by gel electrophoresis, excised, and purified using a Gel Extraction Kit
(Denville), then ligated into pGEM-T overnight at 4°C with the pGEM-T Easy Vector
System I kit (Promega). A 200μl aliquot of chemically competent JM109 E. coli was
transformed with the ligation by heat shock transformation, incubated for one hour with
800μl antibiotic-free LB (37°C, 200rpm shaking) then plated onto LB agar plates
containing 50μg/ml ampicillin as well as X-Galactose and IPTG. Colonies positive for
the transformed plasmid were selected by blue-white screening and PCR with plasmid
specific primers T7 and SP6 (55°C annealing, one minute elongation, 35 cycles),
cultured overnight at 37°C in 5ml LB with 50μg/ml ampicillin (37°C, 200rpm shaking)
and purified using an EZNA Plasmid isolation Kit II (Omega Bio-tek). The sequence of
the plasmid insert was verified by Sanger sequencing (Ohio University Genomics
37
Facility) and is supported by the Eschscholzia californica transcriptome contig
NKJC0015470 (1KP).
Additional downstream sequence data was obtained by rapid amplification of
cDNA ends using a 3'/5' RACE kit (Promega) and the nested, gene specific primers
EcCIN-F8 and EcCIN-15F to ensure the specificity of the product.
Two EcCIN fragments were inserted into a vector derived from the tobacco rattle
virus, pTRV2. One construct comprises the EcCIN TCP domain in the vector and the
other instead containing a downstream region that, based on phylogenetic analysis, is less
conserved. The latter construct for comparison and ensured that cross-silencing of
related TCP genes containing the conserved TCP domain was not the source of any
phenotype. The TCP domain was amplified by PCR (55°C, one minute elongation, 35
cycles) with nested primers tailed with EcoRI and BamHI restriction sites (EcCIN-8F and
EcCIN-R9 for the TCP-specific construct, EcCIN-17F and EcCIN-18R for the
downstream construct).
The product was verified for its size by gel electrophoresis, excised from the gel
and purified using an EZNA Gel Extraction Kit (Omega bio-tek). The product was
digested at 37°C for one hour with EcoRI and BamHI (Promega). The restriction
enzymes were heat inactivated at 70°C for ten minutes. Empty pTRV2 vector was
similarly digested with EcoRI and BamHI and purified using an EZNA Gel Extraction kit
(Omni Bio-Tek) protocol for enzymatic reaction cleanup. The two products were ligated
together overnight at 4°C with T4 DNA ligase (Promega), transformed into JM109 cells
by heat shock transformation and cultured overnight at 37°C on LB agar plates
38
containing 50μg/ml kanamycin. Colonies containing plasmids with the desired insert
were identified by PCR with the primers pTRV2-fwd and pTRV2-rev (55°C annealing,
35 cycles) and cultured overnight in 5ml LB containing 50μg/ml kanamycin. Plasmids
were purified with the EZNA Plasmid Isolation kit II. Possession of the desired insert by
the plasmid was verified by Sanger sequencing.
The pTRV2 vector containing the insert was transformed into 100μl
Agrobacterium tumefaciens strain GV3101 by electroporation at 1800mV and incubated
at 28°C with 900ul antibiotic-free LB for one hour before being plated on LB agar plates
containing 50μg/ml kanamycin and 50μg/ml gentamycin. Positive colonies were selected
by PCR with the primers pTRV2-fwd and pTRV2-rev (55°C annealing, one minute
elongation, 35 cycles) and restreaked on a fresh antibiotic plate. The second construct
was similarly prepared from the pGEM-T vector containing the 3' RACE product. A
region of the insert was amplified with the nested primers EcCIN-17F and EcCIN-18R
(annealing at 55°C, one minute elongation, 35 cycles), purified and appropriately
digested along with the pTRV2 vector before cloning into E. coli and A. tumefaciens.
The contig Eschscholzia californica RKGT-0016406 (1KP) is homologous to
Arabidopsis thaliana TCPs 2 and 24. A 308bp section of the sequence was amplified
using the KpnI- and XbaI-flanked primers EcRKGT-0016406-3F and EcRKGT-00164064R by 35 cycles of PCR at 58°C (one minute elongation) then cloned into pGEM-T
(JM109 E. coli) and into pTRV2 (JM109 E. coli and GV3101 A. tumefaciens) as
described for EcCIN. Likewise, the contig Eschscholzia californica UNTP-0023803
(1KP) is homologous to Arabidopsis thaliana TCPs 5, 13 and 17, and a 301bp section of
39
this sequence spanning the TCP domain was similarly obtained using primers with
flanking KpnI and XbaI sites (primers EcUNTP-0023803-3F and EcUNTP-0023803-4R
respectively). These amplificates were cloned into pGEM-T and pTRV2 and finally
transformed into A. tumefaciens.
Partial sequences of the CIN homologues of Cysticapnos vesicaria and another
basal eudicot, Hypecoum procumbens, were obtained using degenerate primers based
upon TCP domain sequences identified during the phylogenetic analysis (primers
PapCIN-1F and PapCIN-2R) using vegetative shoot tip cDNA from the respective
species as a template. After cloning into pGEM-T, VIGS constructs were prepared as
previously described with nested primers flanked with enzymes XbaI and KpnI (CvCIN1F and CvCIN-2R). A Hypecoum VIGS constructs for the positive control PHYTOENE
DESATURASE (PDS) was produced by the same approach with the generic primers PDS5F and PDS-6R and the specific nested primers HpPDS-1F (with XbaI site) and HpPDS2F (with SmaI site). An HpCIN construct was prepared with HpCIN-1F and HpCIN-2R
(with XbaI and KpnI sites respectively). PDS construct preparation for Eschscholzia and
Cysticapnos has been described in Wege et al. (2007) and Hidalgo et al. (2012).
Infiltration technique
To prepare the VIGS infiltration mixture, single colonies containing the pTRV2
construct of interest were cultured for 24 hours in 5ml LB containing 5ml LB containing
50μg/ml kanamycin and 50μg/ml gentamycin. Colonies containing the pTRV1 plasmid
(Wege et al., 2007) were cultured identically. Cells of each type were separated from
40
their media by centrifuging 1ml of each culture at 5000 x g for 30 seconds then
resuspended together in 1ml 5% w/v sucrose. Seedlings with between one and three
leaves were mechanically wounded at the hypocotyl and 2µl of the infiltration mixture
was pipetted onto the wound.
Photobleaching of control pTRV2-PDS plants in Eschscholzia and Cysticapnos
arising between eight and fifteen days after infiltration indicated the efficacy of VIGS.
Hypecoum procumbens was found to be unamenable to VIGS with pTRV2 constructs
derived from Hypecoum procumbens PDS (HpPDS) and CIN (HpCIN) genes (pTRV2HpPDS n = 16 plants; pTRV2-HpCIN n = 16).
Plant culture
Seeds were sown in standard flat trays with either 48 or 32 larger wells in a
standard potting soil with good drainage and covered with clear lids. After sowing, the
seeds were stratified at 4°C and in darkness for between three days and one week before
transfer to constant light (concentration) at 22°C. Plants were watered with tap water for
two weeks after germination, after which the water was supplemented with 250µl/l
‘Grow 7 - 9 - 5’ fertilizer (Dyna-Gro).
RNA extraction, reverse transcription, and demonstration of CvCIN downregulation by
quantitative PCR
RNA was isolated from lateral shoot tips of pTRV2-empty and pTRV2-CvCIN
VIGS plants. pTRV2-empty plants showed no abnormal phenotypes. To select control
41
plants, the number of segments per leaf was averaged for nodes 7 – 12 for each pTRV2empty plant, and those closest to the mean were selected. Three pTRV2-CvCIN plants
with strong silencing were selected from those whose average number of segments per
leaf was more than one standard deviation greater than the average of the pTRV2-empty
group.
Total RNA was isolated with Tri Reagent (Sigma), chloroform, and isopropanol,
then washed with 70% ethanol in DEPC-treated distilled water and resuspended in
DEPC-treated distilled water. Isolated RNA was assessed for concentration using a
Nanodrop ND-1000 and for quality on a Bioanalyzer Nano chip, and then was stored at 80°C until use. Two micrograms of RNA per sample was reverse transcribed into cDNA
at 37°C using MMLV-reverse transcriptase (Promega) and random hexamer primers in a
1:1 ratio to RNA (Promega). The cDNA was diluted 1/10 with nuclease-free water.
The cDNA was used as a template for quantitative polymerase chain reaction
(QPCR) for CvCIN and the control gene ACTIN-2 using the primers ACTIN-2-fwd and
ACTIN-2-rev. Each reaction (1μl cDNA sample, appropriate primer pair, and SYBR
master mix) was performed in triplicate, alongside negative controls (nuclease-free
water) and RNA to confirm the absence of DNA contamination.
Preservation of voucher specimens
Voucher specimens for cultivated Eschscholzia californica, Cysticapnos
vesicaria, and Hypecoum procumbens were deposited at the Bartlett Herbarium (BHO) at
Ohio University, Athens, Ohio 45701 (accession numbers pending).
42
Documentation of phenotypes
The number of leaflets per leaf was counted for nodes six through twelve in VIGS
experiment plants. Phenotypes were documented with a Canon 7D digital SLR camera
equipped with a 100mm f/2.8 macro lens or 65mm MP-E f/2.8 macro lens and a Canon
MT-24EX twin-light flash system.
43
Table 1. Primers used for cloning, in situ hybridization probe preparation and quantitative
PCR for CIN-TCP genes
Primer name
EcCIN-21F
EcCIN-22R
EcTCP2-6F
EcTCP2-7R
EcTCP5-6F
EcTCP5-7R
CvCIN-3F
CvCIN-4R
EcCIN-8F
EcCIN-9R
EcCIN-17F
EcCIN-18R
EcRKGT-0016406-3F
EcRKGT-0016406-4R
EcUNTP-0023803-3F
EcUNTP-0023803-4R
PapCIN-1F
PapCIN-2R
CvCIN-2R
PDS-5F
PDS-6R
HpPDS-1F
HpPDS-2R
HpCIN-1F
HpCIN-2R
ACTIN2-Fwd
ACTIN2-Rev
Sequence
TTCAAGACTTGGGGTAGTAAGAGG
AACAGTAGATGCAGTTGGTCTCC
AAGGAAAAACCCGAAGAACC
TTGAGCTTGAACCGAAAAGC
GATCCAAACCTCCATCTTCG
CCAAAAGTACGGGAAACACG
CTCAGCGAGTTCATCAATGG
CAAGGTGGTCACATTGTTCG
AAGAATTCCCAAGAGATCGAAGAGTTCGTCTTTCAGC
AAAGGATCCGTGTCGGCAATGGAATCAGAGTCC
CAAAGAATTCCAGAAATGGGTAGGTTTCAGAG
GCAAAGGATCCAACAGGAATGAAAACC
AAATCTAGAGTTGGTGGTTTTCATGTTGG
AACGGTACCTTAGTTGCTTTGGGGTTTCG
AAAGGTACCTGGCTACGACAAGATCATCG
AAGTCTAGACCATTGATTGAGAATACTGACC
AAGAATTCGAGGTACAAGGWGGYCACATTG
TTCCTAGGGAGTTACTGGACTGAAGGGGTC
ATCGGTACCGGCGATTAAGTTGGGTAACG
AATCTAGACGAGTAACTGATGAGGTGTTTATTGC
AACCATGGAGCATGGTTCCAAGATGGC
AAATCTAGAGTAACCCTCCTGAGAGACTTTGCATG
AAACCCGGGGAGGGGACTTCTGCTGAAGAGTAG
ATCTCTAGATGATCAAGAAGGCCAAATCC
ATCGGTACCGGTCAGGTGGGTAATTCTGG
TTACAATGAGCTTCGTGTTGC
TCCAGCACAATACCTGTAGTA
44
Results
CIN is conserved between basal and core eudicots
Eschscholzia Class II TCP genes were identified by PCR amplification from
cDNA using degenerate primers based on model plant species and from the online
transcriptome databases 1KP and Phytometasyn. A single Eschscholzia sequence was
identified for each of the three CIN-TCP subclades delineated in the phylogeny
constructed by Martin-Trillo and Cubas (2010), which Arabidopsis thaliana TCP 3, 4 and
10, 2 and 24, and 13, 5 and 17 respectively. Partial sequences from single copies of CIN
were obtained from Cysticapnos vesicaria and Hypecoum procumbens. Gene
composition of the homologs was similar to those of Arabidopsis, with EcCIN (Figure 2)
and EcTCP2-LIKE containing similar miRNA319 binding regions and EcTCP2-LIKE
containing a somewhat diverged and lengthened R domain, while EcTCP5-LIKE
contained neither. Interestingly, the TCP domain of EcTCP5-LIKE includes the sequence
IDEL at its 3’ end, a feature that while common in other TCP genes has been lost from
Arabidopsis TCP5.
Figure 2. Eschscholzia TCP gene structures. EcCIN, EcTCP2-LIKE and EcTCP5-LIKE
contain a conserved TCP domain; EcCIN and EcTCP2-LIKE contain a 3’ miR319
binding site, the latter also containing an R domain. Note the different positions of the
miR319 binding site.
45
Sequences representative of the TCP3/4/10 clade were also found for species
from Chelidonium, Argemone, Sanguinaria, Corydalis and Papaver. Within these, the
only variable amino acid residues in the TCP domain were at positions 54 (Alanine
(hydrophobic) or Serine (polar neutral)), 55 (Serine in Eschscholzia versus Alanine in
other) and 59 (polar neutral Glutamine in Argemone versus acidic glutamic acid in
others). The exchange of histidine with proline at residue 25 that is evident in TCP3 but
not TCP4 in Arabidopsis thaliana, as well as in the TCP13/5/17 clade, has not occurred
in the Papaveraceae homologs; however, substantial DNA and amino acid sequence
variation between genera can be found outside of these conserved regions.
Gene duplications have occurred for Argemone mexicana (CIN-like) and Papaver
rhoeas (TCP2-like) genes. Further investigation of Argemone indicated that other
important developmental genes have been duplicated, suggesting chromosomal or whole
genome duplications in that lineage (Figure 3). For example, 1KP identifies two
homologs of PHANTASTICA (‘GOQJ-2014003-Argemone_mexicana-stem’ and ‘AmeCCHG-2003316-Argemone_mexicana-flower_bud’). It is unclear if this is also the case
for P. rhoeas, as the absence of additional sequenced homologs in the database provides
no certainty of their absence.
46
Figure 3. Phylogeny of amino acid sequences putatively translated from Papaveraceae
and Arabidopsis thaliana CIN-TCP genes, supporting the three clades outlined by
Martin-Trillo and Cubas (2010).
EcCIN is most highly expressed in shoot tips that include young leaves and the shoot
apical meristem. Homologs of TCPs 2 & 24 and TCP5, 13 & 17 show similar expression.
Eschscholzia vegetative and floral tissue were harvested from at least three plants
and expression levels for CIN-TCP genes were quantified in triplicate and normalized
against the expression of ACTIN-2. The expression profiles of EcCIN and the other CINTCP homologs (Figure 4, Figure 5) are largely consistent with those of Arabidopsis
TCP4 (Koyama et al., 2007). Expression of EcCIN is low in root tissue compared to
maturing lateral organs, but interestingly, apparently mature organs continue to express
47
these genes, albeit at low levels. This is consistent with prolonged expression of
LANCEOLATE in compound-leafed Solanum species. In situ hybridization of EcCIN
reveals its expression in leaf primordia, especially in immature leaflets. EcCIN is absent
from mature stem, leaf and petiole tissue.
Figure 4. Expression profiles of EcCIN, EcTCP2-LIKE and EcTCP5-LIKE in wild-type
Eschscholzia californica tissues. Expression of all genes was elevated in shoot tips and
flower buds, with lower expression in roots and mature leaf and flower tissue. Note that
amplification efficiency is not uniform between plots.
48
Figure 5. In situ hybridization of EcCIN mRNA in wild type Eschscholzia californica
demonstrates that EcCIN is expressed in the immature leaf blade (BL) and developing
leaflets (A – E) but not in mature stem tissue (STEM), the shoot apical meristem (SAM;
A – C), or in the petioles of mature leaves (PET; A – E). Arrows indicate regions of
intense expression in leaflets.
VIGS of Eschscholzia and Cysticapnos TCP genes increases the dissection of the leaf
blade but floral organs are unaffected
Virally-induced silencing of EcCIN was effected with both the 3’-specific (60
plants, complete data sets for 27) and TCP –specific (64 plants, complete data sets for 16)
constructs, rendering phenotypic plants (Figure 6) with increased marginal dissection
49
concentrated proximally, the distalmost leaflets remaining normally sized, compared to
pTRV2-empty control plants. The TCP-specific construct significantly increased
(Kruskal-Wallace test, p=<0.05) in nodes 8 – 12, corresponding with primordia in their
incipient or morphogenetic stages at the time of infiltration. Note that while infiltration
efficiency profoundly impacts statistical significance and that low efficiency of
infiltration and silencing promotes Type II errors, the leaflet counts from phenotypic
plants obviously skew the normal distribution of the data or form a bimodal distribution
on a histogram; Kruskal-Wallace tests may therefore be unsuitable, however, a
significant difference between distributions is indicated by the Kolmogorov-Smirnov test
(Figure 6).
Figure 6. Box and violin plots of total leaflets per node in plants infiltrated with pTRV2empty (control), pTRV2-3’-specific and pTRV2 –TCP-domain constructs.
50
EcCIN knockdown phenotypes (exemplified in Figure 7) ranged from a moderate
increase in dissection of the leaf blade to a dramatic increase that excluded only the most
distal leaflets. Variation between plants along this continuum likely reflects the degree
of TRV-mediated silencing. The bias towards proximal dissection and the absence of
increased terminal dissection, for example, the formation of additional orders of ternate
dissection, is a consequence of the early maturation of the terminal leaflet particular to
the species, which is resistant to EcCIN silencing even in plants exhibiting a strong
phenotype, and occurs early in primordial development (Gleissberg, 2004). The order of
dissection was not obviously altered, although this has not been statistically assessed.
Figure 7. Phenotypic effects of silencing EcCIN with TCP-domain-specific and
unconserved 3’-end-specific VIGS constructs. (A) Wild type leaf, node 10; (B-E)
phenotypic range of silenced plants at node 10. Distal leaflets exhibit normal size and
morphology while proximal leaflets are more severely dissected. This is more
pronounced in the distal flanks of the primary leaflets. Leaf blade area is not
conspicuously increased as a product of dissection, however, and the number of primary
leaflets is not increased.
No changes in petal surface curvature, pigmentation or dissection were observed
in either treatment group, even in plants exhibiting strong leaf phenotypes, contrasting
51
with observations from Arabidopsis (Koyama et al., 2011), Antirrhinum (Crawford et al.,
2004), and Cyclamen (Tanaka et al., 2011).
Eight pTRV2-CvPDS, 17 pTRV2-empty, and 17 pTRV2-CvCIN Cysticapnos
vesicaria plants were assessed for phenotypes. Silencing of CvCIN in Cysticapnos
significantly increases leaf blade dissection but tendril development is unaffected (Figure
8). VIGS knockdown of CvCIN subtly increased leaf blade dissection from node eight
through twelve (Kolmogorov-Smironov tests, P<0.05), superficially increasing proximal
leaflet dissection the most. As the terminal leaflet of Cysticapnos is replaced by a tendril
there was no conspicuous marker of differential dissection, the tendril developing
normally and without a significant change in branching or any alteration in climbing
habit. No changes in floral morphology were visible, although the number of flowers
available for study was small (<6).
52
Figure 8. pTRV2-empty and pTRV2-CvCIN plants (A & B respectively) and leaves from
the same plants from nodes 7 – 10 (wild type = C – F; pTRV2-CvCIN = G – H). VIGS
plants exhibit increased leaflet dissection.
53
Figure 9. Box and violin plots for leaflets per node in pTRV2-empty and pTRV2-CvCIN
plants. Distributions differed significantly at nodes 8 and 9 (not shown), 10, 11, and 12
(Kolmogorov-Smirnov, P<0.05). PDS silencing in pTRV2-CvPDS control plants was
visible at node 6.
CvCIN expression was compared between select pTRV2-empty plants (those with
average leaflet counts most similar to the mean for the treatment) and select pTRV2CvCIN plants (those most different from the control treatment, average leaflet counts
more than one standard deviation greater). CvCIN expression was lower in pTRV2CvCIN plants with the increased leaf dissection phenotype (Figure 10).
54
Figure 10. Quantitative PCR shows decreased expression of CvCIN in pTRV2-CvCINtreated VIGS plants. Numbers appended to columns are average leaflet numbers per
node for nodes 7-12, which differed significantly between the pTRV2-empty and
pTRV2-CvCIN groups (Kolmogorov-Smirnov test, p<0.05). Average leaflet counts for
pTRV2-CvCIN plants selected differed from the pTRV2-empty control group average by
more than one standard deviation.
55
Silencing of additional Eschscholzia CIN-TCP genes produces similar phenotypes to
silencing of EcCIN
*
*
*
*
Figure 11. Box and violin plots of total leaflets per node for pTRV2-empty, pTRV2EcCIN-3’, pTRV2-EcTCP2-LIKE, and pTRV2-EcTCP5-LIKE plants. Asterisks indicate
a significant difference in distribution to the pTRV2-empty group.
A second VIGS experiment to individually silence EcCIN (3’ unconserved region
construct), EcTCP2-LIKE and EcTCP5-LIKE genes reiterated the inefficacy of the
EcCIN 3’ construct while revealing the importance of EcTCP2-LIKE, which is similar to
EcCIN in its regulation and has been shown to have similar effects when knocked down
in Arabidopsis (Koyama et al., 2007). A small number of pTRV2-EcTCP5-LIKE plants
bore leaves with greatly increased dissection, but it was unclear whether these plants
were outliers or strongly silenced plants in a batch with few successfully infiltrated
plants; the size of the pTRV2-EcTCP5-LIKE batch was smaller than that of the other
56
constructs (total plants = 26, complete data sets for 19, versus pTRV2-empty = 34/29,
pTRV2-EcCIN-3’ = 36/35; pTRV2-EcTCP2-LIKE 34/23).
Discussion
The discovery and experimental verification of the DNA sequences described in
Eschscholzia californica supports a hypothetical early origin of three CIN-TCP subfamily
genes, with roughly homologous function conserved between basal and core eudicots. As
in Solanum and Antirrhinum, a single copy of a CINCINNATA homolog was identified;
database mining and PCR amplification and cloning from CINCINNATA-based primers
yielded one sequence. This contrasts with TCP3, 4, and 10 in Arabidopsis and PCF 5
and 7 in Oryza sativa, species that have undergone additional whole genome duplications
(Blanc et al., 2003; Guyot and Keller, 2004). This lack of redundancy precludes the
modulation of expression level and domain between copies observed in TCP 3, 4, and 10
(Koyama et al., 2007).
The phenotypic changes observed in Eschscholzia and Cysticapnos VIGS plants
are in accordance with reported knockdown phenotypes observed in core eudicots
species, for example, in Solanum lycopersicum la-6 plants (Ori et al., 2007), in that the
basic ground plan of the leaf blade is unchanged; dissection of the margins of the distal
leaflets is increased but additional pairs of primary leaflets do not develop.
CINCINNATA and its homologs have been associated with maturation and the cessation
of dissection of the leaf blade via downregulation of pro-morphogenesis factors such as
the CUC and Class I KNOX genes. Recently, Efroni et al. (2013) showed Arabidopsis
57
TCP4 to directly promote ARR16, an auxin response regulator that decreases cell
sensitivity to cytokinins, which promote cell division, rather than affecting cytokinin
production per se. The absence of CINCINNATA expression does not increase baseline
cytokinin concentrations and increase cell division rate, instead cytokinin sensitivity is
maintained for a longer period, allowing continuance of dissection that ordinarily ceases
at the onset of CINCINNATA activity (i.e. when CINCINNATA is expressed in the
diminished presence or the absence of miR319) (Efroni et al., 2013).
Evidence provided by Yanai et al. (2011) indicates that in tomato, LANCEOLATE
also directly or indirectly stimulates production of gibberellic acids by SlGAox4,
providing a link to pro-maturation signalling, i.e. cell differentiation and expansion are
promoted. Involvement of LANCEOLATE and its homologs in a range of convergent
pathways support its status as a master regulator of leaf development.
Given the evidence for the non-uniform expression of CIN throughout the blade,
transitioning basipetally in the simple-leafed Antirrhinum (Nath et al., 2003) while being
gradually restricted to the margins of tomato’s compound leaves (Ori et al., 2007), it is
unsurprising that distal leaflets remain comparatively undissected in Eschscholzia and
Cysticapnos and that the tendrils of the latter, to which cell expansion contributes
substantially anyway, are unchanged. An interesting comparison could be made if the
CINCINNATA homolog of a related, compound-leaved species with a basipetalous
dissection programme (rather than acropetalous, as in Eschscholzia and Cysticanos) were
knocked out, wherein we might find dissection to be intensified in different parts of the
blade. Caution must be exercised, however, as the sequence of maturation of leaflets is
58
likely more influential that their sequence of initiation; in Eschscholzia, pairs of leaflets
are induced acropetally, but the terminal leaflet consistently matures first.
The absence of floral phenotypes even in the presence of changes in leaf
morphology is an indicator that the involvement of CIN-TCP genes in petal development
in species such as Antirrhinum majus is a derived characteristic, where regulators of cell
division and maturation involved in formation of the leaf lamina are co-opted into
development of the petal lamina; however, the expression of EcCIN in floral buds and
mature flowers opposes the idea that this is a novelty of the core eudicots. Furthermore,
we cannot assume that CIN is important only in zygomorphic flowers that are dissimilar
from those Eschscholzia, as Arabidopsis TCP4 knockdown mutants possess wavy petals.
We might therefore accept Eschscholzia and other basal eudicots as the exception rather
than the rule (although the limited availability of Cysticapnos flowers invokes caution).
Observations of VIGS phenotypes support a role for CIN-TCP genes in the
patterning of the leaf blade. Furthermore, recent identification of targets of
CINCINNATA and its homologs show it to have a broad regulatory role in promoting
maturation. Functional experiments of the kind described herein indicate that the
imposition of repressive genes and genetic modules such as miR319 silencing and
expression of Class I KNOX genes onto the CIN expression pattern could act as a
mechanism to shape the leaf blade. This mechanism may be recycled in many lineages to
provide a means for diversification of form throughout eudicot evolution.
59
References
Abascal F., Zardoya R. and Posada D. (2005). ProtTest: Selection of best-fit models of
protein evolution. Bioinformatics: 21(9):2104-2105.
Aggarwal P., Padmanabhan B., Bhat A., Sarvepalli K., Sadhale P.P., and Nath
U. (2011). The TCP4 transcription factor of Arabidopsis blocks cell division in yeast at
G1 → S transition. Biochem. Biophys. Res. Commun. 410, 276-281.
Blanc, G., Hokamp, K., and Wolfe, K.H. (2003). A recent polyploidy superimposed on
older large-scale duplications in the Arabidopsis genome. Genome Res. 13, 137–144.
Crawford B.C.W., Nath U., Carpenter R., and Coen E.S. (2004). CINCINNATA
controls both cell differentiation and growth in petal lobes and leaves of antirrhinum.
Plant Physiol. 135, 244-253.
Cubas P., Lauter N., Doebley J., and Coen E. (1999). The TCP domain: a motif found
in proteins regulating plant growth and development. Plant J. 18, 215-222.
Efroni I., Blum E., Goldshmidt A., and Eshed Y. (2008). A Protracted and Dynamic
Maturation Schedule Underlies Arabidopsis Leaf Development. The Plant Cell Online
20, 2293-2306.
60
Efroni I., Han S., Kim H., Wu M., Steiner E., Birnbaum K., Hong J., Eshed Y., and
Wagner D. (2013). Regulation of Leaf Maturation by Chromatin-Mediated Modulation
of Cytokinin Responses. 24, 438-445.
Gasteiger E., Gattiker A., Hoogland C., Ivanyi I., Appel R.D. and Bairoch A. (2003).
"ExPASy: The proteomics server for in-depth protein knowledge and analysis". Nucleic
Acids Research 31 (13): 3784–8.
Gleissberg S. (2004). Comparative analysis of leaf shape development in Eschscholzia
californica and other Papaveraceae-Eschscholzioideae. Am. J. Bot. 91, 306-312.
Guyot R, and Keller B. (2004). Ancestral genome duplication in rice. Genome. 47:610–
614.
Hagen G. and Guilfoyle T. (2002). Auxin-responsive gene expression: genes, promoters
and regulatory factors. Plant Mol. Biol. 49: 373-385
Hagemann W. and Gleissberg S. (1996). Organogenetic capacity of leaves: The
significance of marginal blastozones in angiosperms. Plant Syst. Evol. 199, 121-152.
61
Hidalgo O., Bartholmes C., and Gleissberg S. (2012). Virus-induced gene silencing
(VIGS) in Cysticapnos vesicaria, a zygomorphic-flowered Papaveraceae (Ranunculales,
basal eudicots). Annals of Botany 109, 911-920.
Katoh K. and Standley (2013). MAFFT multiple sequence alignment software version
7: improvements in performance and usability. Molecular Biology and Evolution 30:772780.
Koyama T., Furutani M., Tasaka M., and Ohme-Takagi M. (2007). TCP transcription
factors control the morphology of shoot lateral organs via negative regulation of the
expression of boundary-specific genes in Arabidopsis. Plant Cell 19, 473-484.
Koyama T., Mitsuda N., Seki M., Shinozaki K., and Ohme-Takagi M. (2010). TCP
Transcription Factors Regulate the Activities of ASYMMETRIC LEAVES1 and miR164,
as Well as the Auxin Response, during Differentiation of Leaves in Arabidopsis. The
Plant Cell Online 22, 3574-3588.
Koyama T., Ohme-Takagi M., and Sato F. (2011). Generation of serrated and wavy
petals by inhibition of the activity of TCP transcription factors in Arabidopsis thaliana. 6,
697-699.
62
Laufs P., Peaucelle A., Morin H., and Traas J. (2004). MicroRNA regulation of the
CUC genes is required for boundary size control in Arabidopsis meristems. Development
131, 4311-4322.
Li Z., Li B., Shen W., Huang H., and Dong A. (2012). TCP transcription factors
interact with AS2 in the repression of class-I KNOX genes in Arabidopsis thaliana. Plant
J. 71, 99-107.
Martín-Trillo M. and Cubas P. (2010). TCP genes: a family snapshot ten years later.
Trends Plant Sci. 15, 31-39.
Nag A., King S., and Jack T. (2009). miR319a targeting of TCP4 is critical for petal
growth and development in Arabidopsis. Proceedings of the National Academy of
Sciences 106, 22534-22539.
Nath U., Crawford B.C.W., Carpenter R., and Coen E. (2003). Genetic control of
surface curvature. Science 299, 1404-1407.
Navaud O., Dabos P., Carnus E., Tremousaygue D., and Hervé C. (2007). TCP
transcription factors predate the emergence of land plants. J. Mol. Evol. 65, 23-33.
63
Nikovics K., Blein T., Peaucelle A., Ishida T., Morin H., Aida M., and Laufs P.
(2006). The balance between the MIR164A and CUC2 genes controls leaf margin
serration in Arabidopsis. Plant Cell 18, 2929-2945.
Ori N., Cohen A.R., Etzioni A., Brand A., Yanai O., Shleizer S., Menda N.,
Amsellem Z., Efroni I., Pekker I., Alvarez J.P., Blum E., Zamir D., and Eshed Y.
(2007/06//print). Regulation of LANCEOLATE by miR319 is required for compoundleaf development in tomato. Nat Genet 39, 787-791.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B,
Liu L, Suchard MA, and Huelsenbeck JP. (2012). MrBayes 3.2: efficient Bayesian
phylogenetic inference and model choice across a large model space. Syst Biol. 61(3),
539-42.
Sarojam R., Sappl P.G., Goldshmidt A., Efroni I., Floyd S.K., Eshed Y., and
Bowmana J.L. (2010). Differentiating Arabidopsis shoots from leaves by combined
YABBY activities. Plant Cell 22, 2113-2130.
Sarvepalli K. and Nath U. (2011). Interaction of TCP4-mediated growth module with
phytohormones. Plant Signal Behav 6 (10), 1440-1443.
64
Shleizer-Burko S., Burko Y., Ben-Herzel O., and Ori N. (2011). Dynamic growth
program regulated by LANCEOLATE enables flexible leaf patterning. Development 138,
695-704.
Tanaka Y., Yamamura T., and Terakawa T. (2011). Identification and expression
analysis of the Cyclamen persicum MADS-box gene family. Plant Biotechnology 28,
167–172.
Tian Q., Uhlir N.J., and Reed J.W. (2002). Arabidopsis SHY2/IAA3 inhibits auxinregulated gene expression. Plant Cell. 14(2):301-19.
Tsukaya H. (2006). Mechanism of leaf-shape determination. Annu Rev Plant Bio 57,
477-496.
Wege S., Scholz A., Gleissberg S., and Becker A. (2007). Highly efficient virusinduced gene silencing (VIGS) in california poppy (Eschscholzia californica): An
evaluation of VIGS as a strategy to obtain functional data from non-model plants. Ann.
Bot. 100, 641-649.
Yanai O., Shani E., Russ D., and Ori N. (2011). Gibberellin partly mediates
LANCEOLATE activity in tomato. 68, 571-582.
65
CHAPTER 3: ESCHSCHOLZIA CALIFORNICA PHANTASTICA (ECPHAN)
REGULATES PETAL MORPHOGENESIS IN THE CALIFORNIA POPPY
Abstract
Throughout evolution, genes have been co-opted from one aspect of plant
development into another. The ARP genes are associated with adaxial-abaxial
polarization and control of KNOX gene expression in the leaf blade and in flower petals.
In the basal eudicot Eschscholzia californica, virally-induced silencing of the
homologous gene EcPHAN modifies petals to produce ectopic growth axes, partial
radialization, and/or dissection of the distal edge. In contrast to mutants identified in core
eudicot species, no leaf phenotype was observed, possibly due to decoupling of EcPHAN
from leaf development, efficient compensation by other adaxial specifiers in the leaf, or
the presence of a subfunctionalized paralog in Eschscholzia.
Introduction
The morphological diversity of plants is evidence for the flexibility of the genetic
pathways that direct the development of structures, organs, and tissues. Intensive study
of development in core eudicots such as Arabidopsis thaliana has identified many of the
genetic regulatory pathways responsible for organogenesis, and it is now possible to
establish other species as phylogenetic landmarks for evolutionary-developmental
studies, as well as to compare between close relatives with divergent morphological
features.
66
The plant leaf is the product of a complex four-dimensional pattern of genetic
interactions. Key events that must occur during leaf development are the designation of
the incipient primordium as a region distinct from the shoot apical meristem (SAM), the
specification of dorsiventral (adaxial-abaxial), proximodistal, and mediolateral axes,
patterning of the leaf blade, and the differentiation of cells to form the anatomy of the
leaf (Blein et al., 2010). The processes may be broadly divided into three stages,
initiation, morphogenesis and histogenesis, wherein the general morphology of the leaf
(especially the blade) is established by dividing, undifferentiated cells, and then the leaf
ceases to change in its overall shape as the frequency of cell division slows and cells
differentiate and expand. Altered regulation of the maintenance of cells in an
undifferentiated state, the transition from morphogenesis to histogenesis, and the
subsequent regulation of cell division and expansion creates a variety of mature
morphologies and, therefore, the expression, regulation, and function genes relevant to
these processes are of interest to evolutionary-developmental biologists.
The ARP genes, named after ASYMMETRIC LEAVES 1 (Arabidopsis thaliana;
Byrne et al. 2000), ROUGH SHEATH 2 (Zea mays; Schneeberger et al. 1998) and
PHANTASTICA (Antirrhinum majus; Waites and Hudson, 1995) are transcription factors
of the MYB (Waites et al. 1998) family. In several eudicot species, ARP genes are
involved in the specification of the incipient leaf primordium where they are involved in
the initial downregulation of class I KNOX genes. ARP genes also seem to have a
conserved role in the promotion and maintenance of the adaxial leaf domain (Kidner and
Timmermans 2010). Promotion of adaxial cell fates is performed in concert with the
67
Class III homeodomain leucine zipper (HD-ZIP) genes PHABULOSA, PHAVOLUTA and
REVOLUTA (Prigge et al., 2005) and other factors. KANADI and YABBY genes instead
promote abaxial identity (Sarojam et al., 2010), and mutual repression interactions
between adaxial and abaxial factors establish a boundary along which the primordial leaf
margin forms and blade outgrowth occurs. Consequently, mutants in whom either of the
two identities is not established, fail to form a margin and develop into bladeless, often
radialized structures (Waites and Hudson 1995). The first such mutant characterized was
PHANTASTICA in Antirrhinum majus, in which loss of AmPHAN results in radial leaves
with only abaxial surface (Waites and Hudson, 1995). Some leaves develop a margin and
blade and are bifacial; however, they may produce ectopic patches of abaxial tissue on
their adaxial surface, suggesting local loss of adaxial identity. These patches are
surrounded by an ectopic margin marking the boundary between the two identities.
ARP activity requires interaction with homologs of the Arabidopsis thaliana genes
ASYMMETRIC LEAVES 2 and HISTONE DEACETYLASE 6 (HDA6) (Byrne et al. 2000,
Luo et al. 2012) to form a regulatory complex that represses the expression of Class I
KNOX genes (Kim et al., 2003). Rather than directly determining cell fate, the primary
function of ARP genes is likely the repression of KNOX genes, which maintain cell
indeterminacy in the shoot meristem and in nascent lateral organs. Recently, Koyama et
al. (2010) reported activation of ASYMMETRIC LEAVES 1 by CINCINNATA-like TCP
genes, which are known to promote cell fate determinacy and the transition of leaf
primordia from a morphogenetic state to maturation (Nath et al,. 2003; Ori et al., 2007)
68
The role of ARP genes has also been studied in core eudicot species with
dissected leaves. In Solanum lycopersicum, ARP genes appear to control the positioning
of leaflets along the leaf axis (Kim et al., 2004). Evidence supports the notion that the
size and shape of the adaxial domain as a component of the leaf primordium dictates the
patterning of dissection (e.g. pinnate or palmate) and the placement of leaflets (Zoulias et
al. 2012). In Pisum sativum, the crispa mutation represents a loss-of-function of the pea
ARP homolog and results in abaxialized leaflets and ectopic stipules (Tattersall et al.,
2005).
ARP genes also influence the development of petals, which like leaves develop
dorsiventral, proximodistal and mediolateral axes. Mutant petals of Antirrhinum
PHANTASTICA exhibit radialized needle-like petal lobes and the establishment of
ectopic margins surrounding patches of abaxial tissue growth similar to those seen in
leaves (Waites and Hudson, 1995). Similarly, floral organs in Pisum sativum crispa
mutants exhibit polarity defects (Tattersall et al., 2005).
Although some aspects of ARP function are conserved between species, there is
considerable variation in both expression patterns and mutant phenotypes between
lineages. For instance, mutants of the Zea mays ARP gene ROUGH SHEATH 2 exhibit
no effects of leaf polarity (Timmermans et al. 1999). This study characterizes the knockdown phenotype of a PHAN ortholog, EcPHAN, in the basal eudicot Eschscholzia
californica (Papaveraceae). Virus-induced gene silencing resulted in an abnormal petal
phenotype with ectopic growth axes; in contrast, leaf development appeared to be
unaffected.
69
Methods
Phylogenetic analyses
Putative basal eudicots and basal angiosperm homologs of AS1, RS2 and
PHANTASTICA were obtained from the 1KP transcriptome database using blastn with
EcPHAN as the search query. Similar sequences were aligned with MAFFT v7 (Katoh
and Standley, 2013) and divergent sequences eliminated. Remaining, complete coding
sequences were translated with the Expasy Translate tool (Gasteiger et al., 2003) and the
resultant amino acid sequences were again aligned with MAFFT v7. A Phyml 4 – format
file was submitted to the ProtTest 2.4 server (Abascal et al., 2005) to select an
appropriate evolutionary model for Bayesian analysis. JTT + G (Jones’ model with a
gamma distribution of variable sites) was selected under AIC, AICc and BIC criteria.
Phylogenetic tree form and branch posterior probabilities were inferred with MrBayes 3.2
(50,000 generations, standard deviation of split frequencies <0.001; sump burnin = 400;
sumt burnin=400) (Ronquist et al., 2012).
Cloning and sequencing of EcPHAN
A 334 bp sequence of EcPHAN (AY228766.1) downstream of the conserved
MYB domain was amplified from cDNA and cloned into pTRV2 using XbaI- and SacItailed primers EcPh14F (TCTAGATACTTCCACCTTGGCTTT) and EcPh15R
(GAGCTCCTCTGACTCGAGTTGTAG). The resultant pTRV2-EcPHAN vector was
confirmed by Sanger sequencing and cloned into Agrobacterium tumefaciens strain
GV3101.
70
RT-PCR expression profile
To study expression of EcPHAN, total RNA was isolated from flowers, stems
(peduncles), roots, mature leaves and vegetative shoot tips and reverse-transcribed with
AMV reverse transcriptase (Roche) and an oligo-dT adaptor primer
(GACTCGAGTCGACATCGATTTTTTTTTTTTTTTT). cDNA concentration was
normalized by inspecting band brightness after gel electrophoresis of total RNA.
EcPHAN was amplified with primers EcPh399F
(AGGAAGAACAACGACTTGTAATCCGTC) and EcPh1028R
(TTCAACCCTTTTAAGCCTCCAAGCTGC), yielding a 629 bp product. Gel band
brightness was inspected after 30, 35, and 40 cycles to determine a suitable pre-saturation
stage of amplification, and 31 cycles were used to assess relative expression in different
tissues.
VIGS Infiltration technique
To prepare the VIGS infiltration mixture, single colonies containing the pTRV2
construct of interest were cultured for 24 hours in 5ml LB containing 5ml LB containing
50ug/ml kanamycin and 50ug/ml gentamycin. Colonies containing the pTRV1 plasmid
(Wege et al., 2007) were cultured identically. Cells of each type were separated from
their media by centrifuging 1ml of each culture at 5000 x g for 30 seconds then
resuspended together in 1ml 5% w/v sucrose. Seedlings with between one and three
leaves were mechanically wounded at the hypocotyl and 2µl of the infiltration mixture
was pipetted onto the wound. The experiment was performed twice. In the first replicate
71
21 pTRV2-empty and 44 pTRV2-EcPHAN produced at least one flower. In the second
replicate 13 pTRV2-empty and 88 pTRV2-EcPHAN plants flowered.
Plant culture
Seeds were sown in trays with either 48 x n cm2 or 32 x n cm2 wells in a standard
potting soil with good drainage and covered with clear lids. After sowing, the seeds were
stratified at 4°C and in darkness for between three days and one week before transfer to
constant light (concentration) at 22°C. Plants were watered with tap water for two weeks
after germination, after which 250µl/l ‘Grow 7 - 9 - 5’ fertilizer (Dyna-Gro) was added.
Scanning electron microscopy
Petals with abnormal phenotypes from pTRV2-EcPHAN plants were allowed to
expand fully before removal and preservation in 70% ethanol before drying using a
carbon dioxide critical point dryer (Balzers CPD 030, Bal-tec (now Leica
Microsystems)). Dried material was dissected with a razor blade as required before
mounting on aluminum stubs and sputter coating (Balzers SCD 050). The specimens
were viewed and photographed using a Zeiss EVO-50XVP (University of Dayton) at
15kV.
Results
EcPHAN is an ARP homolog in the Papaveraceae
EcPHAN (AY228766.1) is homologous in structure and conserved protein
domains to ASYMMETRIC LEAVES 1, ROUGH SHEATH 2 and PHANTASTICA, having
72
a similar N-terminal MYB domain. Cloning and mining of the 1KP database uncovered
single homologs of PHANTASTICA in Eschscholzia and other Papaveraceae species, with
the exception of a duplication in Argemone mexicana. Another important leaf
developmental gene, CINCINNATA, has undergone duplication in Argemone mexicana,
and it is possible that a whole genome duplication has occurred. The amino acid
sequence encoded by EcPHAN clusters closely with putative Papaveraceae
PHANTASTICA homologs, and is more closely related to ASYMMETRIC LEAVES 1 than
to PHANTASTICA, found in the less derived species Antirrhinum majus.
Figure 12. Phylogeny of ASYMMETRIC LEAVES 1, ROUGH SHEATH 2 and
PHANTASTICA and their homologs in the Papaveraceae and in the basal angiosperm
Amborella trichopoda. Numbers indicate posterior probabilities.
EcPHAN is differentially expressed in Eschscholzia organs
73
RT-PCR profiling of EcPHAN revealed strong expression in shoot tips with developing
leaf primordia, as well as in elongated stem tissue of reproductive stems and in flowers
(Figure 13). Weak expression was found in root tissue and in mature leaf tissue.
Figure 13. RT-PCR expression profile of EcPHAN. Expression is strongest in shoot tips
containing the SAM and developing leaf primordia (SAM), and in mature elongated
pedicels (stem). Expression was also strong in floral tissue. Weak expression was
detected in root tissue and in mature leaves.
EcPHAN VIGS plants exhibited changes in petal morphology and produced additional
petaloid laminae on the adaxial surfaces of petals
Silencing of EcPHAN induced a range of abnormal petal phenotypes (phenotypic
frequencies were 12/44 (27%) and 8/88 (5%) in independent experiments). In mildly
affected flowers, irregular distal dissection and cleavage of petals occurred (Figure 14 B)
along with irregular longitudinal ridges and folds, suggesting perturbed growth. Petals
were often narrowed (Figure 14 C) and sometimes involuted (Figure 14 E, third from
left). . The most conspicuous phenotype involved flaps of additional petal laminae on the
adaxial surfaces (Figure 14 C). These ectopic petal flaps varied in number and width, but
often extended almost as far along the proximo-distal petal axis as the regular petal
74
lamina, broadening distally. Epidermal coloration of these petal flaps was mostly pale
yellow, more similar to the wild-type abaxial petal surface, contrasting with the orange
color of the adaxial petal surface not covered by ectopic flaps. Ectopic petal flaps
emerged from or near the base of petals, remaining or becoming fused along some or
most of the petals’ lengths.
In some cases, ectopic petal flaps were connected with the regular petal along
their margins, forming a double layered and partially hollow tube that superficially
resembled a corollary tube in synpetalous species (Figure 14 D). The outer surface had a
glossy yellow epidermis resembling the abaxial epidermis in wild-type petals, whereas
the silky-orange color of wild-type adaxial epidermis was evident in the open distal part
of the trumpet-shaped petal. Sepals, stamens, and gynoecia developed normally.
Phenotypes were manifest in the terminal and in lateral flowers.
Scanning electron microscopy provided details of the surface of the ectopic
laminae and fusion between the ectopic and regular laminae (Figure 15). In studied
examples, the superficial tissue flaps resembled normal petals in terms of cell sizes,
shapes and apparent identities, however, the longitudinal ripples and ridges seen in Figure
14 (B and C) were clear on the ‘adaxial’-type faces (Figure 15 A and B). Flaps were
attached at the bases of petals and remained partially fused (Figure 15 C and D) and
sometimes became fused to the normal petal again at other points (Figure 14 A).
75
Figure 14. VIGS-induced EcPHAN knockdown phenotypes. In contrast to those of the
wild type flower (A), the petals of pTRV2-EcPHAN plants exhibited dissection (star in
B), narrowing (C, D), ectopic petaloid laminae on their adaxial surfaces (C), or hollow,
tubular petals (D, E).
76
Figure 15. Scanning electron microscopy of petals exhibiting the EcPHAN knockdown
phenotype. (A) An additional, ectopic lamina (right) overlaps and is partially fused to the
adaxial surface of the petal below (left) . Scale = 1mm. The distal edges of both are
uneven and have deep incisions. (B) Distortion of the normally smooth petal surface was
observed on the adaxial (AD) faces of petals (P) and also on the near face of ectopic
laminae (L). Scale = 100µm. (C) A longitudinal section through a petal with ectopic
tissue showing the site of initiation (arrow) of that tissue. Scale = 200µm. The ectopic
tissue remains or has become fused to the petal along part of its length. (D) Enlarged
view of the initiation site (arrow). Scale = 100µm.
No abnormal phenotype was observed in the stems and leaves of pTRV2EcPHAN plants, even in those exhibiting strong floral phenotypes. Counts of leaflets on
leaves at nodes six through ten indicated that pTRV2-EcPHAN plants had the same levels
of leaf dissection as empty vector control plants (data not shown).
77
Discussion
The changing role of PHAN in leaf development.
PHAN genes were first studied in plants with simple leaves, Antirrhinum majus and
Arabidopsis thaliana, where expression of ARP genes appear mutually exclusive with
class I KNOX gene expression. Loss-of-function of PHAN in Antirrhinum produces a
range of leaf phenotypes that suggest complete or partial loss of adaxial leaf identity
(Waites and Hudson, 1995). In Nicotiana tabacum, comparable unifacial and peltate
phenotypes occur, but were interpreted as resulting from delayed tissue differentiation
due to extended KNOX expression when PHAN is silenced (McHale and Koning 2004).
Several loss-of-function alleles of Arabidopsis thaliana AS1 retain a bifacial, margined
leaf. In maize, rough sheath2 mutants maintain adaxial-abaxial polarity (Timmermans et
al., 1999). This suggests variable evolutionary roles of PHAN in simple-leaved species.
In dissected-leaved species of the core-eudicot lineage, leaf expression of PHAN has been
shown to co-occur with KNOX genes. In Solanum lycopersicum, an asterid core eudicot
with basipetal-pinnate leaf architecture, silencing PHAN caused a change in leaf
architecture to palmate or peltate (Kim et al., 2003). In Cardamine hirsuta, a rosid core
eudicot with basipetal-pinnate leaves (Hay and Tsiantis 2006), mutation in a PHAN
homolog also resulted in the compression of the leaf axis and altered arrangement of
leaflets. Leaves of crispa mutants in Pisum sativum, a rosid core eudicot acropetalpinnate leaves, showed compression of the leaf axis and peltate leaflets (Tattersall et al.,
2005). These data suggest that that leaf development is affected in a species and
morphology-dependent way in various core eudicots. This study presents the first knock-
78
down study of an ARP gene in a basal eudicot. Silencing of EcPHAN in Eschscholzia
californica did not produce any leaf phenotype. Leaves were bifacial and had normal
architecture. No ectopic tissue was observed, and the leaf axis was not compressed.
Levels of leaf dissection did not differ between pTRV2-empty and pTRV2-EcPHAN
plants. The RT-PCR data provided in this study are consistent with co-expression of
EcPHAN in either the shoot apical meristem and/or leaf primordia in Eschscholzia, where
class I KNOX genes have been shown to be expressed (Groot et al., 2005, Stammler et
al., in press). Higher-resolution expression analyses of EcPHAN by in situ hybridization
would be necessary to determine whether co-expression with KNOX genes occurs in this
species. Together, these results may indicate that the regulation by PHAN of adaxial leaf
identity, mesophyll differentiation, or leaflet patterning along the leaf axis evolved in
core eudicots after the split from Eschscholzia ancestors. Alternatively, the role of
EcPHAN in these processes may be masked by the activity of redundant adaxial identity
factors, such as class III HD-ZIP genes. Experiments in which Eschscholzia HD-ZIP
orthologs are silenced together with EcPHAN would allow us to investigate this
possibility.
EcPHAN specifically affects petal development and morphology
The formation of ectopic petal laminae from the adaxial petal surface in pTRV2EcPHAN flowers resembles the patches of ectopic tissue that develop in Antirrhinum
phantastica mutant corollas, where they arise from a defect in the establishment or
maintenance of adaxial identity, followed by the formation of a boundary-induced ectopic
79
margin. It is likely that the ectopic petal flaps reflect a role of EcPHAN as a determinant
of adaxial identity, that is conserved between basal and core eudicots. Ectopic lamina
flaps in pTRV2-EcPHAN petals can be interpreted as the induction of an entirely new
lamina by the ectopic expression of KNOX genes that are normally suppressed by PHAN.
Class I KNOX genes are expressed in the Eschscholzia floral meristem but downregulated
in floral organ primordia (Groot et al., 2005). Petals in Eschscholzia plants silenced with
two KNOX I genes, SHOOTMERISTEMLESS1 (EcSTM1) and EcSTM2 does not affect
petal growth. The ectopic outgrowths of pTRV2-EcPHAN petals have their own adaxialabaxial polarity. The pale, abaxial-like pigmentation of the upper surface of ectopic flaps
suggests homology to the wild type abaxial face. The inner lower face derives context
and presumably identity from its continuity with the adaxial face of the regular petal.
Weaker phenotypes with narrowed petals with ridges and distal incisions likely
reflect uneven longitudinal expansion due to adaxial tissue identity defects. Narrowed
petals with incisions were also observed in EcYABBY VIGS petals that are likely due to
defects in abaxial tissue identity (Bartholmes et al., in prep.).
Some petals in which the ectopic surface developed in continuum the regular petal
exhibited a ridge along the center of their adaxial surface, suggesting that the margins
were rolled inwards and subsequently fused; however, this contrasts with the clear
separation of most ectopic laminae from the lateral edges of the petals. All ectopic flaps
originated close to the proximal end of the petal, suggesting that ectopic growth is
initiated early in petal development at the base of the petal primordium, prior to the
expansion of the petal. The fact that ectopic flaps often expanded to almost the same
80
extent as the regular petal underneath suggests that the ectopic growth axes were initiated
early, both growth axes developing over a similar time period and at similar rates.
The striking phenotype observed in pTRV2-EcPHAN VIGS plants suggests that
ARP gene function in petal morphogenesis is conserved between basal eudicots, rosid,
and asterid eudicots. However, the developmental outcome of compromising PHAN
function is quite different between Eschscholzia and Antirrhinum. This illustrates that the
role of species or lineage-specific morphogenetic contexts in specifying specific
outcomes of a conserved function, necessitating a characterization of the developmental
context in the species under study. Further, the absence of a leaf phenotype in pTRV2EcPHAN plants suggests that EcPHAN functions have diverged from those of
PHANTASTICA in Antirrhinum and AS1 in Arabidopsis.
References
Abascal F., Zardoya R. and Posada D. (2005). ProtTest: Selection of best-fit models of
protein evolution. Bioinformatics: 21(9), 2104-2105.
Blein T., Hasson A., and Laufs P. (2010). Leaf development: what it needs to be
complex. Curr. Opin. Plant Biol. 13, 75-82.
Byrne M.E., Barley R., Curtis M., Arroyo J.M., Dunham M., et al. (2000).
Asymmetric leaves1 mediates leaf patterning and stem cell function in Arabidopsis.
Nature 408, 967–971.
81
Gasteiger E., Gattiker A., Hoogland C., Ivanyi I., Appel R.D. and Bairoch A. (2003).
"ExPASy: The proteomics server for in-depth protein knowledge and analysis". Nucleic
Acids Research 31 (13), 3784–3788.
Groot E.P., Sinha N., and Gleissberg S. (2005). Expression patterns of STM-like
KNOX and Histone H4 genes in shoot development of the dissected-leaved basal eudicot
plants Chelidonium majus and Eschscholzia californica (Papaveraceae). Plant Mol. Biol.
58, 317-331.
Hay A. and Tsiantis M. (2010). KNOX genes: versatile regulators of plant development
and diversity. Development 137, 3153-3165.
Katoh K. and Standley (2013). MAFFT multiple sequence alignment software version
7: improvements in performance and usability. Molecular Biology and Evolution 30,
772-780.
Kidner C.A. and Timmermans M.C. (2010). Signaling sides adaxial-abaxial patterning
in leaves. Curr Top Dev Biol. 91, 141-168.
82
Kim M., McCormick S., Timmermans M., and Sinha N. (2003). The expression
domain of PHANTASTICA determines leaflet placement in compound leaves. Nature
424, 438-443.
Kim S., Soltis D.E., Soltis P.S., Zanis M.J., and Suh Y. (2004). Phylogenetic
relationships among early-diverging eudicots based on four genes: were the eudicots
ancestrally woody? Mol. Phylogenet. Evol. 31, 16-30.
Koyama T., Mitsuda N., Seki M., Shinozaki K., and Ohme-Takagi M. (2010). TCP
Transcription Factors Regulate the Activities of ASYMMETRIC LEAVES1 and miR164,
as Well as the Auxin Response, during Differentiation of Leaves in Arabidopsis. The
Plant Cell Online 22, 3574-3588.
Luo M., Yu C., Chen F., Zhao L., Tian G., Liu X., Cui Y., Yang J., and Wu K.
(2012). Histone Deacetylase HDA6 Is Functionally Associated with AS1 in Repression
of KNOX Genes in Arabidopsis. 8, e1003114.
McHale N.A. and Koning R.E. (2004). PHANTASTICA regulates development of the
adaxial mesophyll in Nicotiana leaves. Plant Cell 16, 1251–1262.
Nath U., Crawford B.C.W., Carpenter R., and Coen E. (2003). Genetic control of
surface curvature. Science 299, 1404-1407.
83
Ori N., Cohen A.R., Etzioni A., Brand A., Yanai O., Shleizer S., Menda N.,
Amsellem Z., Efroni I., Pekker I., Alvarez J.P., Blum E., Zamir D., and Eshed Y.
(2007/06//print). Regulation of LANCEOLATE by miR319 is required for compoundleaf development in tomato. Nat Genet 39, 787-791.
Prigge M.J., Otsuga D., Alonso J.M., Ecker J.R., Drews G.N., and Clark S.E. (2005).
Class III Homeodomain-Leucine Zipper Gene Family Members Have Overlapping,
Antagonistic, and Distinct Roles in Arabidopsis Development. The Plant Cell Online 17,
61-76.
Tattersall A.D., Turner L., Knox M.R., Ambrose M.J., Ellis T.H.N., Hofer J.M.I..
(2005). The mutant crispa reveals multiple roles for PHANTASTICA in pea compound
leaf development. Plant Cell 17, 1046–1060.
Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B,
Liu L, Suchard MA, and Huelsenbeck JP. (2012). MrBayes 3.2: efficient Bayesian
phylogenetic inference and model choice across a large model space. Syst Biol. 61(3),
539-542.
Sarojam R., Sappl P.G., Goldshmidt A., Efroni I., Floyd S.K., Eshed Y., and
Bowmana J.L. (2010). Differentiating Arabidopsis shoots from leaves by combined
YABBY activities. Plant Cell 22, 2113-2130.
84
Schneeberger R., Tsiantis M., Freeling M., Langdale J.A.(1998). The rough sheath2
gene negatively regulates homeobox gene expression during maize leaf development.
Development 125, 2857–2865.
Timmermans M.C.P., Hudson A., Becraft P.W., Nelson T. (1999). ROUGH
SHEATH2: a Myb protein that represses knox homeobox genes in maize lateral organ
primordia. Science 284, 151–153.
Waites R. and Hudson A. (1995). Phantastica - a Gene Required for Dorsoventrality of
Leaves in Antirrhinum-Majus. Development 121, 2143-2154.
Waites R., Selvadurai H., Oliver I., and Hudson A. (1998). The PHANTASTICA gene
encodes a MYB transcription factor involved in growth and dorsoventrality of lateral
organs in Antirrhinum. Cell 93, 779-789.
Wege S., Scholz A., Gleissberg S., and Becker A. (2007). Highly efficient virusinduced gene silencing (VIGS) in california poppy (Eschscholzia californica): An
evaluation of VIGS as a strategy to obtain functional data from non-model plants. Ann.
Bot. 100, 641-649.
85
Zoulias N., Koenig D., Hamidi A., McCormick S., and Kim M. (2012). A role for
PHANTASTICA in medio-lateral regulation of adaxial domain development in tomato and
tobacco leaves. Ann. Bot. 109, 407-418.
86
CHAPTER 4: DUPLICATED STM-LIKE KNOX I GENES ACT IN FLORAL
MERISTEM ACTIVITY IN ESCHSCHOLZIA CALIFORNICA (PAPAVERACEAE)
This chapter has been published by the journal Genes, Development and Evolution. The
contribution of this author was the selection and alignment of angiosperm KNOX I DNA
sequences, their alignment, and the assembly of a phylogenetic tree of those sequences by
Bayesian inference.
Authors
Angelika Stammler • Sandra S. Meyer • Alastair R. Plant • Brad T. Townsley • Annette
Becker • Stefan Gleissberg
Abstract
In angiosperms, the shoot apical meristem is at the origin of leaves and stems and
is eventually transformed into the floral meristem. Class I knotted-like homeobox (KNOX
I) genes are known as crucial regulators of shoot meristem formation and maintenance.
KNOX I genes maintain the undifferentiated state of the apical meristem and are locally
downregulated upon leaf initiation. In Arabidopsis, KNOX I genes, especially
SHOOTMERISTEMLESS (STM), have been shown to regulate flower development and
the formation of carpels. We investigated the role of STM-like genes in the reproductive
development of Eschscholzia californica, to learn more about the evolution of KNOX I
gene function in basal eudicots. We identified two orthologs of STM in Eschscholzia,
EcSTM1 and EcSTM2, which are predominantly expressed in floral tissues. In contrast, a
87
KNAT1/BP-like and a KNAT2/6-like KNOX I gene are mainly expressed in vegetative
organs. Virus induced gene silencing (VIGS) was used to knockdown gene expression,
revealing that both EcSTM genes are required for the formation of reproductive organs.
Silencing of EcSTM1 resulted in the loss of the gynoecium and a reduced number of
stamens. EcSTM2-VIGS flowers had reduced and defective gynoecia and a stronger
reduction in the number of stamen than observed in EcSTM1-VIGS. Co-silencing of both
genes led to more pronounced phenotypes. In addition, silencing of EcSTM2 alone or
together with EcSTM1 resulted in altered patterns of internodal elongation and sometimes
in other floral defects. Our data suggest that some aspects of STM function present in
Arabidopsis evolved already before the basal eudicots diverged from core eudicots.
Introduction
Apical meristems are at the origin of growth and development in plants. Shoot
apical meristems (SAMs) produce leaves from their periphery, while maintaining a
central pool of initials, or stem cells, that allow for principally indefinite shoot
development. A family of plant-specific homeobox genes, the class I knotted-like (KNOX
I) homeobox genes, is crucial for maintaining the continuous organ-producing activity of
SAMs. Loss-of function causes the failure to replenish the pluripotent pool of cells in the
central zone of the SAM, so that further shoot growth and consequently leaf initiation are
arrested (Endrizzi et al. 1996; Long et al. 1996). The central role of KNOX I genes in
SAM functioning is demonstrated by the fact that overexpression of KNOX I genes is
sufficient to form ectopic SAMs in leaves (Chuck et al. 1996; Brand et al. 2002).
88
Exclusion of KNOX I gene products from leaf founder cells is required for a leaf-specific
determinate developmental program to be established, and the phytohormone auxin as
well as the transcription factors ASYMMETRIC LEAVES 1 (AS1) and FILAMENTOUS
FLOWER (FIL) contribute to the downregulation of KNOX I genes in incipient leaf
primordia (Hamant and Pautot 2010). The separation of the leaf from the SAM is further
defined by KNOX I interaction with CUP SHAPED COTYLEDON-LIKE (CUC) genes
(Aida et al. 1999; Hay and Tsiantis 2010). KNOX I gene function in the SAM is mediated
through regulation of the phytohormone cytokinin which promotes cell proliferation in
the SAM, and gibberellin, which promotes a determinate leaf program in the absence of
KNOX I (Jasinski et al. 2005). However, in many species KNOX I gene expression is reestablished in the context of dissected leaf development, allowing leaflet initiation from
the primordial margins for a brief period of time (Hareven et al. 1996; Bharathan et al.
2002; Champagne and Sinha 2004; Shani et al. 2009).
Duplication of angiosperm KNOX I genes has led to a differentiation of their
general function in SAM maintenance and organ differentiation (Hay and Tsiantis 2010).
In Arabidopsis, the SHOOTMERISTEMLESS (STM) gene assumes its role as early as the
establishment of the embryonic SAM, and remains the major KNOX I contributor to
SAM function throughout vegetative, inflorescence, and flower development (Hamant
and Pautot 2010). BREVIPEDICELLUS (BP), also known as KNAT1, and two recent
Arabidopsis duplicates, KNAT2 and KNAT6, have more restricted expression domains,
and loss-of-function mutations do not lead to SAM arrest, indicating that their role in
meristem function is less crucial. Mutations in the KNAT1/BP gene impair internode and
89
pedicel growth, and thus affect the function of intercalary meristems located outside and
below the SAM and the floral meristem (Venglat et al. 2002).
KNOX I proteins form complexes with BELL-like homeobox proteins, and
various dimer combinations between KNOX I and BELL are implicated in most KNOX I
functions. In addition to SAM maintenance and the control of dissected leaf development,
KNOX I and BELL genes control phyllotaxy and internode spacing in Arabidopsis
(Douglas et al. 2002; Venglat et al. 2002; Smith and Hake 2003; Kanrar et al. 2006;
Hamant and Pautot 2010). The function of KNAT1/BP in the pedicel and in the
inflorescence is mediated through interaction with other KNOX I and with BELL-like
homeodomain proteins and involves downregulation of KNAT6 and KNAT2 (Ragni et al.
2008).
BELL and KNOX I genes contribute to flower meristem specification by
regulating the floral meristem identity genes LEAFY (LFY) and APETALA 1 (AP1)
(Smith et al. 2004; Kanrar et al. 2008). Double mutants in the BELL genes PENNYWISE
(PNY) and POUNDFOOLISH (PNF) do not produce flowers, and LFY and AP1 levels are
reduced. In addition, STM-PNY/PNF act together with FLOWERING LOCUS T (FT) to
specify flower identity (Smith et al. 2011). Mutant combinations between stm-10 and ft/fd
produced more cauline leaves and coflorescences and only few flowers, or produced a
terminal cluster of leaves after which the meristem was aborted, and both LFY and AP1
fail to initiate expression (Smith et al. 2004; Kanrar et al. 2008).
A specific role of STM and other KNOX I genes in carpel formation has been
demonstrated in Arabidopsis (Endrizzi et al. 1996; Scofield et al. 2007; Alonso-
90
Cantabrana et al. 2007). All KNOX I genes participate in meristematic activity of the
ovule-bearing replum/placenta region of the gynoecium (Alonso-Cantabrana et al. 2007).
STM plays an essential role in carpel initiation, which fails if STM is silenced (Scofield et
al. 2007). STM overexpression can activate de novo carpel formation and can induce the
homeotic conversion of ovules to carpels (Scofield et al. 2007). No comparable effects
were observed in KNAT2 or KNAT1/BP mutants (Pautot et al. 2001, Chuck et al. 1996;
Lincoln et al. 1994; Belles-Boix et al. 2006).
Only very limited information is available about floral KNOX I loss-of-function
phenotypes in other species. In Zea mays, knotted1 loss-of-function results in a delayed
or a complete loss of gynoecium development, but may also cause an increase in carpel
number (Kerstetter et al. 1997). Hence more ancestral floral roles for KNOX I genes
outside of core eudicots remain inconclusive. We were interested in assessing the role of
KNOX I genes in the basal eudicots, a lineage positioned between Arabidopsis and other
core eudicots and monocot model systems in the grass family. Here we present the
cloning, phylogenetic, and expression analysis of four KNOX I genes in the California
poppy, Eschscholzia californica. We report phenotypic effects following virus-mediated
silencing of two STM orthologs in this poppy species. We demonstrate that STM genes
control gynoecium and androecium development in Eschscholzia, and have some
additional roles in the development of reproductive shoots. Our results suggest that the
specific role of STM genes in floral meristem activity during production of the fertile
whorls arose prior to the evolution of core eudicots.
91
Materials and Methods
Isolation of KNOX I genes
Genomic DNA from Eschscholzia californica was isolated with the DNeasy Plant
Mini Kit (QIAGEN GmbH, Hilden). Total RNA was isolated from Eschscholzia
californica shoot tips during late rosette stage by using the RNeasy Plant Kit (Qiagen,
Hilden, Germany). cDNA syntheses were carried out following the instructions for the
SuperScript III reverse transcriptase (Invitrogen, Karlsruhe, Germany) using an oligo
(dT) anchor primer (suppl. Table 2). To obtain the full open reading frame (ORF) of
EcSTM1, sequence information of a published partial clone (Groot et al., 2005) and
promoter sequences were used to design gene-specific primers. PCR with genomic DNA
using forward primer EcKn17F in the 5'UTR and reverse primers EcKn18R and
EcKn19R in the coding region completed the 5' end of EcSTM1. The 5' part of EcSTM2
was obtained with a similar approach using the primers EcKn30F and EcKn31R, and the
EcSTM2 3' end was obtained using 3'RACE (suppl. Table 2). Based on partial coding
regions, the 3' end of EcKNAT1 was cloned using 3'RACE with the primers EcKN21F
and EcKN27F; and the 3'end of EcKNAT2 was cloned using TAIL-PCR with primers
EcKN50F and the degenerate primers AD2-2 and AD5. TAIL PCR was also used to
clone the 5'ends of EcKNAT1 (using AD3 with EcKn38R and EcKn39R) and EcKNAT2
(using AD1-2 with EcKn42R and AD2-1 with EcKn43R). Subsequently, complete ORFs
of the four genes were isolated with restriction site-tailed primers located in the 5'UTRs
and 3'UTRs of the four genes (suppl. Table 2) and cloned into pGEM-T (Promega,
Madison WI, USA) or pART7 (Gleave, 1992). Restriction enzymes from Promega,
92
Madison WI, USA and Fisher Scientific, Pittsburgh PA, USA were used in the cloning
process. Each plasmid was sequenced in both directions.
Multiple sequence alignments and phylogenetic analysis
For the phylogenetic analysis of Eschscholzia KNOX I genes, nucleotide
sequences of selected asterid, rosid, basal eudicot, and monocot species were retrieved
from GenBank (http://www.ncbi.nlm.nih.gov) and The Gene Index Project
(http://compbio.dfci.harvard.edu/). Additional Papaveraceae sequences were retrieved
from PhytoMetaSyn (http://www.phytometasyn.ca/; suppl. Table 2). Nucleotide
sequences were aligned with MAFFT 6 (Katoh and Toh, 2008) using the G-INS-i
strategy with manual editing in MacClade 4.08 (suppl. Table 3). Poorly conserved areas
5' to the MEINOX domain, and 5' to the ELK/Homeodomain encoding DNA sequence,
as well as the 3' end of the ORFs were removed, and incomplete sequences that did not
cover the conserved areas were excluded. A concatenated data set of 582 nucleotides was
used for Bayesian analyses with MrBayes v3.2. GTR was used as the least specific
evolutionary model implemented in MrBayes since models suggested by JModelTest2
(Darriba et al. 2012) were not available in MrBayes. The algorithm was run for 1,000,000
generations with sampling every 100 generations, giving a final standard deviation of less
than 0.01. The burnin for parameter values and for trees was set to 2000. Two nucleotide
datasets were run, one that included class II KNOX genes as outgroup (62 genes from 23
genera) and one with class I KNOX genes only (53 genes from 22 genera). A smaller
dataset with translated amino acid sequences that focused on Papaveraceae sequences
93
was also run. For this analysis with 31 sequences from ten species, the JTT + I + G
evolutionary model (Jones et al. 1992) was selected using ProtTest 2.4 (Abascal et al.
2005) according to AIC, AICc and BIC. For all analyses, consensus trees with the
posterior probabilities of bifurcations were viewed and analysed in Archaeopteryx v1.
RT-PCR
For expression profiles, total RNA was isolated from various tissues of several
stages of plant development using the RNeasy Plant Kit (Qiagen GmbH, Hilden,
Germany) or Plant-rna-OLS (OLS OMNI Life Science GmbH & Co. KG, Hamburg,
Germany). cDNA was generated by reverse transcription of 200 ng RNA by SuperScript
III Kit (Invitrogen, Karlsruhe, Germany) in combination with the Oligo-T anchor primer
AB05. To test for VIGS-induced downregulation of KNOX I genes, total RNA was
extracted from individual terminal flower buds (diameter less than 2 mm) of nine plants
per experiment, three weeks after inoculation with the VIGS construct, using the RNeasy
Plant Kit Micro (Qiagen GmbH, Hilden, Germany), and reverse transcribed.
Amplification of a 191-bp fragment of EcActin2 was used to normalize the cDNA pools
for RT-PCR. RT-PCR for KNOX I genes was conducted with gene specific primers
(EcSTM1-RT-fw, EcSTM1-RT-rev EcSTM2-RT-fw, EcSTM2-RT-rev). Primers were
designed to yield 799-bp and 244-bp fragments for EcSTM1 and EcSTM2, respectively,
as well as 829-bp and a 848-bp fragments for EcKNAT1 and EcKNAT2/6. PCR was
performed in 25µl volumes containing 1x GreenGoTaq Flexi buffer, 0,2 mM dNTPs,
10µl of each primer, 2 mM MgCl2, 0,5 U GoTaq DNA polymerase and 10µl 1:5 to 1:200
94
diluted cDNA with the following cycling program: 96 °C for 2 min, 94 °C for 30 s (step
2), 54° C for 60 s (step 3), 72 °C for 60 s (step 4) and a final extension of 10 min at 72
°C. Steps two through four were repeated 29 to 37 times. EcSTM1 was amplified for 35
cycles, EcSTM2, EcKNAT1, and EcKNAT2/6 for 37 cycles, and EcActin2 for 30 cycles.
Virus induced gene silencing (VIGS)
VIGS was performed using the tobacco rattle virus system (Liu et al. 2002). To
silence EcSTM1, a 387-bp fragment of EcSTM1 between the KNOX and ELK domains
was directionally cloned into pTRV2 using XbaI and SacI restriction sites (pTRV2EcSTM1b). A construct containing the full-length EcSTM1 coding region (1111 bp) was
also cloned using BamHI and SacI restriction sites (pTRV2-EcSTM1c). To silence
EcSTM2, a 604 bp fragment containing the ELK/homeodomain and the 3'-end of
EcSTM2 was cloned using EcoRI restriction sites yielding pTRV2-EcSTM2f. To target
both EcSTM1 and EcSTM2, the gene fragments used in pTRV2-EcSTM1b and pTRV2EcSTM2f were combined into plasmid pTRV2-EcSTM1b+2f. Tailed primers used for
directional cloning are listed in suppl. Table 2. Each pTRV2-STM construct as well as
pTRV1 and empty control vector pTRV2-E were transformed into Agrobacterium
tumefaciens strain GV3101. Inoculation of Eschscholzia plants with a mixture of A.
tumefaciens strains pTRV1 and one specific pTRV2 plasmid was conducted as described
previously (Wege et al. 2007) with the modification that the infection solution was
applied to the hypocotyls of 2-3 weeks old plants using a 2 ml syringe combined to a 0.45
x 25 mm needle. Growing conditions were the same as described previously (Wege et al.
95
2007), and flowers were manually cross-pollinated. In each experiment, a small number
of plants inoculated with pTRV2-EcPDS were included to confirm successful silencing
through the associated photobleaching phenotype (Wege et al. 2007). Scoring was based
on the about 70-80% of plants that survived inoculation, and focused on the terminal
flower and the two flowers opening after the terminal flower. The number of flowers to
be scored was further reduced by flower bud abortion (up to 20% of buds) and
individuals that did not commence flowering within a nine week period after inoculation
(up to 20% of plants). There was no apparent difference between the experimental and
control batches regarding lethality, bud abortion, or non-flowering plants.
Results
Orthology of Eschscholzia class I KNOX I genes
All four class I KNOX genes isolated from shoot cDNA contained the MEINOX
domain with the containing KNOX A, KNOX B domains, as well as an ELK and
homeodomain typical of KNOX genes (Figure 16). BLAST searches indicated that
Eschscholzia has two STM-like paralogs that are co-orthologous with Arabidopsis STM.
The open reading frame (ORF) of EcSTM1 (GenBank accession nr. HQ337629) is 1089
bp long and codes for a 362 aa protein, while the ORF of EcSTM2 (GenBank accession
nr. HQ337630) contains 1158 bp coding for a 385 aa protein. A partial clone reported by
Groot et al. (2005) corresponds to EcSTM1. The ORF of a KNAT1/BP-like gene,
EcKNAT1 (GenBank accession nr. HQ337627), contains 1218 bp encoding 405 aa and
matches with GenBank entry DQ133604. The ORF of EcKNAT2 (GenBank accession nr.
96
HQ337628) consists of 1068 bp coding for 355 aa, and matches a partial sequence
deposited in GenBank DQ012434.
Figure 16. Domain structure of the hypothetical proteins encoded by the four class I
KNOX genes in Eschscholzia californica. Domains are shown in darker shading and
defined according to Kimura et al., (2008), the amino acid positions of the domains are
indicated above.
Bayesian phylogenetic analyses of angiosperm KNOX I genes revealed four
distinct gene clades (Figure 17). When rooted with class II KNOX genes, three clades
received highest branch support. STM-like genes were sister to KNAT1/BP-like genes,
which together were sister to KNAT2/6-like genes. The forth group of class I genes,
OSH6-like, formed a basal grade within class I genes, with monocot members more basal
than eudicot genes (suppl. Figure 26). Analyses without class II KNOX genes recovered
all four groups, including OSH6-like, as monophyletic clades with high support (Figure
2). Further, all four clades contained species from monocots, basal eudicots, rosids, and
asterids. 20 sequences from seven Papaveraceae species were found in all four clades,
97
however, an OSH6-like gene is missing from Eschscholzia. A Bayesian analysis using
amino acid sequences of all available 20 Papaveraceae sequences and from Solanum
lycopersicon, Arabidopsis thaliana, and Aquilegia formosa × pubescens confirmed the
gene clade affiliations of Eschscholzia and other Papaveraceae genes (suppl. Figure 27).
All analyses revealed the existence of two distinct STM clades that contained only
Papavearaceae genes. The STM2 clade contained EcSTM2 and sequences from
chelidonoid poppies (Sanguinaria canadensis, Stylophorum diphyllum) and from
papaveroid poppies (Argemone mexicana, Papaver bracteatum). The STM1 clade
contained EcSTM1 and likewise sequences from chelidonioids (Sanguinaria canadensis,
Glaucium flavum) and a papaveroid species (Argemone mexicana).
98
Figure 17. Phylogram of angiosperm KNOX I genes. Consensus tree of Bayesian
analysis of 53 genes from 22 genera, rooted with OSH6+KNAT2/6. The four gene clades
are indicated. Genes are identified by accession numbers or gene names (see suppl. Table
3). Monocot genes are indicated in blue, poppies and Aquilegia in orange, rosids in green,
and asterids in purple. Eschscholzia genes isolated in this study are marked in bold.
Branch support (posterior probabilities) of branch nodes over 80% are indicated. Poppyspecific duplicated STM clades are marked with orange circles.
Class 1 KNOX genes are differentially expressed during Eschscholzia shoot development
To analyze the expression patterns of Eschscholzia KNOX I genes, RNA
accumulation was visualized using RT-PCR (Figure 18). The two STM paralogs EcSTM1
and EcSTM2 were weakly expressed in vegetative shoot tips and developing leaves, and
were sharply upregulated upon floral transition and in early flower buds. Expression was
lower in older flower buds. EcSTM1 showed a second peak in 4-5 mm flower buds that
may coincide with ovule development (Becker et al. 2005). In all analyzed tissues, the
99
expression observed for EcSTM1 was stronger than that of EcSTM2. In contrast to the
two STM-like genes, EcKNAT1 and EcKNAT2 exhibited strong expression during
vegetative development, in shoot tips and developing leaves. Both genes were also
expressed in developing flower buds, but at lower levels. Expression of EcKNAT2
increased in older flower buds, and was also detected in cotyledons. Taken together, all
four Eschscholzia class 1 KNOX genes were expressed in both vegetative and
reproductive stages, but STM-like genes were expressed at higher levels in floral tissues,
whereas EcKNAT1 and EcKNAT2 were stronger in vegetative apices including
developing leaves.
Figure 18. Expression profiles of Eschscholzia californica class I KNOX genes using
semi-quantitative RT-PCR. The four genes are expressed in both vegetative and floral
tissues, STM-like genes are expressed at higher levels in early floral meristems. SAM
early: less than 5 leaves per rosette, SAM late: more than 8 leaves per rosette, byl blade of
young leaves, fb floral bud, FM floral meristem, cot cotyledon, LM length marker, nc
negative control, SAM shoot apical meristem, yl young leaf. EcActin2 was used for
normalization. PCR cycle numbers and gene fragment lengths are indicated.
100
Downregulation of EcSTMs affects gynoecium formation
VIGS-mediated silencing of both Eschscholzia EcSTM genes resulted in various
flower and shoot phenotypes. Semi-quantitative RT-PCR confirmed effective silencing in
a proportion of the treated plants, consistent with the proportion of plants showing
phenotypes (suppl. Figure 28). Silencing of EcSTM1 and EcSTM2 was not fully specific
as intended by the respective single gene construct, suggesting some extent of crosssilencing between the two duplicated genes. EcSTM-VIGS flowers were severely
impaired in gynoecium initiation or development, whereas empty vector-treated plants
were normal (Figure 19). Longitudinal sections of untreated and pTRV2-E flowers
exhibited the wild-type morphology with a central, bicarpellate gynoecium inserted at the
bottom of the receptacle cup (Figure 19A,C). Four petals and numerous stamens are
inserted at the top of the floral cup that extends outwards into a floral rim, and the hoodlike calyx dehisces at anthesis. Viewed from above, the four filamentous yellow stigma
rays extend from the floral cup, surrounded by many broader stamens (Figure 19B,D). In
EcSTM1-silenced flowers, perianth and floral cup formed as in untreated plants, but the
floral cup did not contain a gynoecium (Figure 19E,F). Scanning electron microscopy of
developing EcSTM1-VIGS flowers revealed that carpel initiation at stage 5 of
Eschscholzia flower development (Becker et al. 2005; Figure 20A) did not occur (Figure
20B). The central region of the floral meristem which in wild-type plants is consumed in
the process of gynoecium initiation remains flat in EcSTM1-VIGS treated plants (Figure
20C). Observations of stained longitudinal sections through equivalent stages confirmed
the lack of initiation of a gynoecium in EcSTM1-VIGS flowers (Figure 20E) in about
101
71% (n=14), as compared to untreated floral buds that had carpels initiated (Figure 5D).
Scored at anthesis, about 52% of all developed EcSTM1-VIGS flowers lacked a
gynoecium (Figure 21A). Two pTRV2 constructs containing a 387 bp fragment (pTRV2EcSTM1b) respectively the entire coding sequence (pTRV2-EcSTM1c) resulted in similar
frequencies. (Figure 21A). Post-anthesis, an empty floral cup and rim persist after petals
and stamens have abscised (inset in Figure 19E).
Figure 19. Floral phenotypes of EcSTM1, EcSTM2, and EcSTM1+2 silenced
Eschscholzia californica plants. Longitudinally bisected and central views of flowers at
anthesis are shown, the calyx has fallen off. Untreated (A,B) and pTRV2-E empty vector
controls (C,D) flowers show wild-type morphology. The ovary arises from the bottom of
the floral cup, and four stigmatic rays extend beyond the floral cup (A,C) and are seen
from above among numerous stamens (B,D). E,F pTRV2-EcSTM1b flowers had an
empty floral cup lacking a gynoecium. Inset in (E) shows the empty cup of a postanthesis flower. (G,H) pTRV2-EcSTM2f flowers had a rudimentary gynoecium that
sometimes extended beyond the cup post-anthesis (inset in G). A petaloid stamen is seen
in (H). Combined silencing in pTRV2-EcSTM1b/EcSTM2f plants had flowers with no or
with a rudimentary gynoecium at anthesis, and fewer stamens (I,J). Arrows in (E), (G)
and (I) point to the bottom of the floral cup. Asterisks in (B) indicate stigmatic rays.
Asterisk in (H) indicates petaloid stamen.
102
Figure 20. Scanning electron micrographs and longitudinal sections of EcSTM-VIGS
floral buds. A,D untreated Eschscholzia californica. B,C,E pTRV2-EcSTM1b treated.
The center of the floral meristem lacks initiation of carpels and remains flat (red arrow in
(E)). (C) is a magnified view of the floral meristem center shown in (B). F pTRV2EcSTM2f treated. The center of the floral bud comprises a rudimental structure (red
arrow). g gynoecium, p petal, s stamen, se sepals, le leaf. In (A) and (B), stamen
primordia of consecutive androecial whorls are marked with numbers. Scale bars are
100µm.
103
Figure 21. Reduced gynoecium and flowers in EcSTM-silenced Eschscholzia plants.
(A) About 52% of EcSTM1 silenced flowers (light grey columns) had no gynoecium,
while about 24% of EcSTM2-silenced flowers had an aborted or reduced
gynoecium (dark grey columns). 68% of flowers co-silenced with EcSTM1 and
EcSTM2 (black column) lacked or had a reduced gynoecium. (B) Reduced
flowers consisting only of a calyx were found in 5.6% of flowers silenced in
EcSTM2. This phenotype was rare in EcSTM1-silenced plants. Reduced flowers
in EcSTM1/2-co-silenced plants occurred at 3.3%.
(B) Reduced flowers consisting only of a calyx were found in 5.6% of flowers
silenced in EcSTM2. This phenotype was rare in EcSTM1-silenced plants.
Reduced flowers in EcSTM1/2-co-silenced plants occurred at 3.3%.
104
Figure 22. Stamen numbers in EcSTM-silenced Eschscholzia flowers. Compared to
untreated plants and plants inoculated with the empty vector pTRV2-E (white columns),
silencing of all STM constructs resulted in reduced stamen numbers. Silencing of
EcSTM2 with the pTRV2-EcSTM2f construct (dark grey column) had a stronger effect
than two EcSTM1-containing constructs (light grey columns). In plants inoculated with
pTRV2-EcSTM1b, flowers without gynoecium (- gyn) had fewer stamens than those with
gynoecium (+ gyn). Standard deviation and sample numbers are shown.
Silencing of EcSTM2 had effects that were overlapping but distinguishable from
EcSTM1. At anthesis, many EcSTM2-VIGS treated flowers appeared to lack a gynoecium
like plants treated with EcSTM1-VIGS. However, closer examination often revealed a
rudimentary gynoecium at the bottom of the floral cup (Figure 19G) at a frequency of
about 24% (Figure 21A). At stage 12 of flower development when petals and stamens
abscise (Becker et al. 2005), about 39% of EcSTM2-VIGS flowers (n=90) had strongly
reduced capsule sizes, shorter than 7mm in length. Stage 5 flower primordia showed a
105
rudimentary gynoecium structure in about 59% of longitudinally sectioned specimens
(Figure 20F; n=17). Taken together, gynoecium development in EcSTM2-VIGS flowers
was arrested at an early stage, or showed a delayed development that resulted in shorter
and mostly infertile capsules (inset in Figure 19G).
Combined silencing of EcSTM1 and EcSTM2 resulted in flowers with aborted or
arrested gynoecia at higher frequencies (68%), likely reflecting a combinatorial effect
(Figure 20A). Silencing of EcKNAT1 had no effect on gynoecium development, and
flowers appeared normal (data not shown).
EcSTM silencing results in reduced stamen numbers
The androecium in Eschscholzia californica consists of variable numbers of
hexamerous whorls, except the first whorl that has only four stamens (Karrer 1991;
Becker et al. 2005). Untreated and control plants inoculated with pTRV2-E had an
average of 27 and 28 stamens, respectively (Figure 21), corresponding to five stamen
whorls, but ranged between four to six whorls (suppl. Figure 29). Silencing of both
EcSTM genes individually resulted in reduced stamen numbers, but silencing with the
pTRV2-EcSTM2f construct had a stronger effect than with either of the two EcSTM1
specific constructs (Figure 22, suppl. Figure 29). pTRV2-EcSTM2f-mediated silencing
resulted in an average of only twelve stamens, and a range of zero to four whorls.
Silencing with pTRV2-EcSTM1b resulted in an average of about 21 stamens, or four
whorls, and a range of two to six whorls. When EcSTM1b-silenced flowers with and
without gynoecium were analysed separately, the latter had fewer stamens (18), which
106
may reflect a stronger silencing effect when compared to flowers with a gynoecium
(average of 24 stamens). Co-silencing of both EcSTM genes using pTRV2EcSTM1b/EcSTM2f were similar in effect to EcSTM2-VIGS flowers (Figure 22, suppl.
Figure 29).
Some EcSTM-VIGS flowers show reduction of perianth organs and development of floral
shoots
About 5.6% of EcSTM2-VIGS flowers and 3.3% of double-silenced flowers
lacked petals and stamens in addition to an arrested gynoecium (Figure 21B, 23D). Often,
the calyx of these flowers assumed largely leaf identity, forming dissected organs above
the floral rim (Figure 23E-H). Reduction in calyx identity was accompanied by a
reduction of the floral rim (Figure 23H) and the pedicel. Some of these flowers formed
additional leafy organs inside the leafy calyx (Figure 23F-G), and the floral meristem
occasionally could be seen differentiated into a tiny pin (Figure 23G). This phenotype
was rarely observed in EcSTM1-VIGS flowers (Figure 21B).
Premature termination of the floral meristem was sometimes followed by the
formation of a replacement shoot that emerged from within the floral rim and calyx
(Figure 23I). These replacement shoots appeared as the continuation of the main axis and
developed another pseudowhorl and terminal flower (Figure 23J-K). If sepal or rim
identity was not obvious, as in Figure 23L, replacement shoots following early floral
meristem termination were difficult to detect.
107
Figure 23. Spectrum of floral organ initiation defects in EcSTM-VIGS flowers. A,
untreated wild-type flower. B, flower lacks gynoecium. C, flower lacks all fertile organs.
D, flower bud consisting of a narrowed calyx only. E-H, flowers in which sepals have
largely assumed leaf identity and form as separate organs with various degrees of
dissection. A reduced floral rim is present in E-G, but is missing in H. In F and G,
additional leafy organs have formed inside the leafy calyx. In G, a pin-like structure has
formed (arrowhead). I, a leafy shoot has formed, two sepal-like organs are seen to the
left. J, shoot formation from a sepal-bearing flower, sepal is to the right. K, same shoot
after ten days, the shoot has formed two basal leaves, a pseudowhorl of two leaves with
one axillary shoot, and a terminal flower. L, magnification of K, showing two floral rims
carrying a sepal-like organ each, and the base of the floral shoot. Arrows point to the
position of the floral rim at the end of the pedicel.
EcSTM silencing can cause homeotic conversions in floral organs
Silencing of both EcSTM genes, singly and combined, led to changes in floral
organ identity in a few flowers. Homeotic conversions of stamens into petals were mostly
observed in flowers that lacked a gynoecium (Figure 24A). Occasionally, petals extended
to the center of the flower (Figure 24C). Sometimes, mosaic sepal/leaf organs formed
108
(Figure 24B, D-F). Sepal sectors with leaf identity were associated with an interruption of
the floral rim (Figure 24E, F), and the calyx failed to abscise at anthesis (Figure 24A, B).
Figure 24. Homeotic organ transformations in EcSTM-VIGS plants. A,B the same flower
from above and below showing petaloid stamens and leafy persistent sepals. C petaloid
organs occupy the center of the flower. D-F floral buds with leafy calyxes. Interruption of
the floral rim is indicated with arrows.
Elongation of stem internodes and the degree of leaf dissection are affected in EcSTMVIGS plants
Examination of internodes between stem leaves revealed that EcSTM-silenced
plants frequently formed multiple clusters of leaves separated by longer internodes along
the stem. In contrast, wild type plants have single leaves separated by internodes, and a
single cluster of two or three leaves, called the pseudowhorl, preceding flowers (Becker
et al. 2005; Figure 25). In addition, some EcSTM-VIGS stems exhibited irregular
phyllotaxy and fusion of adjacent leaves (data not shown). Finally, overall leaf dissection
at higher nodes appeared to be reduced in pTRV2-EcSTM1b stem leaves, albeit
109
variability of this trait was high (suppl. Figure 30). A milder reduction in leaf segment
number was also observed in EcKNAT1-VIGS plants.
Figure 25. Additional pseudowhorls in Eschscholzia shoots. More than one pseudowhorl
was rare in control plants (pTRV2-E), but occurred between 19% in pTRV2-EcSTM2f
plants and in 45% percent in pTRV2-EcSTM1b/EcSTM2f plants. Shoots with poorly
defined pseudowhorls, or where pseudowhorls were not preceded by a single stem leaf,
were excluded.
In summary, silencing of the two EcSTM genes had overlapping but distinct
effects on the formation of fertile floral organs. In addition to the gynoecium and
androecium, silencing of EcSTM genes affected stem internode patterning, and at lower
110
frequencies caused defects in perianth formation, floral specification, and floral organ
identity.
Discussion
KNOX I gene evolution
KNOX I genes form a small family of transcription factors that have diversified
into four subclades in flowering plants. Most phylogenetic analyses have grouped STMlike genes as sister to KNAT1/BP-like (Golz et al. 2002; Guillet-Claude et al. 2004; Groot
et al. 2005; Harrison et al. 2005; Sano et al. 2005; Zluvova et al. 2006; Floyd and
Bowman 2007; Hirayama et al. 2007; Jouannic et al. 2007; Di Giacomo et al. 2008;
Tanaka et al. 2008; Alakonya et al. 2012; Box et al. 2012), while few studies suggest
KNAT1/BP- like are closer to KNAT2/6-like genes than to STM-like (Sakakibara et al.
2008; Magnani et al. 2008; Mukherjee et al. 2009). Our phylogenetic comparisons
including the four Eschscholzia KNOX I genes support that STM genes are closest to
KNAT1/BP, which in turn are sister to KNAT2/6 genes). KNAT2/6-like are either sister to
OSH6-like genes (Floyd and Bowman 2007; Jouannic et al. 2007; Hirayama et al. 2007;
Mukherjee et al. 2009; Box et al. 2012), or OSH6-like genes appear as sister to all other
KNOX I genes (Sano et al. 2005; Harrison et al. 2005; Alakonya et al. 2012). KNOX I
duplications that produced the four clades precede the divergence of monocots and
eudicots, since they contain members of both clades. However, STM-like genes are not
found in Poaceae, and no OSH6-like gene occurs in Arabidopsis. Since OSH-like genes
111
are present in two Papaveraceae species and in the Ranunculaceae Aquilegia, an OSH6like gene in Eschscholzia either remains undetected, or was lost.
The two Eschscholzia STM-like genes isolated in this study, EcSTM1 and
EcSTM2, have their respective orthologues in other Papaveraceae, but are not found
outside the family. Our phylogenetic analyses suggest a STM duplication at the base of
subfamily Papaveroideae, since both genes are found in all three clades of this subfamily,
in eschscholzioid (Eschscholzia), papaveroid (Papaver, Argemone), and chelidonioid
(Sanguinaria, Glaucium, Stylophorum) poppies. More sequences from subfamily
Fumarioideae, and from other Ranunculales families will be needed to precisely localize
the node of this duplication event.
Diversification of expression and function of Eschscholzia KNOX I genes
The two Eschscholzia STM-like genes, EcSTM1 and EcSTM2, like their single
Arabidopsis homologue, are expressed in both vegetative and reproductive meristems,
but exhibit a strong upregulation during the floral transition. Expression of EcSTM1 in
leaves and floral meristems has previously been demonstrated by RNA in situ
hybridization (Groot et al. 2005). In contrast, EcKNAT1, a KNAT1/BP homologue, and
EcKNAT2, a KNAT2/6 homologue, are more strongly expressed in vegetative shoot tips
and young leaves, suggesting a partial subfunctionalization among KNOX I genes
between vegetative and reproductive stages. In accordance with this, EcSTM silencing
phenotypes are primarily floral, while we could not detect flower defects in EcKNAT1VIGS plants (not shown).
112
EcSTM genes function in reproductive floral organ development
The spectrum of phenotypes following silencing of EcSTM1 and EcSTM2
suggests that both Eschscholzia STM genes have roles in gynoecium and androecium
development. Although single-gene VIGS resulted in some degree of cross-silencing of
the other paralogue, limiting an assessment of the degree of redundancy and/or
subfunctionalization, a comparison of single and double VIGS plants suggest some extent
of subfunctionalization. EcSTM1 silencing has a stronger effect on gynoecium initiation,
as gynoecium defects occur less frequently in EcSTM2-VIGS flowers, and lead to
arrested or delayed growth rather than complete failure of gynoecium initiation. On the
other hand, EcSTM2 silencing affects stamen numbers more frequently and more
severely, compared to EcSTM1. Co-silencing of the two paralogues results in stronger
phenotypes compared to silencing of each individual gene, indicating additive effects
and/or stronger silencing of both genes.
Meristem maintenance and floral determinacy
Reduction of the gynoecium and the androecium in EcSTM-VIGS flowers
suggests that EcSTM genes regulate meristem growth specifically during the formation of
the fertile floral organs. According to this hypothesis, premature meristem arrest
underlies the reduction of gynoecium and androecium in Eschscholzia STM-VIGS plants.
Hence, the general role of KNOX I genes in other species, and STM genes in particular, in
maintaining a pool of undifferentiated meristematic cells, is largely restricted to later
113
stages of floral organogenesis following perianth formation. This is in agreement with the
predominantly floral expression of both EcSTM genes. Our RT-PCR data show that both
genes are sharply upregulated during the transition to flowering. It is possible that
EcSTM1 primarily controls meristem maintenance necessary to provide the central
meristem territory from which the gynoecium arises, while EcSTM2 primarily operates in
the androecial ring meristem that gives rise to stamens. However, the flat center of the
floral meristem in gynoecium-less EcSTM1-VIGS flowers and the non-vacuolated,
meristematic character of its cells (Figure 20B,C,E) suggest that central cells do form but
fail to initiate a gynoecium. In situ hybridization data would be needed to correlate these
differences in function with any temporal-spatial differences of expression. Although our
data reveal differential effects of the two EcSTM genes, effects common to plants
silenced with either gene may be due to unintended cross-silencing. Stable single-gene
mutants would be necessary to fully differentiate between the functions of the two genes.
The Eschscholzia AGAMOUS (AG) genes EScaAG1 and EScaAG2 confer
determinacy in both the central floral meristem territory where carpels form, and in the
ring-like androecial meristem surrounding it (Yellina et al. 2010). Virus-mediated
silencing of EScaAG genes increases both stamen numbers arising from the ring
meristem as well as carpel numbers in the floral meristem center, an effect opposite to
EcSTM silencing that reduces organ numbers in both the gynoecium and the androecium.
In addition, the Eschscholzia CRABS CLAW gene EcCRC contributes to floral meristem
determinacy after the gynoecium is initiated but does not act on the ring meristem
generating stamen primordia (Orashakova et al. 2009). Hence, a balance of EScaAGs,
114
EcSTMs, and EcCRC expression may regulate floral determinacy during androecium and
gynoecium development, determining the correct number of fertile floral organs in
Eschscholzia. Interestingly, both stamen and carpel numbers show prominent variation in
other genera of the Papaveraceae family, suggesting these genes as part of a network that
might have been imporant in evolutionary changes of fertile floral organ number. In
contrast, the FLORICAULA/LEAFY-like gene EcFLO regulates floral determinacy
specifically during perianth development, and EcFLO-VIGS flowers produce additional
sepal and petal whorls (Wreath et al., 2013).
STM genes as floral specifiers
A number of studies in Arabidopsis suggest that STM also plays a role in flower
meristem specification and is required for floral organ formation, particularly of carpels
(Pautot et al. 2001; Endrizzi et al. 1996; Scofield et al. 2007; Yu et al. 2009; Smith et al.
2011). STM cooperates with the BELL-like homeobox genes PNY and PNF to specify
flower meristems together with the flowering gene FT (Smith et al. 2011), and STM-BEL
complexes may act as additional activators of the flower meristem identity genes LFY
and AP1 (Yu et al. 2009; Smith et al. 2011). Occasionally, EcSTM-VIGS flowers showed
homeotic conversions between floral organs, indicating a compromised floral organ
identity. Indeed, leafy sectors in the calyx of EcSTM-VIGS flowers (Figure 23A,B) are
similar to EcFUL-VIGS flowers in which an AP1/FUL-like gene is silenced (Pabon-Mora
et al., 2012), and a reiterated floral rim (Figure 23L) is reminiscent of the EcFLO-VIGS
phenotype (Wreath et al., 2013). Occasionally, EcSTM-VIGS flowers consisted only of
115
sepals or leafy sepals, suggesting that EcSTM genes contribute, most likely indirectly via
activation of floral meristem identity genes, to the specification of sepal and petal
identity, in addition to their major role in stamen and carpel formation.
EcSTM-VIGS flowers suggest that the role of STM in gynoecium initiation and
growth is conserved between basal eudicots and rosid core eudicots (Pautot et al. 2001;
Endrizzi et al. 1996; Scofield et al. 2007). The reduction of stamen number, along with
carpels, suggest that EcSTMs may have a broader role in fertile organs, compared to
Arabidopsis.
The effects on carpels seen in some EcSTM-VIGS flowers may reflect a role of
STM in floral meristem maintenance, in carpel specification and formation, or both. A
role in meristem maintenance would depend on the time point at which the meristem
ceases in EcSTM-VIGS flowers if the resulting flower is lacking only a gynoecium or,
when it ceases earlier, the flower is lacking a gynoecium and some stamen whorls. The
fact that EcSTM2-VIGS flowers do initiate a gynoecium that is subsequently arrested in
its development might suggest an additional role in gynoecium growth. In Eschscholzia,
carpel formation and differentiation also requires AG (Yellina et al. 2010), while flowers
silenced in EcFLO retain a gynoecium in the center of the flower (Wreath et al., 2013).
Pre-floral roles of EcSTMs
In core eudicots KNOX I genes are implicated in promoting leaf complexity. Our
data indicate that leaf dissection might be reduced in Eschscholzia when EcSTM1 is
116
silenced. More studies, particularly including the silencing of multiple genes are needed
to corroborate a role of KNOX I genes in leaf dissection in basal eudicots.
Arabidopsis stm shoots repeatedly initiate replacement shoots in place of an
arrested SAM (Endrizzi et al., 1996). Similar floral replacement shoots were observed in
reduced sepal-bearing EcSTM-VIGS flowers. Further, STM-deficient Arabidopsis
inflorescences exhibit irregular internode spacing, perturbed phyllotaxy, and fusion of
adjacent leaves (Endrizzi et al. 1996; Smith et al. 2011). Similar effects were also seen in
EcSTM-VIGS shoots, suggesting conserved roles in inflorescence shoot patterning
despite weaker expression of both EcSTM genes in pre-floral tissues. The occurrence of
additional pseudowhorls could, at least in part, also reflect the origin of replacement
shoots following prefloral meristem abortion. Alternatively, the shoots emerging from
EcSTM-VIGS sepals could be explained by a reversion of the floral into a vegetative
meristem.
We have characterized the role of STM-like KNOX I genes in the basal eudicot
species Eschscholzia californica, using virus-induced gene silencing. We show that two
paralogues exist that are predominantly expressed during the reproductive phase of shoot
development where they play crucial roles in the initiation and development of the fertile
inner floral organs. Our data suggest that duplication of an ancestral STM gene in the
lineage leading to Eschscholzia may have been followed by partial subfunctionalization
of their role in flower development, establishing some organ-type specificity. We could
also detect that Eschscholzia STM genes contribute to stem internode patterning, perianth
formation, flower specification, and floral organ identity. We conclude that the described
117
aspects of STM function originated in basal eudicots, or earlier, and have been maintained
in core eudicots such as Arabidopsis. Equivalent data from basal angiosperms will be
needed to further unravel the evolution of function of these crucial meristem regulators in
flowering plants.
Acknowledgements
S. Gleissberg received funding from the German Research Foundation (DFG) and
a start-up fund from Ohio University. A. Becker received follow-up funding from the
German Research Foundation (DFG). We thank N. Sinha (Davis) for providing
sequences, Andrea Scholz (Mainz) for cloning of pTRV2-EcSTM1-b, Chi Elsie Zhang
(Athens) for database work, Angelika Trambacz and Werner Vogel (Bremen) for plant
care, Friederike Koenig (Bremen) for discussions, Abdinasir Mohamud and Timothy
Pritchard (Athens) for help with phenotypic scoring, and two anonymous reviewers for
comments.
Author Contributions
S. Gleissberg designed the project and led the research with A. Becker. S. Meyer
cloned and characterized the genes with B. Townsley. Angelika Stammler contributed to
cloning, carried out RT-PCR profiling, and performed the VIGS experiments with
phenotypic scoring, data analyses, and data presentation. S. Gleissberg contributed to
data analyses and presentation. A. Plant performed the phylogenetic analyses. A.
Stammler, S. Gleissberg, and A. Becker wrote the manuscript.
118
References
Abascal F, Zardoya R, Posada D (2005) ProtTest: Selection of best-fit models of
protein evolution. Bioinformatics 21, 2104-2105.
Aida M, Ishida T, Tasaka M (1999) Shoot apical meristem and cotyledon formation
during Arabidopsis embryogenesis: interaction among the CUP-SHAPED COTYLEDON
and SHOOT MERISTEMLESS genes. Development 126:1563-1570.
Alakonya A, Kumar R,Koenig D,Kimura S, Townsley B, Runo S, Garces HM, Kang
J, Yanez A, David-Schwartz R, Machuka J, Sinha N (2012) Interspecific RNA
interference of SHOOT MERISTEMLESS-like disrupts Cuscuta pentagona plant
parasitism. Plant Cell 24, 3153-3166.
Alonso-Cantabrana H, Ripoll JJ, Ochando I, Vera A, Ferrandiz C, MartinezLaborda A (2007) Common regulatory networks in leaf and fruit patterning revealed by
mutations in the Arabidopsis ASYMMETRIC LEAVES1 gene. Development 134:26632671.
Becker A, Gleissberg S, Smyth D (2005) Floral and vegetative morphogenesis in
California poppy (Eschscholzia californica Cham.). Int J Plant Sci 166, 537-555.
119
Belles-Boix E, Hamant O, Witiak SM, Morin H, Traas J, Pautot V (2006) KNAT6: an
Arabidopsis homeobox gene involved in meristem activity and organ separation. Plant
Cell 18, 1900-1907.
Bharathan G, Goliber T, Moore C, Kessler S, Pham T, Sinha N (2002) Homologies
in leaf form inferred from KNOX1 gene expression during development. Science 296,
1858-1860.
Box MS, Dodsworth S, Rudall PJ, Bateman RM, Glover BJ (2012) Flower-specific
KNOX phenotype in the orchid Dactylorhiza fuschsii. J Exp Bot 63, 4811-4819.
Brand U, Grünewald M, Hobe M, Simon R (2002) Regulation of CLV3 expression by
two homeobox genes in Arabidopsis. Plant Physiol 129, 565-575.
Champagne C, Sinha N (2004) Compound leaves: equal to the sum of their parts?
Development 131, 4401-4412.
Chuck G, Lincoln C, Hake S (1996) KNAT1 induces lobed leaves with ectopic
meristems when overexpressed in Arabidopsis. Plant Cell 8, 1277-1289
Darriba D, Taboada GL, Doallo R, Posada D (2012) jModelTest 2: more models, new
heuristics and parallel computing. Nature Methods 9, 772
120
Di Giacomo E, Sestili F, Iannelli MA, Testone G, Mariotti D, Frugis G (2008)
Characterization of KNOX genes in Medicago truncatula. Plant Mol Biol 67, 135-150
Douglas SJ, Chuck G, Dengler RE, Pelecanda L, Riggs CD (2002) KNAT1 and
ERECTA regulate inflorescence architecture in Arabidopsis. Plant Cell 14, 547-558
Endrizzi K, Moussian B, Haecker A, Levin JZ, Laux T (1996) The SHOOT
MERISTEMLESS gene is required for maintenance of undifferentiated cells in
Arabidopsis shoot and floral meristems and acts at a different regulatory level than the
meristem genes WUSCHEL and ZWILLE. Plant J 10, 967-979
Floyd SK, Bowman JL (2007) The ancestral developmental tool kit of land plants. Int J
Plant Sci 168, 1-35.
Golz JF, Keck EJ, Hudson A (2002) Spontaneous mutations in KNOX genes give rise to
a novel floral structure in Antirrhinum. Curr Biol 12, 515-522.
Groot EP, Sinha N, Gleissberg S (2005) Expression patterns of STM-like KNOX and
Histone H4 genes in shoot development of the dissected-leaved basal eudicot plants
Chelidonium majus and Eschscholzia californica (Papaveraceae). Plant Mol Biol 58, 317331.
121
Guillet-Claude C, Isabel N, Pelgas B, Bousquet J (2004) The evolutionary implications
of knox-I gene duplications in conifers: correlated evidence from phylogeny, gene
mapping, and analysis of functional divergence. Mol Biol Evol 21, 2232-2245.
Hamant O, Pautot V (2010) Plant development: a TALE story. C R Biol 333, 371-381.
Hareven D, Gutfinger T, Parnis A, Eshed Y, Lifschitz E (1996) The making of a
compound leaf: genetic manipulation of leaf architecture in tomato. Cell 84, 735-744.
Harrison J, Möller M, Langdale J, Cronk Q, Hudson A (2005) The role of KNOX
genes in the evolution of morphological novelty in Streptocarpus. Plant Cell 17, 430-443.
Hay A, Tsiantis M (2010) KNOX genes: versatile regulators of plant development and
diversity. Development 137, 3153-3165.
Hirayama Y, Yamada T, Oya Y, Ito M, Kato M, Imaichi R (2007) Expression
patterns of class I KNOX and YABBY genes in Ruscus aculeatus (Asparagaceae) with
implications for phylloclade homology. Dev Genes Evol 217, 363-372.
Jasinski S, Piazza P, Craft J, Hay A, Woolley L, Rieu I, Phillips A, Hedden P,
Tsiantis M (2005) KNOX action in Arabidopsis is mediated by coordinate regulation of
cytokinin and gibberellin activities. Curr Biol 15, 1560-1565.
122
Jones DT, Taylor WR, Thornton JM (1992) The rapid generation of mutation data
matrices from protein sequences. Comp Appl Biosciences 8, 275-282.
Jouannic S, Collin M, Vidal B, Verdeil JL, Tregear JW (2007) A class I KNOX gene
from the palm species Elaeis guineensis (Arecaceae) is associated with meristem function
and a distinct mode of leaf dissection. New Phytol 174:551-568
Kanrar S, Onguka O, Smith HMS (2006) Arabidopsis inflorescence architecture
requires the activities of KNOX-BELL homeodomain heterodimers. Planta 224, 11631173.
Kanrar S, Bhattacharya M, Arthur B, Courtier J, Smith HMS (2008) Regulatory
networks that function to specify flower meristems require the function of homeobox
genes PENNYWISE and POUND-FOOLISH in Arabidopsis. Plant J 54, 924-937.
Karrer AB (1991) Blütenentwicklung und systematische Stellung der Papaveraceae und
Capparaceae. PhD dissertation, Universitaet Zuerich
Katoh K, Toh H (2008) Recent developments in the MAFFT multiple sequence
alignment program. Briefings Bioinformatics 9, 286-298.
123
Kerstetter RA, Laudencia-Chingcuanco D, Smith LG, Hake S (1997) Loss-offunction mutations in the maize homeobox gene, knotted1, are defective in shoot
meristem maintenance. Development 124, 3045-3054.
Lincoln C, Long J, Yamaguchi J, Serikawa K, Hake S (1994) A knotted1-like
homeobox gene in Arabidopsis is expressed in the vegetative meristem and dramatically
alters leaf morphology when overexpressed in transgenic plants. Plant Cell 6, 1859-1876.
Liu Y, Schiff M, Dinesh-Kumar SP (2002) Virus-induced gene silencing in tomato.
Plant J 31, 777-786.
Long JA, Moan EI, Medford JI, Barton MK (1996) A member of the KNOTTED
class of homeodomain proteins encoded by the SHOOTMERISTEMLESS gene of
Arabidopsis. Nature 379, 66-69.
Magnani E, Hake S (2008) KNOX lost the OX: the Arabidopsis KNATM gene defines a
novel class of KNOX transcriptional regulators missing the homeodomain. Plant Cell 20,
875-887.
Mukherjee K, Brocchieri L, Bürglin TR (2009) A comprehensive classification and
evolutionary analysis of plant homeobox genes. Mol Biol Evol 26, 2775-2794.
124
Orashakova S, Lange M, Lange S, Wege S, Becker A (2009) The CRABS CLAW
ortholog from California poppy (Eschscholzia californica, Papaveraceae), EcCRC, is
involved in floral meristem termination, gynoecium differentiation and ovule initiation.
Plant J 58, 682-693.
Pabón-Mora N, Ambrose BA, Litt A (2012) Poppy APETALA1/FRUITFULL orthologs
control flowering time, branching, perianth identity, and fruit development. Plant Physiol
158, 1685-1704.
Pautot V, Dockx J, Hamant O, Kronenberger J, Grandjean O, Jublot D, Traas J
(2001) KNAT2: evidence for a link between knotted-like genes and carpel development.
Plant Cell 13, 1719-1734
Ragni L, Belles-Boix E, Günl M, Pautot V (2008) Interaction of KNAT6 and KNAT2
with BREVIPEDICELLUS and PENNYWISE in Arabidopsis inflorescences. Plant Cell
20, 888-900.
Sakakibara K, Nishiyama T, Deguchi H, Hasebe M (2008) Class 1 KNOX genes are
not involved in shoot development in the moss Physcomitrella patens but do function in
sporophyte development. Evol Dev 10, 555-566.
125
Sano R, Juárez CM, Hass B, Sakakibara K, Ito M, Banks JA, Hasebe M (2005)
KNOX homeobox genes potentially have similar function in both diploid unicellular and
multicellular meristems, but not in haploid meristems. Evol Dev 7, 69-78.
Scofield S, Dewitte W, Murray JAH (2007) The KNOX gene SHOOT MERISTEMLESS
is required for the development of reproductive meristematic tissues in Arabidopsis. Plant
J 50, 767-781.
Shani E, Burko Y, Ben-Yaakov L, Berger Y, Amsellem Z, Goldshmidt A, Sharon E,
Ori N (2009) Stage-specific regulation of Solanum lycopersicum leaf maturation by class
1 KNOTTED1-LIKE HOMEOBOX proteins. Plant Cell 21, 3078-3092.
Smith HMS, Hake S (2003) The interaction of two homeobox genes,
BREVIPEDICELLUS and PENNYWISE, regulates internode patterning in the
Arabidopsis inflorescence. Plant Cell 15, 1717-1727.
Smith HMS, Campbell BC, Hake S (2004) Competence to respond to floral inductive
signals requires the homeobox genes PENNYWISE and POUND-FOOLISH. Curr Biol
14, 812-817.
Smith HMS, Ung N, Lal S, Courtier J (2011) Specification of reproductive meristems
requires the combined function of SHOOT MERISTEMLESS and floral integrators
126
FLOWERING LOCUS T and FD during Arabidopsis inflorescence development. J Exp
Bot 62, 583-593.
Tanaka M, Kato N, Nakayama H, Nakatani M, Takahata Y (2008) Expression of
class I knotted1-like homeobox genes in the storage roots of sweetpotato (Ipomoea
batatas). J Plant Physiol 165, 1726-1735.
Venglat SP, Dumonceaux T, Rozwadowski K, Parnell L, Babic V, Keller W,
Martienssen R, Selvaraj G, Datla R (2002) The homeobox gene BREVIPEDICELLUS
is a key regulator of inflorescence architecture in Arabidopsis. Proc Natl Acad Sci USA
99, 4730-4735.
Wege S, Scholz A, Gleissberg S, Becker A (2007) Highly efficient virus-induced gene
silencing (VIGS) in California poppy (Eschscholzia californica): an evaluation of VIGS
as a strategy to obtain functional data from non-model plants. Ann Bot 100, 641-649.
Wreath S, Bartholmes C, Hidalgo O, Scholz A, Gleissberg S (2013): Silencing of
EcFLO, a FLORICAULA/LEAFY gene of the California Poppy (Eschscholzia
californica), affects flower specification in a perigynous flower context. Int J Plant Sci
174, 139-153.
127
Yellina AL, Orashakova S, Lange S, Erdmann R, Leebens-Mack J, Becker A (2010)
Floral homeotic C function genes repress specific B function genes in the carpel whorl of
the basal eudicot California poppy (Eschscholzia californica). EvoDevo 2010: 1-13.
Yu L, Patibanda V, Smith HMS (2009) A novel role of BELL1-like homeobox genes,
PENNYWISE and POUND-FOOLISH, in floral patterning. Planta 229, 693-707.
Zluvova J, Nicolas M, Berger A, Negrutiu I, Monéger F (2006) Premature arrest of the
male flower meristem precedes sexual dimorphism in the dioecious plant Silene latifolia.
Proc Natl Acad Sci USA 103, 18854-18859.
128
Supplementary Data
Figure 26 (supplemental). Phylogram of selected angiosperm KNOX nucleotide
sequences. Consensus tree of Bayesian analysis of 62 genes from 23 genera, rooted with
class II KNOX genes. Class II KNOX genes and three class I KNOX gene clades are
indicated. OSH6-like genes form a basal grade within class I genes and are indicated by a
bracket. Genes are identified by accession numbers or gene names (see suppl. Table 3).
Monocot genes are indicated in blue, poppies and Aquilegia in orange, rosids in green,
and asterids in purple. Eschscholzia genes isolated in this study are marked in bold and
underline. Branch support values (posterior probabilities) of bifurcations over 80% are
indicated. Poppy-specific duplicated STM clades are marked with orange circles.
129
Figure 27 (supplemental). Phylogram of poppy and few selected other eudicot KNOX I
deduced amino acid sequences. Consensus tree of Bayesian analysis of 31 genes from ten
species, rooted with OSH6. The four class I KNOX protein clades are indicated.
Sequences are identified by accession numbers or gene names (see suppl. Table 3).
Monocot genes are indicated in blue, poppies and Aquilegia in orange, rosids in green,
and asterids in purple. Eschscholzia genes isolated in this study are marked in bold and
underline. Branch support values (posterior probabilities) of bifurcations over 80% are
indicated. Poppy specific duplicated STM clades are marked with orange circles.
Figure 28 (supplemental). Semi-quantitative RT-PCR of STM-like genes in floral
terminal flower buds with a diameter of less than 2 mm of VIGS-treated Eschscholzia
californica. For each of the four VIGS constructs indicated above, three samples are
shown along with two negative controls (water, RNA). EcActin2 was used as a positive
control.
130
Figure 29 (supplemental). Distribution of stamen numbers in EcSTM-silenced and
control flowers. Stamen number of control flowers (pTRV2-E; white columns) ranged
between 21 and 33, reflecting four to six stamen whorls. EcSTM1 silencing with pTRV2EcSTM1b resulted in stamen numbers between seven and 36, or two to six stamen whorls
(light gray columns). Stamen numbers in flowers silenced with pTRV2-EcSTM2f ranged
between zero and 22, corresponding to zero to four stamen whorls (dark gray columns).
Co-silencing of both EcSTM genes using pTRV2-EcSTM1b+EcSTM2f resulted in stamen
numbers between zero and 30, or zero to six stamen whorls (black columns). pTRV2-E,
n=25; pTRV2-EcSTM1b, n=161; pTRV2-EcSTM2f, n=27; pTRV2-EcSTM1b+EcSTM2f,
n=116.
131
Figure 30 (supplemental). Degree of leaf dissection in KNOX I-silenced and control
leaves. In control plants (grey bars), the total count of leaf segments increased from leaf
node 5 through 17, reflecting leaf heteroblasty. Leaves of EcSTM1-silenced plants were
less dissected at nodes 11 through 17 as compared to empty vector-treated plants.
EcKNAT1-silenced plants showed a milder reduction in leaflet segment count at the same
nodes. Leaves at nodes 5 and 8 showed no difference among treatments. Leaves at these
earlier nodes may have surpassed the organogenetic phase of leaf growth before the
effect of pTRV2-mediated silencing came into effect. Standard deviation and sample
sizes are shown for each data group.
132
Table 2 (supplemental). Primers used for amplification of KNOX genes
Name
Sequence 5' to 3'
Comments
EcKn17F
GGA GGG TCC AAG CAG TAA TTT CAT
EcSTM1
EcKn18R
CTT CTG ACA GTT GAC GTA AGA GGC C
EcSTM1
EcKn19R
GCA TTT GCT TCC TCT AAT TTA G
EcSTM1
EcKn30F
CCC GTC CGT CCC CTT AAC ATA
EcSTM2
EcKn31R
AGG TGC TGC TAC TTG TGG GTT TTG
EcSTM2
EcKn21F
TAA TGG TCC TAT CCG GGT CTT CAC AGA TG
EcKNAT1
EcKn27F
CAT CTG AAG AGG ATC AAG AAA ACA GCG CGG GCG
EcKNAT1
EcKn50F
GGA GAG ATA GAA GTT CAA GAG GTT
EcKNAT2
EcKn38R
GCC CAG TTA GTT CTT CAC GAT ATT TAA CCA ACA TAT CAT AAT AAG EcKNAT1
C
CCA CAA ACT CTT GCC TAG CCT GTG TCA ACC AA
EcKNAT1
EcKn39R
EcKn43R
GGA TGA AGA TTT GTT GTT GCA GAG ATT TGA AAG TTG CAT CTG AAT EcKNAT2
CTT
AGC TCA GGA TCA TCA CCA AGA CAA GTA GTA GAA ACA ACA GTT
EcKNAT2
Pr1-fw-18Xho1
ATC TCG AGG TCC AAG CAG TAA TTT TCA TG
EcSTM1
Pr2-rv +1058Xba1
ATT CTA GAC TTT CAA AGC ATT GGA GTG C
EcSTM1
Pr3-fw+3
GAA GTT GGT GGT AGA AGT AGT AGT AGT GA
EcSTM2
Pr4-rv+1900
AAG ACG GCT GGG TGT AGT AAT C
EcSTM2
Pr5-fw-84EcoRI
ATG AAT TCG AGA GAG AGA GTA CTT CTG G
EcKNAT1
Pr6-rv+1817XbaI
ATT CTA GAA TGA GTC AAG GCC CCA AAC G
EcKNAT1
Pr7-fw-6 XhoI
ATC TCG AGC AAT CAT CAA TGG AGG ATC TC
EcKNAT2
Pr8-rv+1136XbaI
ATT CTA GAG GGA CAT TCA GTT TTC GG
EcKNAT2
Pr15fw-XbaI
TCT AGA AGT TCA TGG AAG CTT ACT GTG AGA TGC
pTRV2-EcSTM1b
Pr16-rev-SacI
GAG CTC TCT TTT GCG ATT CCG AGG
pTRV2-EcSTM1b
Pr18-fw-BamHI
GAA TAG GAT CCG TCC AAG CAG TAA TTT TCA
pTRV2-EcSTM1c
Pr19rev-SacI
GCA TGA GCT CCT TTG AAA GCA TTG GAG TG
pTRV2-EcSTM1c
Pr22fw
CCT GAC ACT CCT CTT ACT AAT TCT C
pTRV2-EcSTM2f
AB05
GAC TCG AGT CGA CAT CTG TTT TTT TTT TTT TTT TT
AB07
GAC TCG AGT CGA CAT CTG
RACE Oligo(dT)
anchor primer
RACE anchor primer
AD2-2
AGW GNA GWA NCA WAG G
TAIL-PCR
AD5
STT GNT AST NCT NTG C
TAIL-PCR
AD3
WGT GNA GWA NCA NAG A
TAIL-PCR
AD2-1
NGT CGA SWG ANA WGA A
TAIL-PCR
AD1-2
NTC GAS TWT SGW GTT
TAIL-PCR
EcKn42R
133
Table 3 (supplemental). Sequence IDs for KNOX genes used in phylogenetic analyses
Species and Gene Name
Antirrhinum majus HIRZINA
Antirrhinum majus INVAGINATA
Sequence ID
AY072736
AY072735
Taxonomy
Core eudicots-asterids
Core eudicots-asterids
Arabidopsis thaliana KNAT1
Arabidopsis thaliana KNAT2
AY113982
X81353
Core eudicots-rosids
Core eudicots-rosids
Arabidopsis thaliana KNAT3
Arabidopsis thaliana KNAT4
X92392
X92393
Core eudicots-rosids
Core eudicots-rosids
Arabidopsis thaliana KNAT5
Arabidopsis thaliana KNAT6
AF306661
AB072362
Core eudicots-rosids
Core eudicots-rosids
Argemone mexicana KNAT1
Argemone mexicana STM1
Argemone mexicana STM2
AMEST1PF_c6638
AMEST1PF_rep_c1005
AMEST1PF_rep_c2762
Papaveroideae-Papavereae
Papaveroideae-Papavereae
Papaveroideae-Papavereae
Corydalis cheilanthifolia KNAT1
Glaucium flavum KNAT1
CCHRT1PF_c4675
GFLRT1PF_c4306
Fumarioideae-Fumarieae
Papaveroideae-Chelidonieae
Glaucium flavum STM1
GFLRT1PF_rep_c387
Papaveroideae-Chelidonieae
Glaucium flavum OSH6
Papaver bracteatum KNAT1
GFLRT1PF_rep_c3987
PBRST1PF_rep_c1541
Papaveroideae-Chelidonieae
Papaveroideae-Papavereae
Papaver bracteatum STM2
Pisum sativum PsKn1
Ruscus aculeatus RaSTM
Sanguinaria canadensis KNAT2/6
Sanguinaria canadensis STM1
Sanguinaria canadensis KNAT1
Sanguinaria canadensis STM2
PBRST1PF_rep_c5140
AF080104
AB300055
SCARH1PF_c4348
SCARH1PF_rep_c1395
SCARH1PF_rep_c2366
SCARH1PF_rep_c2559
Papaveroideae-Papavereae
Core eudicots-rosids
Monocots
Papaveroideae-Chelidonieae
Papaveroideae-Chelidonieae
Papaveroideae-Chelidonieae
Papaveroideae-Chelidonieae
Solanum lycopersicon LeT6
Solanum lycopersicon LeTKn1
AF000141
U32247
Core eudicots-asterids
Core eudicots-asterids
Stylophorum diphyllum KNAT1
Stylophorum diphyllum STM2
SDIST1PF_c10469
SDIST1PF_c15323
Papaveroideae-Chelidonieae
Papaveroideae-Chelidonieae
Stylophorum diphyllum OSH6
SDIST1PF_rep_c6976
Papaveroideae-Chelidonieae
134
CHAPTER 5: LASER MICRODISSECTION OF ESCHSCHOLZIA CALIFORNICA
LEAF PRIMORDIA FOR COMPARISON OF GENE EXPRESSION BETWEEN
DEVELOPMENTAL STAGES
Abstract
While the development of specific structures and tissues in multicellular organisms
requires the expression of specific subsets of genes, organs at different stages of
development are likely to differ substantially in the expression of those genes. Proper
characterization of a developing tissue in terms of its metabolic, gene expression or
proteomic profile necessitates the exclusion of its neighbors when isolating the tissue
from the organism to exclude contamination from the other tissues and ensure confidence
in the data obtained downstream. Laser microdissection (LMD) enables the isolation of
specific regions of tissue from slide-mounted sections with sufficient discriminatory
power to isolate structures as small as the shoot apical meristem. We demonstrate the
feasibility of isolating leaf primordia at different stages of development, of isolating RNA
from that tissue, and of subsequent comparison of expression of a developmental gene,
Eschscholzia californica CINCINNATA, between those extracts by quantitative
polymerase chain reaction.
Introduction
Discrimination between tissues and organs allows profiling of messenger RNA
transcripts, translated proteins, small interfering RNAs (siRNA) and micro RNAs
(miRNA), and metabolism, genetic sequencing to detect abnormalities, and other tissue-
135
specific factors. Isolation of tissues or structures from their neighbors that are similar or
overlapping with regard to the characteristics of interest is a necessity to ensure the
specificity and validity of the data eventually obtained.
Laser microdissection (LMD) enables the selection of small quantities of tissue or
even single cells in a specific manner. Frozen or paraffin-embedded tissues may be
sectioned with a cryostat or microtome, respectively, and those sections mounted on a
slide-mounted membrane. In the case of paraffin-embedded tissues, the sections are
deparaffinized with an appropriate solvent, retaining the tissue. The slides are viewed
tissue side down using a laser capture microscope, which integrates a computer
numerically controlled (CNC) laser offset from the eyepiece. Power, offset and cutting
path are specified by the user, and the membrane is cut, releasing the membrane and
adherent tissue from within the specified region. The tissue falls directly into a collection
tube. This contrasts with laser capture, where the desired tissues are retained on a
membrane and maintain their relative positions (Nelson et al., 2006). The tube may
contain the first reagent (e.g. lysis buffer) required for extraction of materials of interest,
depending upon the protocol. Multiple membrane fragments may be collected into a
single tube, and the design of the microscope in use may permit harvesting of tissue into
several tubes, selectable via the associated computer software. Once isolated, the range of
techniques applicable to the material includes but is not limited to: sequencing of
nucleotide polymorphisms to identify tissue- or cell-specific mutations; RNA-seq
(Schmid et al., 2012) or RNA extraction for quantitative PCR and microarray analysis
(Wang et al., 2006) to characterize transcription in the tissue; isolation of tissue-specific
136
proteins (Cadron et al., 2009); isolation of tissue-specific components or metabolites
(Korekane et al., 2007).
The advantages of the technique extend beyond target specificity. The use of
computational tools during the cutting process allows for the calculation of areas and
volumes cut, the measurement of anatomical features, and the capacity to harvest
multiple tissue types from a single section. Sections can be photographed and annotated
directly so as to accurately record the source of starting materials. There are, however,
disadvantages. Accumulation of sufficient quantities of tissue depends upon the amount
of tissue available, which may be constrained by the area of the tissue and the maximum
thickness of tissue that can be cut with the laser (although multiple passes are possible),
and choice of tissue thickness is a compromise between yield and transparency for ease
of identification. Preservation method, either cryogenic or embedding, favors the
protection of either RNA integrity or tissue morphology. The number of tissue sections
that must be sampled to obtain useable RNA, for example, may number in the hundreds
for small structures such as leaf primordia, and downstream enrichment or amplification
of desired extracts may be necessary.
LMD is a versatile technique, though, and may be the best or only means to
isolate certain structures and tissues. In development, data describing spatial and
temporal changes in gene expression between stages of organ development or
successively produced organs have become accessible via techniques such as quantitative
PCR, microarray profiling, and RNA-seq, provided that the appropriate tissues are
available. LMD allows the user to study the genetic or metabolic profiles of specific
137
tissues or cells, making it a useful technique in the study of plant lateral organs (Nelson et
al., 2006), wherein manual excision and dissection of those organs in order to isolate
particular parts or stages may be impossible due to the limits of manual dexterity or
inevitable trauma to the tissue, or where separation of one tissue from its neighbor, the
inclusion of which may distort data or contaminate extracts, is essential.
Evolutionary-developmental biology seeks in part to establish how changes in
development produce novel morphologies, thus by comparing developmental patterns
and the gene expression that underlies them between different lineages, the processes by
which different forms have emerged or diverged can be revealed. We sought to test LMD
as a means by which to isolate RNA from the leaf primordia of a compound-leafed plant,
Eschscholzia californica, in order to compare gene expression profiles between
organogenetic and differentiating tissues. We hypothesized that tissue from primordia in
the organogenetic stage would show enhanced expression of class I KNOX genes that
promote the production of leaflets in other species. In contrast, we expected that
maturation-promoting genes, such as the TCP (TEOSINE BRANCHED 1, CINCINNATA,
and PROLIFERATING CELL FACTORs 1 and 2) family transcription factor
CINCINNATA, would be increased in abundance in older tissue that is undergoing
differentiation and maturation. Two temporal stages were isolated by LMD and it was
found that several genes could be amplified by quantitative PCR. The choice of fixative,
sample size, extract quality and RNA yield is discussed, and LMD is appraised for its
value in comparative development studies.
138
Method
Tissue harvesting, embedding, sectioning, and mounting
Eschscholzia californica seeds were sown in trays with 48 x n cm2 wells in a
standard potting soil with good drainage and covered with clear lids. After sowing, the
seeds were stratified in darkness at 4°C for three days before transfer to constant light at
22°C in growth chambers. Shoot tips were harvested from plants with 1 – 2 fully
expanded leaves and immediately fixed in 3:1 ethanol : acetic acid. Kerk et al. (2003)
found that this fixative produces higher RNA yields than Prefer (glyoxal) or
formaldehyde-acetic acid-ethanol fixatives. Vacuum treatment was used to remove air
from the samples to ensure good fixation, after which the tissue was shaken at low speed
overnight at 4°C.
Fixed tissue was successively transferred through 70% ethanol, 1 : 1 ethanol :
Histoclear, 100% Histoclear and fresh 100% Histoclear at one hour intervals. A small
quantity of paraffin embedding wax pellets (Tissue-Tek) were added to the beaker that
contained the samples that was then incubated at 55°C for seven days. Histoclear was
drained from the top of the beaker and replaced with paraffin pellets twice per day until
all of the Histoclear was replaced by paraffin. The shoot tips were then arranged
longitudinally in base molds and embedded with fresh, molten paraffin wax. The paraffin
blocks were allowed to solidify overnight at 4°C before trimming and sectioning into
10µm sections with a rotary microtome, section thickness chosen on the basis of RNA
yield comparisons by Kerk et al. (2003). Around 15 shoot tips were sectioned. Ribbons
of sections were trimmed with a razor blade on an RNase-free surface, floated on DEPC-
139
treated distilled water in a 40°C water bath to allow the sections to expand, and then
mounted temporarily on glass microscopy slides for examination and selection of useful
sections at low magnification under a dissection microscope. Ribbons containing
sections of interest were refloated in the water bath and transferred to the membranes of
PEN membrane slides (Leica), selected to give the largest available membrane area per
slide, thus ten ribbons containing approximately six sections each were arranged on five
PEN membrane slides. The slides were then left on a sterilized, 37°C heat block for
approximately 36 hours to ensure attachment of the sections to the membrane before a
period of cold storage (4°C) for several days prior microdissection.
Laser microdissection
Laser microdissection was performed using an LM6000 (Leica). Leaf primordia
were selected by size from point of attachment to tip as being within the organogenetic
phase (<750µm) or the post-organogenetic phase (>750µm) based on the analysis of
dissected leaf development in Eschscholzia californica (Gleissberg, 2004). Measurements
were made using the inbuilt measurement tool in the LM software suite. Test cuts on
shoot tissue were made in order to determine the necessary laser intensity; the default
power used was the lowest necessary, to prevent damage to the tissue. Laser offset was
minimized to ensure that the marked cutting path was followed as closely as possible.
140
RNA extraction and reverse transcription
Tissue was harvested from approximately 300 sections and pooled into two tubes,
one per developmental stage. Each tube contained 40µl of buffer 1 from an Arcturus
Paradise Plus RNA Extraction and Isolation Kit suitable for paraffin-embedded tissue,
and RNA isolation commenced immediately after all sections were harvested.
Isolated RNA was assessed for concentration using a Nanodrop ND-1000 and for
quality on a Bioanalyzer Nano chip. Two micrograms of RNA per sample was reverse
transcribed into cDNA at 37°C using MMLV-reverse transcriptase (Promega) and
random hexamer primers in a 1:1 ratio to RNA (Promega). The cDNA was diluted 1/10
with nuclease-free water.
Quantitative PCR
cDNA extracted from organogenetic and differentiating-stage leaf primordia was
used as a template for quantitative polymerase chain reaction (QPCR) for the genes
ACTIN-2, Eschscholzia californica CINCINNATA (EcCIN), and Eschscholzia californica
TCP2-LIKE, (EcTCP2-LIKE). ACTIN-2 was amplified with the primers ACTIN2-Fwd
(TTACAATGAGCTTCGTGTTGC) and ACTIN2-Rev
(TCCAGCACAATACCTGTAGTA); EcCIN was amplified with EcCIN21F
(TTCAAGACTTGGGGTAGTAAGAGG) and EcCIN22R
(AACAGTAGATGCAGTTGGTCTCC); EcTCP2-LIKE was amplified with EcTCP26F (AAGGAAAAACCCGAAGAACC) and EcTCP2-7R
(TTGAGCTTGAACCGAAAAGC).
141
Each reaction (cDNA sample and appropriate primer pair) was performed in triplicate,
alongside negative controls (nuclease-free water) and RNA (to confirm the absence of
DNA contamination). The quantitative PCR annealing temperature was 55°C (elongation
time one minute)
Results
Laser microdissection and RNA quality assessment
Morphogenetic and maturing leaf primordia were harvested from approximately
300 separate sections of shoot apical tissue (Figure 31) taken from 15 plants, tissue from
each stage being pooled. RNA was isolated from the dissected tissue. Quality
assessment using a Bioanalyzer returned the following data: morphogenetic primordia
yielded 3.54µg of total RNA with an RNA Integrity Number (RIN) of 2.2; maturing leaf
primordia yielded 2.44µg of total RNA, RIN = 2.2.
142
Figure 31. Laser microdissection enables profiling of gene expression at different stages
of leaf development. Morphogenetic primordia (<750μm, top row) were measured and
excised separately from maturing primordia (>750μm, bottom row) and from the shoot
apical meristem. Tissues for each stage were pooled for RNA extraction using an
Arcturus Paradise kit. Randomly primed reverse transcription has yielded cDNA for
quantitative PCR comparison of development-associated candidate gene expression.
Quantitative PCR
The isolated RNA was reverse transcribed into cDNA for comparison of gene
expression between the two tissue types by quantitative PCR. Amplification was
achieved for ACTIN-2 and EcTCP2-LIKE (Figure 2; Ct ACTIN-2 = 22.51 and 22.27; Ct
143
EcTCP2-LIKE = 23.33 and 22.20 for morphogenetic and maturing primordia
respectively), however, amplification of EcCIN failed for both samples. Successful
amplification of EcCIN with the same primers in parallel experiments suggests that either
low levels of expression or that fragmentation of the RNA for that gene prevented
amplification from these cDNAs. For those genes that could be amplified, no significant
difference was seen between the samples.
Discussion
Laser microdissection allowed easy dissection of physically close structures
attached to the Eschscholzia shoot tip with minimal loss of or damage to tissue of interest
(figure 1), allowing assessment of gene expression at different stages of leaf
development. A constitutively expressed gene (ACTIN-2) and a gene with a specific role
in leaf development (EcTCP2-LIKE) were successfully amplified and their levels of
expression between two developmental stages of leaf primordia were compared by
quantitative PCR.
Selection of tissues by size was facilitated by the microscope software, and direct
export of images from the software has promise for downstream analysis of, for example,
quantification of expression for a given number of cells, by acquiring data such as cell
numbers with applications such as ImageJ, or by using built-in features, e.g. recording the
area of tissue excised. Such features provide superior accuracy to measurements of the
mass of manually excised tissue as they can be used to estimate cell numbers and sizes
that may improve between-tissue normalization techniques.
144
The three-dimensional nature of the structures being dissected necessitates some
prior knowledge for dissection to be accurate, either from manual dissection of the tissue
or a short period of training. The machinery can be operated and tissue selected with
relative ease, however, the operating time required is long (approximately six hours to
isolate the morphogenetic and maturing primordia from 300 10µm sections) due to the
speed of the laser and the time required to select the cutting path. During this time the
tissue on the slide remains at room temperature, a concern for RNA stability.
The methods of fixation and embedding proved more than satisfactory
morphological preservation, leaving the tissue in better condition than that normally
obtained by the authors from paraformaldehyde fixation for in situ hybridization (ethanol
: acetic acid fixation is unsuitable for in situ hybridization (Kerk et al., 2003).
Histological staining was found to be unnecessary, although it is possible to include
staining with the method described. The prolonged, harsh conditions of the fixation and
embedding processes evidently had a substantial impact upon RNA quality, however, and
therefore alternate methods are recommended for the highest yields. Research groups
frequently use cryogenic preservation as an alternative to high temperature paraffin
infiltration and embedding, despite the necessary compromise of morphological
preservation, however, Inada and Wildermuth (2005) detail a method for microwave
paraffin embedding that reduces the length of the paraffin embedding process and
increases the quality of the RNA obtained while better preserving tissue structure.
Another likely source of damage to RNA is the use of the laser. Inevitably,
densely packed tissues are susceptible to heat damage, even when cutting between them.
145
Reduction of laser intensity to a minimum for accurate cutting and reduction of heating
likely improves the quality of the RNA obtained. The intensity necessary is related to the
thickness of the tissue, which in turn corresponds to both the amount of RNA available
per section and to the surface area: volume ratio of the material and thus the possible
exposure of the RNA to external RNases. Thinner sections are, however, less likely to
require multiple cuts. The authors recommend experimentation with a series of tissue
thicknesses.
Although QPCR amplification was successful for several genes, the low quantity
of RNA isolated, i.e. the small number of transcripts, and the low RNA quality (RIN= 2.2
for both tissues) likely impacted the expression data obtained and possibly prevented
detection of a gene (EcCIN) that was expected to be detected in at least one sample.
Improvement of RNA preservation, linear amplification of isolated RNA (Rudnicki et al.,
2004), and/or preferential enrichment of rare transcripts at the reverse transcription stage
with duplex-specific nucleases (Yi et al., 2011) would likely be necessary for broad-scale
comparison of gene expression between tissues, e.g. by microarray analysis or RNA-seq.
In the opinion of the author, the specificity of the technique and its ease of employment
justify the development of improved protocols that add these processes.
In conclusion, while there are unavoidable compromises to the process of laser
microdissection, the ease of isolating small, densely packed structures from the shoot
apex is undeniable, and optimization of fixation and embedding techniques in a tissuespecific manner will make this a formidable technique in plant evo-devo research.
146
Acknowledgements
We would like to thank Vijay Nadella for instruction in using the laser
microscope and in experimental design, and Ahmed Faik and Loren Honaas for
discussion of the laser microdissection process. Work was funded in part by an OURC
grant to SG.
References
Cadron I., Van Gorp T., Amant F., Vergote I., Moerman P., Waelkens E., Daemen
A., Van De Plas R., De Moor B., and Zeillinger R. (2009). The use of laser
microdissection and SELDI-TOF MS in ovarian cancer tissue to identify protein profiles.
Anticancer Res. 29, 1039-1046.
Gleissberg S. (2004). Comparative analysis of leaf shape development in Eschscholzia
californica and other Papaveraceae-Eschscholzioideae. Am. J. Bot. 91, 306-312.
Inada N. and Wildermuth M.C. (2005). Novel tissue preparation method and cellspecific marker for laser microdissection of Arabidopsis mature leaf. Planta 221, 9-16.
Kerk N.M., Ceserani T., Tausta S.L., Sussex I.M., and Nelson T.M. (2003). Laser
Capture Microdissection of Cells from Plant Tissues. Plant Physiology 132, 27-35.
147
Korekane H., Shida K., Murata K., Ohue M., Sasaki Y., Imaoka S., and Miyamoto
Y. (2007). Evaluation of laser microdissection as a tool in cancer glycomic studies.
Biochem. Biophys. Res. Commun. 352, 579-586.
Nelson T., Tausta S.L., Gandotra N., and Liu T. (2006). LASER
MICRODISSECTION OF PLANT TISSUE: What You See Is What You Get. Annu.
Rev. Plant Biol. 57, 181-201.
Rudnicki M., Eder S., Schratzberger G., Mayer B., Meyer T.W., Tonko M., and
Mayer G. (2004). Reliability of T7-based mRNA linear amplification validated by gene
expression analysis of human kidney cells using cDNA microarrays. 97, e86-e95.
Schmid M.W., Schmidt A., Klostermeier U.C., Barann M., Rosenstiel P., and
Grossniklaus U. (2012). Mechanism of leaf-shape determination. Annu Rev Plant Bio
57, 477-496.
Wang L., Zhu J.-., Song M.-., Chen G.-., and Chen J.-. (2006). Comparison of gene
expression profiles between primary tumor and metastatic lesions in gastric cancer
patients using laser microdissection and cDNA microarray. 12, 6949-6954.
148
Yi H., Cho Y.-., Won S., Lee J.-., Jin Yu H., Kim S., Schroth G.P., Luo S., and Chun
J. (2011). Duplex-specific nuclease efficiently removes rRNA for prokaryotic RNA-seq.
Nucleic Acids Res. 39.
149
CHAPTER 6: DISCUSSION
Changes in the employment of developmental modules, i.e. groups of genes
acting in concert to produce some function of development, or their integration, the
qualitative or quantitative interactions between or within modules, constitute a driving
force in evolutionary-developmental biology. Modification of an organism’s
developmental program may produce new phenotypes that provide an adaptive
advantage, for example, increasing the likelihood of pollination and fertilization or
facilitating occupation of a different ecological niche, and such changes may be favored
by natural selection and become a part of that species’ evolutionary history.
Examination of the expression and knockdown phenotypes of genes such as
CINCINNATA and PHANTASTICA in separate lineages makes clear the importance of
viewing development as a network of interactions that has been repeatedly modified, for
uniform function cannot be assumed in developmental systems where multiple modules
are partially redundant (e.g. TCP4 with TCP3 and TCP10 (Koyama et al., 2007);
PHANTASTICA with the Class III HD-ZIP genes (Prigge et al., 2005)). The examples
described in chapters two, three and four expand our knowledge of the range of roles for
these genes, and allow us to identify common themes and likely ancestral roles for such
genes. To use the ARP genes as an example, ROUGH SHEATH 2 is required for the
repression of Class I KNOX genes in the leaf of the monocot Zea mays but is apparently
unconnected to specification of leaf polarity (Timmermans et al., 1999), while in the core
eudicot Antirrhinum majus the loss of AmPHAN leads to the radialization of leaves.
Inference of EcPHAN function from VIGS in Eschscholzia californica suggests that an
150
expanded role for the ARP genes in the specification of the adaxial domain of the leaf
lamina is a derived characteristic.
Likewise, the absence of floral phenotypes for EcCIN and CvCIN implies cooption of CIN-TCP genes into the development of the petal lamina after the Papaveraceae
diverged from their common ancestor with the core eudicots (Crawford et al., 2004, Nag
et al., 2009), however, a scarcity of research into the CIN-TCP genes in monocots and
basal angiosperms leaves open the possibility of a loss of petal development related
functions in Eschscholzia and Cysticapnos. This question could be addressed with a
more detailed comparison between species. Comparison of homologs in currently used
models as well as in new phylogenetic intermediates, perhaps target range from
chromatin immunoprecipitation or upstream regulation at cis regulatory elements, may
indicate whether presence or absence of the characteristic is the ancestral state.
Looking forward, the increasing capabilities of next generation sequencing and
sequence assembly technologies, in combination with current high throughput techniques
such as microarrays, are beginning to permit wide-scale comparisons of genomes and
profiling of gene expression at multiple stages of ontogeny, as discussed in Chapter 5.
Rather than taking a candidate gene approach, evo-devo researchers will be at liberty to
assay multiple genes in a regulatory network, or even genome-level expression; inferred
lineage-specific shifts in regulatory patterns might then be supported with functional
studies using transgenic or post-transcriptional gene silencing technologies (de Bruijn et
al., 2012). With such an approach we will rapidly gain a better understanding of how
151
plant development has evolved to produce the variety of anatomical and morphological
forms seen in plants today.
References
Crawford B.C.W., Nath U., Carpenter R., and Coen E.S. (2004). CINCINNATA
controls both cell differentiation and growth in petal lobes and leaves of antirrhinum.
Plant Physiol. 135, 244-253.
de Bruijn S., Angenent G.C., and Kaufmann K. (2012). Plant ‘evo-devo’ goes
genomic: from candidate genes to regulatory networks. Trends Plant Sci. 17, 441-447.
Koyama T., Furutani M., Tasaka M., and Ohme-Takagi M. (2007). TCP transcription
factors control the morphology of shoot lateral organs via negative regulation of the
expression of boundary-specific genes in Arabidopsis. Plant Cell 19, 473-484.
Nag A., King S., and Jack T. (2009). miR319a targeting of TCP4 is critical for petal
growth and development in Arabidopsis. Proceedings of the National Academy of
Sciences 106, 22534-22539.
Prigge M.J., Otsuga D., Alonso J.M., Ecker J.R., Drews G.N., and Clark S.E. (2005).
Class III Homeodomain-Leucine Zipper Gene Family Members Have Overlapping,
152
Antagonistic, and Distinct Roles in Arabidopsis Development. The Plant Cell
Online17, 61-76.
Timmermans M.C.P., Hudson A., Becraft P.W., Nelson T. (1999). ROUGH
SHEATH2: a Myb protein that represses knox homeobox genes in maize lateral organ
primordia. Science 284:151–53
153
APPENDIX I: CLONING OF PUTATIVE MICRORNA319 HOMOLOGS FROM
ESCHSCHOLZIA CALIFORNICA
Solanum lycopersicum LANCEOLATE and the homolgous Arabidopsis thaliana
genes TCP3, TCP4, TCP10, as well as other CIN-TCP genes TCP2 and TCP24 are
negatively post-transcriptionally regulated by the microRNA miRNA319 (Ori et al.,
2007), a relative of miR159 (Li et al., 2011). In Arabidopsis there are multiple RNA
precursor genes, silencing functions primarily associated with miR319a (Warthmann et
al., 2008; Palatnik et al., 2007), but miR319 family microRNAs have been identified
even in moss (Arazi et al., 2005).
Previously, Barakat et al. (2007) conducted broad-scale sequencing of
microRNAs from Eschscholzia californica, an herbaceous basal eudicot plant. Six
miR319-like sequences were identified, five of which represented subtle variations of the
same sequence, and one of which was dissimilar. This dissimilar sequence was inferred
to correspond to another region of the pre-miRNA. To clone pre-miRNA319 sequences
(potentially useful for phylogenetic comparison, in situ hybridization or transgenic
silencing), the primers EcCINmiRNA319-1F
(GCACTAGTGATTAACTCGAGGCAAATATGG) and EcCINmiRNA319-2R
(CATCTACTCCATATTTGCCTCGAG) were used to amplify DNA from Eschscholzia
californica shoot-tip-derived cDNA by PCR. Four unique sequences were obtained from
non-exhaustive sequence of transformed plasmid inserts. Prediction of RNA secondary
154
structures for these sequences with the Vienna RNA Websuite (Gruber et al., 2008)
supports the hypothesis that these are premiRNA sequences (Figure 32).
Priming sites/
miRNA sites
Figure 32. 2-D centroid model for an Eschscholzia californica premiRNA319 sequence
(GLE1388)
155
Sequences
GLE1383
GAGCTCTCTTCAGTCCAGTCACGGAGGTTTCAAGGGTTTGAATTATCTGCCGG
CTCATTCATCCAAACACAAAGTAGACACTGGGGAGTACATTTGCTACTGTGA
CTGCGTGAATGATACGGGAGATAAATTCCATCCTTTTACCTCTATGATTGGAct
GAAGGGAGCTCCCT
GLE1384
GAGCTCTCTTCAGTCCAGTCATGGGTAGCTATGAGATTCAATTAACTGCCGAC
TCATTCATCCAAATACTAAGTAAAGAAAAATGATGAAGAACAAGCACAACA
AGTACTACTTGCTTGGTAAATGAGTGAATGATGCGGGAGATAAATTGTATCTT
TTGCTCCTCTTAATTGGACTGAAGGGAGCTCCCT
GLE1385
GAGCTCTCTTCAGTCCAGTCATGGGTAGCTATGAGATTCAATTAACTGCCGAC
TCATTCATCCAAATACTAAGTAAAGAAAAATGATGAAGAACAAGCACAACA
AGTACTACTTGCTTGGTAAATGAGTGAATGATGCGGGAGATAAATTGTATCTT
TTGCTCCTCTTAATTGGACTGAAGGGAGCTCCCT
GLE1387
GAGCTCTCTTCAGTCCAGTCATGGGTAGCTATGAGATTCAATTAACTGCCGAC
TCATTCATCCAAATACTAAGTAAAGAAAAAATGATGAAGAACAAGCACAAC
AGGTACTACTTGCTTGGTAAATGAGTGAATGATGCGGGAGATAAATTGTTTCT
TTTGCTCCTCTTAATTGGACTGAAGGGAGCTCCCT
GLE1388
GAGCTCTCTTCAGTCCAGTCATGGGTAGCTATGAGATTCAATTAACTGCCGAC
TCATTCATCCAAATACTAAGTAAAGAAAAAATGATGAAGAACAAGCACAAC
AAGTACTACTTGCTTGGTAAATGAGTGAATGATGCGGGAGATAAATTGTTTCT
TTTGCTCCTCTTAATTGGACTGAAGGGAGCTCCCT
GLE1389
GAGCTCTCTTCAGTCCAGTCATGAGTAGTCATAAGATTCAATTATCTGCCGAC
TCATTCATCCAAATACTAAGTGAATAAACGATGAATCCCTAACCTATGCAGT
ACGTACAACTACTCGCTTGGTAAATGTGTGAATGATACGGGAGATAAATTGA
TTCTTTTGCTTCTCGTAATTGGACTGAAGGGAGCTCCCTCCCT
GLE1390
GAGCTCTCTTCAGTCCAGTCATGGGTAGCTATGAGATTCAATTAACTGCCGAC
TCATTCATCCAAATACTAAGTAAAGAAAAATGATGAAGAACAAGCACAACA
AGTACTACTTGCTTGGTAAATGAGTGAATGATGCGGGAGATAAATTGTATCTT
TTGCTCCTCTTAATTGGACTGAAGGGAGCTCCCT
156
References
Arazi T., Talmor-Neiman M., Stav R., Riese M., Huijser P., and Baulcombe D.C.
(2005). Cloning and characterization of micro-RNAs from moss. 43, 837-848.
Barakat A., Wall K., Leebens-Mack J., Wang Y.J., Carlson J.E., and DePamphilis
C.W. (2007). Large-scale identification of microRNAs from a basal eudicot
(Eschscholzia californica) and conservation in flowering plants. 51, 991-1003.
Gruber A.R., Lorenz R., Bernhart S.H., Neuböck R., Hofacker I.L. (2008). The
Vienna RNA Websuite. Nucleic Acids Res. 36, W70-W74.
Li Y., Li C., Ding G., and Jin Y. (2011). Evolution of MIR159/319 microRNA genes
and their post-transcriptional regulatory link to siRNA pathways. BMC Evolutionary
Biology 11, 122.
Palatnik J.F., Wollmann H., Schommer C., Schwab R., Boisbouvier J., Rodriguez
R., Warthmann N., Allen E., Dezulian T., Huson D., Carrington J., and Weigel D.
(2007). Sequence and Expression Differences Underlie Functional Specialization of
Arabidopsis MicroRNAs miR159 and miR319. 13, 115-125.
157
Warthmann N., Das S., Lanz C., and Weigel D. (2008). Comparative analysis of the
MIR319a microRNA locus in Arabidopsis and related Brassicaceae. Mol. Biol. Evol. 25,
892-902.
158
APPENDIX II: CLONING OF GIBBERELLIC ACID AND CYTOKININ
METABOLIC GENES FROM ESCHSCHOLZIA CALIFORNICA
Cytokinins
The cytokinins are a family of growth regulators, predominantly
isopentenyladenines but also trans-zeatins (Frebort et al., 2011), that promote cell
division and indeterminacy and regulate processes such as apical dominance and
meristem maintenance. The cytokinin biosynthetic pathway is catalyzed by a series of
enzymes via two alternative pathways, the MVA (isopentenyladenine) and MEP (transzeatin) pathways (Frebort et al., 2011). These use different initial substrates (DMAPP
and HMBDP) that are initially modified by isopentenyltransferases (IPTs) but
intermediate forms from the MVA pathway can be converted to MEP intermediates by
cytochrome p450 monoxygenase. Cytokinin phosphoribohydrolases such as ‘Lonely
Guy’ (LOG) and cytokine N-glucosyl transferases are responsible for producing the
penultimate intermediates and active forms of cytokinin respectively in both pathways.
At several stages of the MEP pathway, intermediates are converted to various cytokinins
by additional enzymes, including zeatin reductase.
Synthesis of the different cytokinin types is compartmentalized, and in
Arabidopsis is performed by IPTs that are spatially and functionally separated (Frebort et
al., 2011). In Arabidopsis, MVA-pathway-specific AtIPT7 is localized to the
mitochondria and AtIPT4 is cytosolic, while the MEP-specific AtIPT1, 3, 5 and 8 are
found in plastids (Frebort et al., 2011). These genes also exhibit different tissue
specificities, with AtIPT3, 5 and 7 being expressed ubiquitously (Frebort et al., 2011).
159
Catabolism of active cytokinins is performed by cytokinin dehydrogenases (also
known as cytokinin oxidases - CKX) (Frebort et al., 2011). This process is irreversible
and is, at present, thought to be performed by this enzyme family only. The CKXs are all
glycosylated and share conserved substrate and FAD binding domains, as well as
additional conserved motifs associated with the FAD-binding domain and elsewhere
(Frebort et al., 2011). Similarly to the IPTs, different CKXs are found in different
subcellular compartments, being vacuolar, cytosolic or apoplastic, and have different
substrate specificities and tissue-specific expression (Frebort et al., 2011).
Gibberellins
Gibberellins are tetracyclic diterpenoid growth regulators. Gibberellin
biosynthesis requires enzymes such as GA 3 oxidase and GA 20 oxidase to convert
transgeranylgeranyl disphosphate to metabolically active gibberellic acids (Thomas and
Sun, 2004). Several essential enzymes are gibberellin, 2-oxoglutarate-dependent
dioxygenases, or 2-ODDs. In GA20ox etc. the specific number of course refers to the
site of hydroxylation of the substrate (Thomas and Sun, 2004).
2-ODDs commonly have two or three introns. They exhibit homology to one
another and share a conserved motif NYYPPCIKP (residues 230-238). Numerous other
residues required for prosthetic group binding are conserved, while the 5’ end of the gene
is largely unconserved and variable in length (Thomas et al., 1999). An additional short
motif LPWKET (residues 148-153) is conserved in GA 20 oxidases only, while many
160
specific residues conserved in GA2Ox are not conserved in GA20Ox and GA3Ox (see
Thomas et al., 1999 for an annotated alignment of this family of genes).
Unlike cytokinin metabolism enzymes, gibberellic acid metabolic enzymes are
compartmentalized by function (Olszewski et al., 2002). The final three stages occur in
the cytoplasm, where GA20Ox converts the precursors GA12 and GA53 to GA9 and GA20.
GA3Ox converts these to active GA4 and GA1. GA2Ox converts GA9, GA20, GA4 and GA1
to inactive GA34 and GA8 (Olszewski et al., 2002; Sakamoto et al., 2004). The expression
of these enzymes is tissue specific, with GA20Ox and GA3Ox sharing common
expression patterns (Hedden and Phillips, 2000).
Cytokinin and gibberellin functions
Shani et al. (2010) demonstrated that in tomato, ectopic expression of IPT7 and
CKX3 has opposite effects on leaflet numbers, increasing and decreasing them
respectively. The role of cytokinins in promoting cell division, partly through the
activation of cyclins (Riou-Khamlichi et al., 1999), as opposed to the promotion of cell
expansion and elongation by gibberellins, would suggest a possible role in maintaining
the morphogenetic state of developing leaf primordia (Fleishon et al., 2011). This would
contrast with the antagonistic roles of gibberellic acids, which favor cell expansion via
depletion of DELLA proteins which suppress growth by interfering with basic helixloop-helix (bHLH) transcription factor binding to DNA targets (Gao et al., 2011). It is
not known if TCP transcription factors, which contain a bHLH domain, are targets of
DELLAs, although gibberellins are known to play some part in the regulation of the
161
CINCINNATA homolog LANCEOLATE (Yanai et al., 2011). The possibility raises
intriguing questions regarding the integration of multiple developmental maturation
pathways. DELLAs also restrict cell division, thus the suppression of their effects broadly
promotes organ growth (Achard et al., 2009). Finally, gibberellic acids likely act as
suppressors of KNOX gene expression (Singh et al., 2010); Class I KNOX genes are
important in the maintenance of cell indeterminacy at the shoot apical meristem and at
the margins of developing compound leaves (Hay and Tsiantis, 2010).
Experimental approach
To begin to investigate the role of cytokinin and gibberellin metabolic genes in
leaf development in Eschscholzia californica, a species of interest in evolutionarydevelopment research, nucleotide sequences homologous to known cytokinin and
gibberellin metabolism genes were identified from Eschscholzia californica
transcriptome assemblies in the 1KP database.
A region of an IPT homolog, designated EcIPT, was cloned into pGEM-T using
the primers EcIPT-3F (AAACGCGTCGATCAAATGG) and EcIPT-4R
(CCCACCACAAGCTCTTCC) designed multiple 1KP contigs that were similar to
Arabidopsis thaliana IPT. Similarly, part of a GA 20 OXIDASE gene homolog
(EcGA20OX) was cloned with the primers EcGA20Ox-9F
(AACTGGTCCTCATTGTGATCC) and EcGA20Ox-10R
(TGGATCCATTTGGAGAAAGC) that were based upon multiple Eschscholzia
californica contigs most similar to Arabidopsis thaliana GA20OX1 and GA20OX2 1KP.
162
The EcGA20OX insert was then amplified using the primers EcGA20Ox11F
(AAGAATTCAACTGGTCCTCATTGTGATCC; contains EcoRI restriction site) and
EcGA20Ox12R (TTCCTAGGGTTGCCCAAGTGAAATCTGG), purified and digested
with EcoRI (the sequenc contains an internal EcoRI restriction site) and directionally
cloned into pTRV2 (plasmid SG1187) in preparation for Virus-Induced Gene Silencing
(VIGS) in Eschscholzia californica.
Sequences
GLE1385 - EcIPT
ATTAAAACGCGTCGATCAAATGGTAAAAATGGGTTTAGTAGAAGAAGTACGA
GATATGTTTGAGCCTCACAATAGAGATTATACGCGTGGTATTAGACGCTCAAT
TGGTATGCCAGAAATGGACCAATACTTACTACTTGAAGATACTGTTGATGAA
GAAACACGCATAAATTTACTCGATATGGCTATTAACGATATCAAAATCAATA
CATGTATTTTAGCGTCTCGTCAACTACAAAAAATTTATCGACTTCGTTCCTTA
CCGGATTGGAACATACATCGTGTCAGTGCCACAGATGTGTTTTTAATGGAGG
GTGGATATTCTTATGATAGATGGGAAGAGCTTGTGGTGGGAATCACTAGTGC
GG
GLE1401 – EcGA20OX
ATGGCCGCGGGATTAACTGGTCCTCATTGTGATCCAACTTCATTAACAATTCT
TCATCAAGATCAAGTTGGTGGTTTACAAGTTTATGTTGATAATCAATGGCATT
CTATTGCTCCTAATTCACAAGCATTTGTCGTTAATATCGGCGATACTTTCATG
GCTTTATCAAATGGGAGATATAAGAGTTGTTTACACAGAGCAGTAGTAAATA
GTGAAACACCAAGAAAATCACTAGCTTTCTTTTTATGCCCTAAAAAAGATAG
AAAGGTGTGTCCACCAGAGGAATTGATCAACTTAGAATGTCCAAGAGTTTAC
CCAGATTTCACTTGGGCAACTTTTCTTGAATTCACTCAGAAACATTACAGAGC
TGATCAAAAGACCCTTGATGCTTTCTCCAAATGGATCCAAATCACTA
References
Achard P., Gusti A., Cheminant S., Alioua M., Dhondt S., Coppens F., Beemster
G.T.S., and Genschik P. (2009). Gibberellin Signaling Controls Cell Proliferation Rate
in Arabidopsis. 19, 1188-1193.
163
Fleishon S., Shani E., Ori N., and Weiss D. (2011). Negative reciprocal interactions
between gibberellin and cytokinin in tomato. New Phytol. 190, 609-617.
Frébort I., Kowalska M., Hluska T., Frébortová J., and Galuszka P. (2011).
Evolution of cytokinin biosynthesis and degradation. J. Exp. Bot. 62, 2431-2452.
Gao X., Xiao S., Yao Q., Wang Y., and Fu X. (2011). An Updated GA Signaling
‘Relief of Repression’ Regulatory Model. Molecular Plant 4, 601-606.
GarciaMartinez J., LopezDiaz I., SanchezBeltran M., Phillips A., Ward D., Gaskin
P., and Hedden P. (1997). Isolation and transcript analysis of gibberellin 20-oxidase
genes in pea and bean in relation to fruit development. Plant Mol. Biol. 33, 1073-1084.
Hay A. and Tsiantis M. (2010). KNOX genes: versatile regulators of plant development
and diversity. Development 137, 3153-3165.
Hedden P. and Phillips A.L. (2000). Gibberellin metabolism: new insights revealed by
the genes. Trends Plant Sci. 5, 523-530.
Olszewski N., Sun T., and Gubler F. (2002). Gibberellin Signaling: Biosynthesis,
Catabolism, and Response Pathways. The Plant Cell Online 14, S61-S80.
164
Riou-Khamlichi C., Huntley R., Jacqmard A., and Murray J.A.H. (1999). Cytokinin
Activation of Arabidopsis Cell Division Through a D-Type Cyclin. Science 283, 15411544.
Sakamoto T., Miura K., Itoh H., Tatsumi T., Ueguchi-Tanaka M., Ishiyama K.,
Kobayashi M., Agrawal G.K., Takeda S., Abe K., Miyao A., Hirochika H., Kitano
H., Ashikari M., and Matsuoka M. (2004). An Overview of Gibberellin Metabolism
Enzyme Genes and Their Related Mutants in Rice. Plant Physiology 134, 1642-1653.
CORRECTION. (2004). Plant Physiology 135, 1863-1863.
Shani E., Ben-Gera H., Shleizer-Burko S., Burko Y., Weiss D., and Ori N. (2010).
Cytokinin Regulates Compound Leaf Development in Tomato. Plant Cell 22, 3206-3217.
Singh D.P., Filardo F.F., Storey R., Jermakow A.M., Yamaguchi S., and Swain S.M.
(2010). Overexpression of a gibberellin inactivation gene alters seed development,
KNOX gene expression, and plant development in Arabidopsis. Physiol. Plantarum 138,
74-90.
Thomas S.G., Phillips A.L., and Hedden P. (1999). Molecular cloning and functional
expression of gibberellin 2- oxidases, multifunctional enzymes involved in gibberellin
deactivation. Proceedings of the National Academy of Sciences 96, 4698-4703.
165
Thomas S.G. and Sun T. (2004). Update on Gibberellin Signaling. A Tale of the Tall
and the Short. Plant Physiology 135, 668-676.
Yanai O., Shani E., Russ D., and Ori N. (2011). Gibberellin partly mediates
LANCEOLATE activity in tomato. 68, 571-582.
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
!
Thesis and Dissertation Services
!