* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Hamster Placental Lactogen-ll Contains a Structural Feature Unique
Citric acid cycle wikipedia , lookup
Magnesium transporter wikipedia , lookup
Interactome wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Catalytic triad wikipedia , lookup
Ancestral sequence reconstruction wikipedia , lookup
Peptide synthesis wikipedia , lookup
Western blot wikipedia , lookup
Protein–protein interaction wikipedia , lookup
Point mutation wikipedia , lookup
Two-hybrid screening wikipedia , lookup
Homology modeling wikipedia , lookup
Ribosomally synthesized and post-translationally modified peptides wikipedia , lookup
Amino acid synthesis wikipedia , lookup
Proteolysis wikipedia , lookup
Biosynthesis wikipedia , lookup
Metalloprotein wikipedia , lookup
Hamster Placental Lactogen-ll Contains a Structural Feature Unique among the Growth HormoneProlactin-Placental Lactogen Family Jonathan N. Southard, Luan Do*, William C. Smith, and Frank Talamantes Department of Biology University of California Santa Cruz, California 95064 Sequence analysis of cDNA for hamster placental lactogen-ll (PL-II) revealed that while this protein has a high degree of sequence homology to mouse and rat PL-II it contains a pair of cysteine residues not present in the mouse and rat proteins or in any other known member of the GH-PRL-PL protein family. This unique pair of cysteine residues may be responsible for the extreme tendency of hamster PL-II, compared to other members of the GH-PRLPL family, to form disulfide-bonded hormone-serum protein complexes. (Molecular Endocrinology 3: 1710-1713, 1989) ior of haPL-ll might be a reflection of a unique structural feature of this member of the GH-PRL-PL hormone family. The cDNA-deduced amino acid sequence of haPL-ll was determined in order to examine this possibility. RESULTS AND DISCUSSION To obtain cDNAs for haPL-ll, a A expression library was constructed using cDNA synthesized from RNA of day16 pregnant hamster placenta. Five positive clones were obtained from immunoscreening of 1 x 105 clones using a polyclonal antiserum to haPL-ll (6). Two clones with cDNAs of approximately 800 base pairs (bp) were sequenced. Subsequent screening of the library was performed by hybridization to a 174 bp fragment from the 5'-end of one of these cDNAs. One of the clones obtained by hybridization had a cDNA of approximately 900 bp which was also sequenced. The composite nucleotide sequence for the three cDNAs is shown in Fig. 1. The overlapping portions of the cDNAs differed only in the starting point for the poly(A) tail; it follows nucleotide 850 for two of the cDNAs and nucleotide 857 for the third. The composite sequence contains an open reading frame for a 221 amino acid polypeptide. Amino terminal amino acid sequencing of purified haPL-ll demonstrated that the amino terminus of the mature haPL-ll protein is located 31 amino acids from the amino terminal Met of the cDNA-deduced sequence (Fig. 1). The mRNA for haPL-ll therefore codes for a 221 amino acid precursor protein which is cleaved to yield a 191 amino acid mature haPL-ll protein. Similarly, mPL-ll and rPL-ll are synthesized as 222 amino acid precursors which are cleaved to yield mature proteins of 191 amino acid residues (4, 5). As is the case for mPL-ll and rPL-ll, the mature haPL-ll protein does not contain a consensus sequence for Asn-linked glycosylation (Asn-X-Ser/Thr). Figure 2 shows the alignment of the predicted amino acid sequences of haPL-ll, mPL-ll, and rPL-ll. A high INTRODUCTION Placental lactogen II (PL-II), a member of the GH-PRLPL family of structurally related hormones, has been purified from three rodent species: mouse (mPL-ll), rat (rPL-ll), and hamster (haPL-ll) (1-3). Complementary DNAs for mPL-ll and rPL-ll have been sequenced (4, 5) and the deduced amino acid sequences have 79% sequence identity. The three purified PL-lls have similar Mr by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), and polyclonal antiserum to each PL-II cross-reacts with the heterologous PL-lls under both native and denaturing conditions (6). The structures of the PL-lls therefore appear to be generally similar. In at least one respect, however, the behavior of haPL-ll differs markedly from that of mPL-ll and rPLII. In both the placenta and the maternal circulation, haPL-ll is present primarily as high Mr (Mr > 100,000) disulfide-bonded forms (3, 7), while mPL-ll and rPL-ll are present primarily in monomeric form (8, 9). Recent evidence (10) indicates that the major circulating form of haPL-ll is a disulfide-bonded complex of haPL-ll and a serum glycoprotein, possibly a-2-macroglobulin. It seemed likely that the unusual disulfide-bonding behav0888-8809/89/1710-1713$02.00/0 Molecular Endocrinology Copyright © 1989 by The Endocrine Society 1710 Hamster PL-II cDNA 1711 AGCGGCTTTCCTCTGTTGTAGTCCACAGTGCAACACATCTTCTCAGAG -30 -20 4 9 ATG CAG CTG CCT TTG ACT CCA CTG TCC TTC TCT GGG ACA CTC CTT TTG ATG GCA ATG TCA MET Gin Leu Pro Leu Thr Pro Leu Ser Phe Ser Gly Thr Leu Leu Leu MET Ala MET Ser -10 -1 +1 109 AAT TTT CTC CTT TGG GAA CAT GTG ACC TCC TCA GCA AGT CCT CGT TTA TCC ACT AGA AAC Asn Phe Leu Leu Trp Glu His Val Thr Ser Ser Ala Ser Pro Arg Leu Ser Thr Arg Asn 11 21 169 TTG TAC CAG CGT GTG GTT GAA TTG TCA CAC TGC ACC CAT GAT CTT GCC TCA AAA GTT TTC Leu Tyr Gin Arg Val Val Glu Leu Ser His Cys Thr His Asp Leu Ala Ser Lys Val Phe 31 41 22 9 ACT GAC TTT AAT ATG AAG TTT GGT AAG AGT ATT TGC AGA CAG AAA CTG ATG TTA TAC ACC Thr Asp Phe Asn MET Lys Phe Gly Lys Ser lie Cys Arg Gin Lys Leu MET Leu Tyr Thr 51 61 28 9 TGC CAC ACC TCC TCT ATT CCT ACT CCA GAA AAC AGA GAG CAA GTC CAC CAA ACA AAC TCG Cys His Thr Ser Ser lie Pro Thr Pro Glu Asn Arg Glu Gin Val His Gin Thr Asn Ser 71 81 34 9 GAA GAT CTC CTG AAA GTG ACG ATC AGT GTT TTA CAA GCC TGG GAG GAG CCT GTG AAG CAC Glu Asp Leu Leu Lys Val Thr He Ser Val Leu Gin Ala Trp Glu Glu Pro Val Lys His 91 101 4 09 ATG GTG GCT GCA GTA GCT GCT CTT CCA GGT ACA TCT GAT GCC ATG CTG TCA AGA GCA AAA MET Val Ala Ala Val Ala Ala Leu Pro Gly Thr Ser Asp Ala MET Leu Ser Arg Ala Lys 111 121 4 69 GAG TTG GAG GAA AGA GTT TTA GGC CTT CTG GAG GGA CTG AAG ATC ATA CTC AAC AGG ATT Glu Leu Glu Glu Arg Val Leu Gly Leu Leu Glu Gly Leu Lys He He Leu Asn Arg He 131 141 52 9 CAT CCT GGA GCT GTT GAA AAT GAC TAT ACT TTC TGG TCT GGA TGG TCA GAT TTG CAG TCA His Pro Gly Ala Val Glu Asn Asp Tyr Thr Phe Trp Ser Gly Trp Ser Asp Leu Gin Ser 151 161 58 9 TCT GAT GAA GCT ACT CGT AAC ATT GCT TTT TAT ACT ATG GGC CGT TGC CTG CGC AGG GAT Ser Asp Glu Ala Thr Arg Asn He Ala Phe Tyr Thr MET Gly Arg Cys Leu Arg Arg Asp 171 181 64 9 ACA CAC AAA GTT GAT AAT TAT CTC AAG GTT TTG AAA TGC CGA GAT ATC CAT AAT AAC AAC Thr His Lys Val Asp Asn Tyr Leu Lys Val Leu Lys Cys Arg Asp He His Asn Asn Asn 191 709 TGC TGA Cys * 786 GCTCAAATCCTTAACCACTGTCATGGAGAAGGTCCAGACCTCAAAGTTCCATTGAGTCTTTACCTTTTGGT TCATTCCTTGGTTTAATGGGCATGTTATTCAAAAATAAACATTGATTCTTTGAAATGCTTAATTCAAAATGAAAAAAAA 8 65 AAAAAAAAAAAAAAAAAAAAAAAAA Fig. 1. Composite Nucleotide Sequence and Predicted Amino Acid Sequence for haPL-ll cDNA The amino acid residues determined by amino terminal sequence analysis of haPL-ll are underlined. The three cDNAs sequenced begin at nucleotides 1,91, and 100 and extend to the poly(A) tail. The overlapping portions of the three cDNAs differ only in the starting point for the poly(A) tail (see text). degree of sequence homology is apparent for the three proteins. Most notable are two regions, one of 30 amino acids (residues 70-99) and another of 27 amino acids (165-191), in which there are no nonconservative substitutions in haPL-ll relative to mPL-ll and only three in each case relative to rPL-ll. Overall, haPL-ll has essentially identical sequence homology to both mPL-ll (70% identity) and rPL-ll (68% identity). This homology is slightly less than that between mPL-ll and rPL-ll (79% identity). The GH-PRL-PL protein family comprises pituitary GH and PRL and several placentally derived proteins. Production of two PLs, designated PL-I and PL-II, appears to be common in rodents. In addition, several cDNAs have been obtained from the placenta which code for other PRL-like proteins (11). Although high Mr forms have been detected for several members of the GH-PRL-PL family, it appears that these proteins circulate in the blood primarily as monomers. The only known exception is haPL-ll. The predominant form of haPL-ll in the maternal circulation is a species with a Mr of 600,000 as determined by gel filtration and 360,000 as determined by SDS-PAGE. Monomeric haPL-ll can be released from this high Mr form by reduction of disulfide bonds (10). While this high Mr form of haPL-ll has not been completely characterized, it was demonstrated that purified (monomeric) haPL-ll readily forms a similar high Mr species when incubated Vol 3 No. 11 MOL ENDO-1989 1712 haPL-II mPL-II rPL-II -20 M Q L P L T P L S F S G T L L L M A M S N F L L W E H V T M K L S L S Q P C S F S G A L L L L A V S N L L V W E K V T M V Q L S L T Q P C F S G T L L M L A V S T L L L W E Q V T haPL-II mPL-II rPL-II 20 * 1 S S A S P R L S T R N L Y Q R V V E L S H C T H D L A S K V S L P N Y R L P T E S L Y Q R V I V V S H N A H D L A S K A S A P N Y R M S T G S L Y Q R V V E L S H Y T H D L A S K V haPL-II mPL-II rPL-II 40 * F T D F N M K F G K S I C R Q K L M L Y T C H T S S I P T P F M E F E M K F G R T A W T Y G L M L S P C H T A A I L T P F I E F D M K F G R T V W T H N L M L S P C H T A A I P T P haPL-II mPL-II rPL-II 80 E N R E Q V H Q T N S E D L L K V T I S V L Q A W E E P V K E N S E Q V H Q T T S E D L L K V S I T I L Q A W E E P L K E N S E Q V H Q A K S E D L L K V S I T I L Q A W Q E P L K haPL-II mPL-II rPL-II 100 H M V A A V A A L P G T S D A M L S R A K E L E E R V L G L H M V A A V A A L P H V P D T L L S R T K E L E E R I Q G L H I V A A V A T L P D G S D T L L S R T K E L E E R I Q G L 60 haPL-II mPL-II rPL-II haPL-II mPL-II rPL-II haPL-II mPL-II rPL-II 120 140 L E G L K I I L N R I H P G A V E N D Y T F W S G W S D L Q L E G L K I I F N R V Y P G A V A S D Y T F W S A W S D L Q L E G L E T I L S R V Q P G A V G S D Y T F W S E W S D L Q 160 S S D E A T R N I A F Y T M G R C L R R D T H K V D N Y L K S S D E S T K N S A L R T L W R C V R R D T H K V D N Y L K S S D K S T K N G V L S V L Y R C M R R D T H K V D N F L K 180 V V V ' L K C R D I H N N N C L K C R D V H N N N C L K C R D I Y N N N C Fig. 2. Alignment of the Predicted Amino Acid Sequences of haPL-II, mPL-II, and rPL-II Nonconservative substitutions are indicated by boldface type (conservative substitutions: D = E, N = Q, K = R, S = T, I = L = V). The asterisks indicate the unique cysteine residues of haPL-II. The sequence for mPL-II is from Jackson et al. (4) and that for rPL-II is from Duckworth et al. (5). with hamster serum in vitro (10). This suggested that the major circulating form of haPL-II is a disulfidebonded complex between haPL-II and a serum protein. The predicted amino acid sequence of haPL-II confirms this. While the sequence does not contain a site for Asn-linked glycosylation, the major circulating form of haPL-II is about 10% Asn-linked carbohydrate by weight (10). Therefore, the circulating form of haPL-II cannot be an aggregate of hormone monomers as has often been assumed to be the case for high Mr forms of proteins in the GH-PRL-PL family. The ability to form high Mr disulfide-bonded complexes is not unique to haPL-II. Human PL (hPL) and mPL-II form similar complexes when incubated with human and mouse serum, respectively (10). The major difference observed for the three PLs is that the conversion to disulfide-bonded complexes in vitro occurs to a significantly greater extent for haPL-II than for hPL and mPL-II. Although these experiments have not been performed with rPL-II, this protein probably behaves similarly to mPL-II, since no significant amount of high Mr forms are present in the placenta or in the blood (9). With regard to the enhanced ability of haPL-II to form intermolecular disulfide bonds, the most obvious structural difference between haPL-II and the other PLs is the presence of an additional pair of Cys residues. The four Cys residues of haPL-II which correspond to those of mPL-II and rPL-II (at positions 51,166,183, and 191) are conserved in all known members of the GH-PRL-PL family (12). In addition, haPL-II contains a pair of Cys residues not present in the other PL-Ms. These occur at residue 21 (Asn in mPL-II and Tyr in rPL-II) and residue 42 (Trp in mPL-II and rPL-II). Like haPL-II, mammalian PRLs have an additional pair of Cys residues. The positions of these Cys residues in PRL are highly conserved (12), with both occurring within the first 11 amino acid residues of the mature protein. Currently, complete amino acid sequences are available for 18 GHs and 13 PRLs (12) and eight placental proteins (excluding haPL-II) related to them (11). None of these proteins contain Cys residues corresponding to those at positions 21 and 42 of haPL-II. The four Cys residues of hPL form two intramolecular disulfide bonds in the monomeric hormone, Cys 53- Hamster PL-II cDNA Cys165 and Cys 182-Cys189 (13). Presumably, analogous disulfide bonds (Cys 51-Cys 166 and Cys 183Cys191) are present in mPL-ll and rPL-ll. Purified, monomeric haPL-ll does not contain any sulfhydryl groups (10) and therefore contains three disulfide bonds in an unknown arrangement. When purified haPL-ll is incubated with serum in vitro, one or more of these disulfides is disrupted to form an intermolecular disulfide bond with a serum protein, generating the high Mr disulfide-bonded form of haPL-ll. It is not possible at this time to predict which of the Cys residues of haPLII participate in the formation of an intermolecular disulfide bond. It has become increasingly clear that the placenta is the source of a number of proteins which, although obviously structurally related to pituitary GH and PRL, have subtle or not so subtle structural variations compared to GH and PRL (11). The finding that haPL-ll contains a uniquely positioned pair of Cys residues introduces yet another type of variation. As for the other structural variations, the ultimate functional consequences of this alteration in structure are unknown. There is in this case, however, a strong correlation between a relatively small change in structure and a gross alteration in the mechanism by which the hormone acts. Thus, while haPL-ll and mPL-ll have a 70% amino acid sequence identity, haPL-ll circulates primarily as a complex with a serum glycoprotein and mPL-ll circulates primarily as a monomer. The exact nature of the circulating haPL-ll complex, the mechanism by which it is formed, and the effect of this process on the functional properties of PL-II in the hamster remain to be elucidated. Acknowledgments We thank Linda Ogren and Gudmundur Thordarson for their comments on the manuscript. Received June 28,1989. Revision received August 3,1989. Accepted August 4,1989. Address requests for reprints to: Dr. Frank Talamantes, Thimann Laboratories, University of California, Santa Cruz, California 95064. 1713 This work was supported by NIH Grants HD-14966 and MBRS-RR08132 and NSF Grant DCB-8602865. * Recipient of a MARC undergraduate fellowship. REFERENCES 1. Colosi P, Marr G, Lopez J, Haro L. Ogren L. Talamantes F 1982 Isolation, purification, and characterization of mouse placental lactogen. Proc Natl Acad Sci USA 79:771-775 2. Robertson MC, Friesen HG 1975 The purification and characterization of rat placental lactogen. Endocrinology 97:621-629 3. Southard JN, Thordarson G, Talamantes F 1986 Purification and partial characterization of hamster placental lactogen. Endocrinology 119:508-514 4. Jackson LL, Colosi P, Talamantes F, Linzer DIH 1986 Molecular cloning of mouse placental lactogen cDNA. Proc Natl Acad Sci USA 83:8496-8500 5. Duckworth ML, Kirk KL, Friesen HG 1986 Isolation and identification of a cDNA clone of rat placental lactogen II. J Biol Chem 261:10871-10878 6. Southard JN, Talamantes F 1987 Immunological studies of rodent placental lactogens. Mol Cell Endocrinol 50:2936 7. Southard JN, Campbell GT, Talamantes F 1987 Hamster placental lactogens: gestational profiles and high molecular weight forms. Endocrinology 121:900-906 8. Markoff E, Talamantes F 1982 Partial characterization of mouse placental lactogen. Endocrinology 110:403-408 9. Robertson MC, Gillespie B, Friesen HG 1982 Characterization of the two forms of rat placental lactogen (rPL): rPL-l and rPL-ll. Endocrinology 111:1862-1866 10. Southard JN, Talamantes F 1989 High molecular weight forms of placental lactogen: evidence for lactogen-macroglobulin complexes in rodents and humans. Endocrinology 125:791-800 11. Duckworth ML, Peden LM, Schroedter I, Shah P, Friesen HG 1988 Placental lactogens and the extra hypophoseal prolactin gene family. In: Hoshino K (ed) Prolactin Gene Family and its Receptors. Excerpta Medica, Amsterdam, pp 79-88 12. Kawauchi H, Yasuda A 1988 The molecular evolution of prolactin and related hormones. In: Hoshino K (ed) Prolactin Gene Family and its Receptors. Excerpta Medica, Amsterdam, pp 61-70 13. Schneider AB, Kowalski K, Russell J, Sherwood LM 1979 Identification of the interchain disulfide bonds of dimeric human placental lactogen. J Biol Chem 254:3782-3787