Download - Bronco Scholar

ABERRANT ALTERNATIVE SPLICING IN SKELETAL MUSCLE OF
R6/2 HUNTINGTON’S DISEASE MICE
A Thesis
Presented to the
Faculty of
California State Polytechnic University, Pomona
In Partial Fulfillment
Of the Requirements for the Degree
Master of Science
In
Biological Sciences
By
Elizabeth Munguia
2016
SIGNATURE PAGE
THESIS:
ABERRANT ALTERNATIVE SPLICING
IN SKELETAL MUSCLE OF R6/2
HUNTINGTON’S DISEASE MICE
AUTHOR:
Elizabeth Munguia
DATE SUBMITTED:
Fall 2016
Biological Sciences Department
Dr. Robert J. Talmadge
Thesis Committee Chair
Biological Sciences
Dr. Andrew D. Steele
Biological Sciences
Dr. Sepher Eskandari
Biological Sciences
ii
ACKNOWLEDGEMENTS
First and foremost, I would like to thank my thesis advisor, Dr. Robert J. Talmadge for
the amazing opportunity to join his lab and be part of a great research project. I could not
have completed my Master’s thesis without his help. I am gratefully indebted to him for
his time, patience, expertise, and guidance.
I would also like to thank my thesis committee, Dr. Sepher Eskandari and Dr. Andrew D.
Steele for their time and intellectual contributions.
Finally, I want to thank my family and friends for their constant support and
encouragement. Gracias mamá y papá por su amor y apoyo. Thank you Adam, Helen,
Steve, and Jenny for your love and countless adventures.
iii
ABSTRACT
Huntington’s disease (HD) is a fatal trinucleotide-repeat disorder that is characterized by
neurodegeneration, which leads to motor and cognitive impairments. The motor
impairments include chorea, rigidity, dystonia, and muscle weakness. Cognitive
impairments include subcortical dementia, depression, mania, and suicide. These
impairments increase in severity until the individual loses the ability to talk, walk, or
reason. Previous research by our lab (Waters et al., 2013) demonstrated that in a
transgenic mouse model for HD, i.e., the R6/2 mouse line, impairments in muscle
function, including alterations in muscle excitability, chloride channel function, and
chloride channel mRNA levels, were in part due to aberrant splicing of the chloride
channel pre-mRNA. The R6/2 mouse line expresses the expanded CAG trinucleotide
repeat from exon 1 of the human huntingtin (HTT) gene observed in human HD patients
and represents a model of early onset HD. The data from Waters et al. (2013) are
reminiscent of another trinucleotide-repeat disorder, myotonic dystrophy (DM), in which
skeletal muscles have dramatic debilitations in the regulation of pre-mRNA splicing.
Therefore, this study investigated the changes in pre-mRNA splicing in multiple muscles
of R6/2 mice for several genes that are known to be aberrantly spliced in DM, and may
be aberrantly spliced in HD. These genes include the chloride channel (CLCN1), insulin
receptor (INSR), titin (TTN), sarco(endo)plasmic reticulum Calcium ATPase (SERCA1),
z-line associated protein (ZASP), troponin (TNNT3), and α-actinin 1 (ACTN1). Reverse
transcriptase-polymerase chain reactions using primers designed to detect multiple splice
variants were used to detect changes in alternative splicing in R6/2 and age-matched
wild-type (WT) mice. Multiple muscles were assessed for alterations in mRNA splicing
iv
including the tibialis anterior (TA), interosseous (IO), diaphragm (Dia), and soleus (Sol)
muscles from late-stage R6/2 mice and WT controls. We found a significant difference in
aberrantly spliced TTN mRNA in the TA of R6/2 mice relative to WT (p < 0.001)
(n=12/group). We also found a significant difference in aberrantly spliced CLCN1 (p <
0.05) and INSR (p < 0.05) mRNAs in the IO of R6/2 mice relative to WT (n=6/group).
However, we did not find significant differences in aberrantly spliced CLCN1 (p =
0.286), INSR (p = 0.716), TTN (p = 0.195), and ZASP (p = 0.496) mRNAs in the Dia of
R6/2 mice relative to WT (n=5/group). There were also no significant differences in
aberrantly spliced CLCN1 (p = 0.500) and INSR (p = 0.264) mRNAs in the Sol of R6/2
mice (n = 6) relative to WT (n = 7). There were also no significant differences in
aberrantly spliced TTN (p = 0.0774) mRNA in the IO muscle of R6/2 mice relative to
WT (n=6/group). We also found no significant differences in aberrantly spliced
SERCA1, TNNT3, and ACTN1 mRNAs in TA, IO, Dia, and Sol skeletal muscles of
R6/2 mice relative to WT. These results suggest the effect of HD on aberrant splicing is
muscle specific and less pronounced than in DM. Thus, slower muscles, such as the Dia
and Sol, may be less affected by HD in terms of aberrant alternative splicing, than faster
muscles, such as the TA and IO.
v
TABLE OF CONTENTS
SIGNATURE PAGE ......................................................................................................... iii
ACKNOWLEDGEMENTS. .............................................................................................. iii
ABSTRACT....................................................................................................................... iv
LIST OF TABLES ............................................................................................................. ix
LIST OF FIGURES ............................................................................................................ x
INTRODUCTION .............................................................................................................. 1
Huntington's Disease....................................................................................................... 1
Huntington's Disease: Previous Research ....................................................................... 5
Alternative Splicing ........................................................................................................ 7
Animal Models of HD .................................................................................................... 8
Myotonic Dystrophy ..................................................................................................... 10
Myotonic Dystrophy: Aberrant Alternative Splicing ................................................... 12
Chloride Channel (CLCN1) ...................................................................................... 12
Insulin Receptor (INSR) ........................................................................................... 12
Sarco(endo)plasmic reticulum Ca2+-ATPase pump (SERCA1) ............................... 13
Skeletal Muscle ............................................................................................................. 13
Skeletal Muscle Composition ................................................................................... 13
Skeletal Muscle Contraction ..................................................................................... 15
Muscle Proteins............................................................................................................. 17
vi
Titin (TTN) ............................................................................................................... 17
Z-line associated protein (ZASP).............................................................................. 17
Troponin T3 (TNNT3) .............................................................................................. 18
Alpha Actinin 1 (ACTN1) ........................................................................................ 18
Thesis Objectives .......................................................................................................... 19
Study Questions ........................................................................................................ 20
Hypotheses ................................................................................................................ 20
MATERIALS AND METHODS...................................................................................... 21
Animal Model ............................................................................................................... 21
Experimental Procedures .............................................................................................. 22
RNA Isolation ........................................................................................................... 22
RNA Quantification and Dilution ............................................................................. 23
Splicing Analysis ...................................................................................................... 24
Genes of Interest ........................................................................................................... 25
Statistical Methods ........................................................................................................ 26
RESULTS ......................................................................................................................... 27
Chloride Channel (CLCN1) ...................................................................................... 27
Insulin Receptor (INSR) ........................................................................................... 30
Sarco(endo)plasmic reticulum Ca2+-ATPase Pump (SERCA1) ............................... 33
Titin (TTN) ............................................................................................................... 35
vii
Troponin T3 (TNNT3) .............................................................................................. 38
Alpha Actinin 1 (ACTN1) ........................................................................................ 40
Z-line associated protein (ZASP).............................................................................. 43
DISCUSSION ................................................................................................................... 46
CONCLUSION ................................................................................................................. 50
FUTURE STUDIES ......................................................................................................... 51
REFERENCES ................................................................................................................. 52
viii
LIST OF TABLES
Table 1. PCR Conditions ................................................................................................. 24
Table 2. Primer Conditions .............................................................................................. 25
Table 3. Summary of Aberrant Alternative Splicing ....................................................... 47
ix
LIST OF FIGURES
Figure 1. Sarcomere of the skeletal muscle. ..................................................................... 14
Figure 2. Gel showing CLCN1 mRNA splicing ............................................................... 28
Figure 3. Expression of CLCN1 mRNA ........................................................................... 29
Figure 4. Gel showing INSR mRNA splicing .................................................................. 31
Figure 5. Expression of INSR mRNA splicing................................................................. 32
Figure 6. Gel showing SERCA1 mRNA splicing............................................................. 34
Figure 7. Gel showing TTN mRNA splicing .................................................................... 36
Figure 8. Expression of TTN mRNA splicing .................................................................. 37
Figure 9. Gel showing TNNT3 mRNA splicing ............................................................... 39
Figure 10. Gel showing ACTN1 mRNA splicing............................................................. 41
Figure 11. Expression of ACTN1 mRNA splicing ........................................................... 42
Figure 12. Gel showing ZASP mRNA splicing ................................................................ 44
Figure 13. Expression of ZASP mRNA splicing .............................................................. 45
x
INTRODUCTION
Huntington's Disease
The first record of Huntington’s disease (HD) was written by Charles Oscar
Waters in a letter published in the Practice of Medicine in 1842. Subsequently, George
Huntington published his paper on HD (Huntington, 1872), Punnett discovered HD to be
autosomal dominant (Punnett, 1908), the HD gene was isolated and the CAG repeat
mutation was identified (Huntington’s Disease Collaborative Research Group, 1993), a
mouse model for HD was produced (Mangiarini et al., 1996), and a high-throughput
screen was published for HD (Heiser et al., 2002). However, despite all these
advancements, a cure for HD has not been elucidated. Also, the treatments for HD that
are available “only help to alleviate some of the movement and psychiatric symptoms
associated with the pathology” (Bano et al., 2011).
Huntington’s disease (HD) is a fatal trinucleotide-repeat disorder that is
characterized by neurodegeneration, which leads to motor and cognitive impairments
(Snell et al., 1993). The motor impairments include chorea, rigidity, dystonia, and muscle
weakness (Ortega and Lucas, 2014). About 90% of HD patients will develop chorea,
which is characterized by jerky and involuntary movement of the body’s upper and lower
extremities (Kirkwood, 2001; Haddad, 1997). Rigidity is the slowing of voluntary
movements, which leads to muscle stiffness (Storey and Beal, 1993). Involuntary
movement that may lead to abnormal postures or movement, or both, characterizes
dystonia. The types of dystonia that are more prevalent among HD patients are internal
shoulder rotation, sustained fist clenching, excessive knee flexion, and foot inversion
(Louis et at., 1999). On average, HD patients develop three to four types of dystonia
1
(Louis et al., 1999).
Cognitive impairments also affect HD patients and they include subcortical
dementia, depression, mania, and suicide (Ortega and Lucas, 2014). Patients with HD
that express subcortical dementia display deficits in fronto-subcortical circuits that give
rise to a variety of cognitive deficits (Zakzanis, 1998). These cognitive deficits include
delayed recall and memory acquisition (Zakzanis, 1998). It has been observed that
emotional and cognitive changes occur about three years before motor dysfunction begins
(Ortega and Lucas, 2014).
These impairments increase in severity until the individual loses the ability to
talk, walk, or reason. Once these symptoms manifest they will progress until the patient
becomes fully dependent on others, which can affect the family emotionally, socially, and
economically (Huntington’s Disease Society of America, 2016). Huntington’s disease
does not only affect the patient, but the lives of the entire family.
Previous research has shown that 1-5 individuals out of every 100,000
worldwide will develop HD (Marshall, 2004). It is also estimated that “more than a
quarter of a million Americans have HD or are at risk of inheriting the disease from an
affected parent” (Huntington’s Disease Society of America, 2016). The severity and the
onset of HD depend on the number of CAG repeats present in the individual’s huntingtin
gene (HTT). Previous research has shown that there is a negative correlation between age
of onset and associated repeat lengths of CAG (Huntington Collaborative Research
Group, 1993). Affected individuals may have a CAG repeat number of 30 – 70 and those
with a CAG repeat number of 9 – 34 may not become affected by HD (Snell et al., 1993).
This study has also shown that the two distributions overlap slightly around 30 -34 CAG
2
repeats, concluding that interpretation of the result in this range is uncertain (Snell et al.,
1993). However, data has shown that individuals with more than 40 CAG repeats will
develop the disease in middle age and those with more than 50 CAG repeats will develop
HD as juveniles (Duyao et al., 1993).
A juvenile that develops HD, termed Juvenile Huntington’s disease (JHD),
develops the disease before the age of 20 and these young individuals develop the more
extreme form of it (Bates et al., 2014). Previous research has shown that in cases of JHD,
epilepsy (recurrent and unprovoked seizures) and myoclonus (involuntary twitching of
muscles) are more prevalent than in adult-onset HD (Seisling et al., 1997). Some
researchers have separated patients with JHD to be those who develop the disease
between the age of 11 to 20, and childhood onset HD to be those who develop the disease
at the age of 10 or younger. It is estimated that about 20% of cases of JHD develop the
disease at 10 years old or younger (Quarrell et al., 2012). Other research has shown that
more seizures have been linked to younger onset of HD and higher CAG repeats (Cloud
et al., 2012). Anticipation has been shown to be the culprit of early-onset HD.
Anticipation is described as a “phenomenon whereby a disease develops an earlier onset
or more severe symptoms, as it is transmitted through the generations” (Bates, 2005).
Anticipation in HD is acquired through the paternal lineage (Bates, 2005).
As stated previously, the treatments available only help to alleviate some of the
movement and psychiatric symptoms associated with HD pathology (Bano et al., 2011).
According to the Huntington’s Disease Society of America, the only FDA approved
treatment is Xenazine® (tetrabenazine). The mechanism for how Xenazine® exerts its
antichorea effects is not fully understood, however, it is believed to deplete monamines
3
(i.e. dopamine) from the nerve terminals (Lundbeck, 2015). Xenazine® helps in treating
the involuntary movements associated with HD. Other medications available for
individuals with HD include dopamine-depleting agents (i.e. reserpine, tetrabenazine) and
dopamine-receptor antagonists (i.e. neuroleptics) (Medscape, 2015). The dopamine
depleting drugs, specifically reserpine, have been shown to work well for other
movement disorders such as Parkinson’s disease (Charles et al., 1963). Parkinson’s
disease is a chronic and progressive disorder characterized by tremor, bradykinesia
(slowness of movement), rigidity and impaired balance and coordination (Parkinson’s
Disease Foundation, 2016). However, one of the problems with using these drugs is that
individuals with HD are more vulnerable to side effects from medications. For example,
tetrabenazine’s serious side effect is that it triggers depression and other psychiatric
conditions (Mayo Clinic, 2015). Also, neuroleptics which, are antipsychotic drugs, may
cause stiffness and rigidity over time, which may exacerbate HD neuromuscular
symptoms.
Since medication to ameliorate involuntary muscle movements leads to serious
side effects, and no cure has been found, it was proposed that epigenetics might be used
to cure Huntington’s disease. Previous research done with Drosophila models of the HD
polyglutamine disease, found that histone deacetylase inhibitors (HDAC) may slow or
prevent the progressive neurodegeneration seen in HD (Steffan et al., 2001). Steffen et al.
(2001) and colleagues observed that the use of HDAC inhibitors alleviated symptoms
observed in HD as a result of re-stabilization of gene transcription. This re-stabilization
was due to a “shift of histone acetylation equilibrium towards increased acetylation of
histones, relaxation of DNA-chromatin complexes and subsequent increase of gene
4
transcription” (Steffen et al., 2001). Thus, gene transcription may play an important role
in HD pathology. Other research done with HDAC inhibitor drugs suggests its beneficial
effects in other neurologic diseases, such as Parkinson's and Alzheimer's (Jakovcevski
and Akbarian, 2012).
Huntington's Disease: Previous Research
Huntington’s disease is an autosomal dominant inherited disease in which the
carriers will become affected (Bates et al., 2014; Punnet, 1908). It has been shown that
HD forms from a combination of increased gain-of-function of the mutant huntingtin
(mHTT) and the loss-of-function of the wild-type HTT (Bano et al., 2011). The mutant
HTT is caused by extended repeats of cytosine, adenine, and guanine (CAG) building
blocks in exon-1 of the gene encoding for huntingtin protein (Bano et al., 2011). The
Gusella laboratory successfully found the location of the HTT gene to be on the short arm
of chromosome 4 (Bates, 2005).
Other research has shown that the overexpression of mHTT leads to an increased
glutamate release from afferent neurons (Cowan et al., 2008). The CAG repeats encode
for the polyglutamine (poly Q) stretch at the N-terminus, which functions as a membrane
association signal that can lead to mHTT aggregation, nuclear entry and toxicity of the
nuclei of striatal neurons (Atwal et al., 2007). In afferent neurons, the increase in
glutamate release enhances the NMDA(N-Methyl-D-aspartate)-Receptor activity, which
leads to an intracellular Ca2+ increase (Cowan et al., 2008). The increase in intracellular
Ca2+ causes the activation of calpains, which are calcium-activated proteases that cleave
the HTT protein into a series of “proteolytic products that promote NMDA-R-mediated
5
excitotoxicity” (Cowan et al., 2008). The excitotoxicity then damages or kills the cells
when HTT proteolytic fragments accumulate and cannot be cleared.
The mHTT has been shown to accumulate in the cytoplasm of neurons axons and
nuclei. Liu et al. (2015) investigated how these mHTT fragments were negatively
impacting the neurons because this process remained unclear. Using R6/2 transgenic
mice, they found that as the motor impairment progressed, the percentage of perinuclear
and intranuclear mHTT changed, in parallel. Their findings showed that perinuclear
inclusions disrupted the nuclear envelope of striatal neurons, accompanied by re-entry
into the cell cycle, and eventual neuronal death. Research conducted by Li et al. (2001)
also showed that huntingtin aggregates formed in the axons of striatal projection neurons
lead to axonal dysfunction and degeneration in mice 11 to 27 months after birth. These
same results were also seen in cultured striatal neurons expressing mutant huntingtin.
Previous research on transgenic mice with HTT deletion has shown that HTT is
essential in mammmalian development (Nasir et al., 1995; Zeitlin et al., 1995). The
deletion of the HTT gene suppresses HTT expression, increasing apoptosis, which leads
to embryonic death (Nasir et al., 1995; Zeitlin et al., 1995). In addition, heterozygous
knockout mice have shown an increase in neuronal loss in the subthalamic nucleus and
basal ganglia, which leads to severe cognitive deficits (Nasir et al., 1995). In short, the
deleterious influence of HD on the nervous system comes about due to a loss of normal
HTT (loss of function) and the elevation of mHTT (gain of function).
Most research done on the neurodegenerative process in HD has focused on the
progressive loss of neurons in the striatum, which leads to cognitive and motor
impairments. However, it was not clear how HD influenced skeletal muscle. Recently,
6
our lab (Waters et al., 2013) investigated the membrane properties in the R6/2 transgenic
mouse model for HD. Waters et al. (2013) demonstrated that impairments in muscle
function, including alterations in muscle excitability, chloride channel function, and
chloride channel mRNA levels, were in part due to aberrant alternative splicing of Clcn1
mRNA (gene for CLC-1). The aberrant splicing resulted in an increase in exon 7A
inclusion in the chloride channel mRNA in HD mice. Exon 7a inclusion causes the
appearance of a premature stop codon resulting in non-sense mediated decay of the
mRNA. As a consequence, there was a reduction of chloride channel mRNA, which
likely result in less functional protein in the sarcolemma. At a physiological level, most
of the resting conductance in the skeletal muscle is mediated by chloride through the
muscle chloride channel so the reduction of the functional protein results in involuntary
and prolonged skeletal muscle contractions due to hyperexcitability of the sarcolemma.
Also, the decrease in resting of chloride and potassium conductance may account for the
self-triggering of contraction in the diseased muscle fibers. From this data, it was
concluded that the action potential in R6/2 transgenic mice was more easily triggered and
sustained than those of the WT mice.
Alternative Splicing
The central dogma of molecular biology is the flow of information from DNA to
RNA to proteins. This is a two-step process that involves transcribing the original strand
of DNA into a messenger RNA (mRNA) and then translating the mRNA into a protein.
Transcription takes place in the nucleus of the cells. The template strand of DNA is read
by RNA polymerase, which unwinds the double-stranded DNA, and matches the DNA
7
template with the complementary RNA nucleotide. As the RNA polymerase moves down
the DNA, the RNA polymerase joins the incoming RNA nucleotide to one already joined
on the DNA strand producing a pre-mRNA. In eukaryotes, such as humans, the premRNA requires three processing reactions before it can be converted to a mature mRNA
and then translated. A 5’-cap is added to the 5’ end of the RNA, which consists of 7methylguanylate (m7G) bonded to three phosphate groups. At the 3’ end of the premRNA, a 3’- poly A tail is added. The 5’-cap serves to initiate translation and the 3’-poly
A tail protects the mRNA strand from being degraded, extending the life of the mRNA,
and thus, increasing the number of times a single mRNA molecule can be translated. The
pre-mRNA transcript also contains exons (coding regions) and introns (non-coding
regions). The introns are cleaved out of the pre-mRNAs by a process known as splicing,
which produces the final mRNA (absent of introns). Alternative splicing allows the
primary RNA transcript to generate different combinations of exons, in order to produce
different mature mRNAs and different proteins.
Alternative splicing of pre-mRNAs is essential for producing multiple RNAs and
protein isoforms from a single DNA segment. However, errors in alternative splicing may
arise, causing various diseases that either have a polymorphism or a deleterious mutation.
One such disease is Huntington’s disease, which is a multisystemic disorder.
Animal Models of HD
A genetic mouse model that has been widely used is the R6/2 transgenic mouse
model of HD. R6/2 transgenic mice are the most widely used animal model to study the
pathogenesis of HD and they express a transgene, which includes exon 1, of the human
8
HTT gene with approximately 150 CAG repeats (Mangiarini et al., 1996). The R6/2
transgenic mouse line has the progressive phenotype and expresses the expanded CAG
trinucleotide repeat in exon 1 of the human huntingtin gene in skeletal muscle and
represents a model of early onset HD (Mangiarini et al., 1996). The mice used in this
study ranged between 10-13 weeks old and fully expressed the progressive phenotype of
HD.
Carter et al. (1999) made strides in studying the behavioral phenotype of the R6/2
mouse line in order to understand its relevance and usefulness as a progressive model of
HD. They observed R6/2 transgenic mice to display motor deficits at 5 weeks old that
slowly worsened until 12-13 weeks. The motor deficits observed included “irregular gait,
resting tremor, stereotypical grooming, abrupt and irregularly timed shuddering
movements, occasional epileptic seizures, and body weight loss” (Carter et al., 1999).
The development and progression of these motor deficits are similar to those experienced
by HD patients. Five tests were conducted using R6/2 transgenic mice and WT in order to
assess the neurological consequences of the R6/2 transgene expression. These tests
included a swimming tank to observe the abnormalities in swimming, beam walking to
compare fine motor skills, the rotarod for motor coordination and balance, footprint test
to assess gait abnormalities, and prepulse inhibition of the acoustic startle response to
evaluate motor reflex responses to noise stimulus. These tests were initiated at 5 – 6
weeks of age, retested at 8 – 9 weeks of age, and then weekly thereafter. Their data
supported the use of R6/2 transgenic mice as a model for understanding the pathologies
associated with HD and as a model to evaluate therapeutic strategies.
9
Myotonic Dystrophy
There are two types of myotonic dystrophy (DM): Type 1 and Type 2. The most
common type of DM is type 1. Like HD, myotonic dystrophy 1 (DM1) is a trinucleotiderepeat disorder characterized by myotonia, progressive muscle weakness, cataracts,
insulin resistance and cardiac conduction defects (Kimura et al., 2005). Myotonia is a
predominant characteristic of DM1 and is associated with an impairment of muscle
relaxation after muscle contraction (Charlet-B et al., 2002). Affected individuals may
walk with a stiff and awkward gait.
Patients with DM1 are subdivided into four subtypes which include Mild/late
onset/assymptomatic, classic, childhood onset, and congenital (Turner and Hilton-Jones,
2010). The clinical signs of mild/late onset/assymptomatic phenotype include cataracts
and mild myotonia; those with classic phenotype include weakness, myotonia, cataracts,
conduction defects, insulin insensitivity, balding, and respiratory failure; those with the
childhood onset phenotype display facial weakness, myotonia, psychosocial problems,
low IQ, conduction defects; those with congenital phenotype display infantile hypotonia
(low muscle tone involving reduced muscle strength), respiratory failure, learning
disability, and cardiorespiratory complications after 40 years of age (Turner and HiltonJones, 2010). About 3-15 individuals per 100,000 of European descent will be afflicted
by DM1 (Harper, 2001).
Previous research has shown that DM1 is an autosomal inherited disease that is
caused by extended repeats of cytosine, thymine, and guanine (CTG) in the 3’
untranslated region (UTR) of the myotonic dystrophy protein kinase (DMPK) which
codes for a protein kinase found in skeletal muscles (Brook et al., 1992; Harris et al.,
10
1996). The DMPK gene is located on chromosome 19 (Brook et al., 1992; Harris et al.,
1992). The repeat size of CTG correlates more with age of onset and severity of the
disease below 400 CTG repeats than CTG repeats above 400 (Gharenhbaghi-Schnell et
al., 1998; Hamshere et al., 1999). This difference in correlation between phenotype and
repeat size may be due to somatic instability in mitotic and post-mitotic tissues (Turner
and Hilton-Jones, 2010).
Normal individuals have a CTG repeat between 5 and 37, and assymptomatic
individuals have a CTG repeat between 38 and 49, but have an elevated risk of having
children with a larger, expanded CTG repeat (Turner and Hilton-Jones, 2010; Martorell et
al., 2001). Patients with DM1 have a CTG repeat from 50 to 4000. Interestingly, some
individuals with 60 repeats and some individuals with up to 500 repeats are
assymptomatic into middle age (Turner and Hilton-Jones, 2010). Childhood onset of
DM1 occurs in children under the age of 10 and display a 50-1000 CTG repeat; those
with more than 1000 CTG repeats have an age of onset at birth (Turner and Hilton-Jones,
2010). These children, with congenital DM1, inherit the expanded mutant DMPK allele
from the mother, as opposed to Huntington’s disease, where the anticipation is through
the paternal lineage (Turner and Hilton-Jones, 2010; Bates, 2005).
To date, there is no cure for DM1 and there are no specific treatments for DM1.
There are, however, treatments for individuals who develop cataracts or heart problems
as a consequence of DM1.
11
Myotonic Dystrophy: Aberrant Alternative Splicing
Chloride Channel (CLCN1)
In the skeletal muscle, the chloride channels function to help stabilize the muscle
cell’s resting membrane potential. Research conducted by Charlet-B. et al. (2002) has
shown that individuals with DM1 show an elevation of aberrant alternative splicing of
multiple genes. One of these is the chloride channel (CLCN1). Aberrant regulation of
Clcn1 pre-mRNA splicing leads to an elevation of exon 7A inclusion in Clcn1 mRNA
and a decrease in full-length Clcn1 mRNA expression and a comensurate reduction in
Clcn1 function (Charlet-B. et al., 2002), resulting in hyperexcitability of the skeletal
muscles.
Insulin Receptor (INSR)
The insulin receptor is a membrane receptor associated with insulin-stimulated
glucose uptake. Santoro et al. (2013) also found aberrant alternative splicing in the
insulin receptor gene (INSR) of skeletal muscles from DM1 patients. The INSR gene
encodes for two alternatively spliced isoforms (IR-A and IR-B). These two alternatively
spliced variants are produced normally, however, individuals with DM1 display a relative
increase in IR-A (predomintes in embryonic tissue) versues IR-B (highly expressed in
adult skeletal muscle, liver, and adipose tissues). An elevation of IR-A, for individuals
with DM1, result in development of insulin resistance at a greater average than those
without DM1.
12
Sarco(endo)plasmic reticulum Ca2+-ATPase pump (SERCA1)
Individuals with DM1 also show an elevation of aberrant alternative splicing of
the sarco(endo)plasmic reticulum Ca2+-ATPase pump (SERCA1) (Zhao et al., 2015).
SERCA1 functions as a pump that transports calcium ions from the sarcoplasm into the
sarcoplasmic reticulum allowing for muscle relaxation. There are two alternatively
spliced variants of SERCA1. SERCA1a is found primarily in adult fast-twitch muscle
and SERCA1b is found in developing (neonatal) muscles. Hino et al. (2007) found that
SERCA1b excluded exon 22 in skeletal muscles of DM1 patients. In addition, Zhao et al.
(2015) and colleagues found that SERCA1b was overexpressed in DM1 patients. Since
the Ca2+ uptake activity of SERCA1a (adult fast SERCA) was almost double that of
SERCA1b (developmental SERCA), DM1 patients have a lower Ca2+ uptake capacity,
accounting for the abnormal intracellualar Ca2+ homeostasis, in DM1 skeletal muscles.
Skeletal Muscle
Skeletal Muscle Composition
The skeletal muscle is composed of muscle fibers (muscle cells), which are long,
cylindrical and multinucleated. The skeletal muscle fibers are unique in that they develop
from myoblasts (embryonic cell that develops into a muscle cell). Each muscle fiber is
composed of many myofibrils. The myofibrils are themselves composed of many
myofilaments. It is the myofibril’s sarcomere composition that give the muscle fiber the
unique striation. Myofibrils are bundles of protein filaments and there are two types of
myofilaments, which are thin filaments (which contain actin) and thick filaments (which
contain myosin).
13
Figure 1. Sarcomere of the skeletal muscle.
Each myofibril is composed of more than ten thousand sarcomeres (repeating
functional unit of the myofibril) placed in series. One sarcomere runs the length from one
Z line to another Z line (Figure 1) (Dzialowski, 2016). The Z line is a network of proteins
and it is where the thin myofilaments are anchored in the sarcomere. The sarcomere is
composed of A bands (dark bands) and I bands (light bands). The A band is formed by
both the thin and thick filaments and the I bands are composed of thin filaments only.
The section of the sarcomere that only contains myosin is called the H zone (an area with
no thin filament overlap at the middle of the sarcomere). The M line is located in the
middle of the H zone and it is a network of proteins to which the thick filaments attach.
The sarcolemma is the cell membrane of the muscle fiber that covers the
sarcoplasm (cytoplasm of striated muscle cells). It gives rise to transverse tubules (ttubules). The sarcolemma contains many ion channels and pumps that function to
maintain the negative resting membrane potential of the muscle fibers (Hopkins, 2006).
The resting membrane potential of skeletal muscles is close to -90 mV and receives a
14
significant contribution from Cl- conductance (Hopkins, 2006). If the Cl- current is not
able to maintain the resting membrane potential, “the muscle would not repolarize
sufficiently to regenerate the active state of the channels responsible for generation of
succeeding action potentials” (Hopkins, 2006).
Skeletal Muscle Contraction
Contraction of the skeletal muscles is essential for locomotion, posture,
respiration, and facial expression, among other functions. Voluntary movement of
skeletal muscles is possible through innervation by somatic motor neurons. The motor
neurons stimulate the muscle fibers to contract at the neuromuscular junction. The
neuromuscular junction is composed of the motor end plate of the muscle and the axon
terminal of the neuron. Located within the axon terminal are synaptic vesicles that
contain and release the neurotransmitter acetylcholine when an action potential reaches
the axon terminal. The motor endplate of the muscle, a small portion of the sarcolemma,
contains acetylcholine receptors. Upon release from the nerve terminal, the acetylcholine
will travel across the synaptic cleft and bind to the acetylcholine receptors at the motor
end plate.
Once acetylcholine binds to the acetylcholine receptors, a gate within the receptor
opens and the sodium channel pore of the receptor opens allowing sodium ion influx.
Thus, the receptors are ligand-gated sodium channels. The sodium influx causes an
increase of the membrane potential, known as depolarization, above the threshold value
of -55mV, which in turn causes voltage-gated Na+ channels to open, leading to an action
potential of the muscle cell. Afterwards, the sodium channels self-deactivate and voltage-
15
gated potassium channels open. This leads to a rush of potassium ions out of the cell,
down its electrochemical gradient. As a result, the membrane potential decreases
(repolarization), when the voltage-gated potassium channels are open and the membrane
potential approaches the resting membrane potential (hyperpolarization). The Na+/K+
pumps help to restore the membrane potential as acetylcholine is broken down by acetyl
cholinesterase. This enables the acetylcholine receptors to respond to another neuronal
stimulus.
The action potential then travels throughout the sarcolemma and enters the ttubule allowing the action potential to travel further into the muscle cell’s interior. The
action potential in the t-tubules communicates with the sarcoplasmic reticulum (SR),
leading to a release of calcium ions from the SR into the sarcoplasm. When the msucle is
not contracting, calcium ions are stored in the SR. The calcium ions will then bind to
troponin on the thin filament, troponin changes conformation, moving tropomyosin
which exposes the binding site for myosin on actin allowing for cross-bridge formation (a
direct binding of the myosin head to actin on the thin filament). Contraction of the muscle
soon follows as the myosin head begins the cross-bridge cycle. Contraction occurs as the
acto-myosin cross-bridges pull actin filaments towards the center of the sarcomere. This
action is caused by the power stroke, which generates the force of contraction. The crossbridge cycle continues as ATP binds to the myosin head causing detachment of the
myosin heads from actin and ATP hydrolysis resets the heads for another cross-bridge
cycle. If the action potentials cease, the calcium ions are transported, via active transport,
back into the SR via the SERCA pump. As Ca2+ dissociates from troponin, tropomyosin
restores actin active site blockage, and the muscle fiber relaxes.
16
Muscle Proteins
Titin (TTN)
Titin is a central sarcomeric protein that connects the thick filament to the Z-line
(see Figure 1). Physiologically, it helps regulate the stiffness and elasticity of the skeletal
muscle fibers (Wang et al., 1991). Titin functions as a spring to prevent over-stretch of
the sarcomere. There are three alternatively spliced isoforms, for the purpose of this
study, they include Titin-L, Titin-M, and Titin-S. Shorter titin isoforms result in a stiffer
spring-mecahnsim. An example of TTN dysfunction is tibial muscular dystropohy, which
is an autosomal late-onset distal myophaty, characterized by weakness and atrophy,
which are similar symptoms found in HD patients.
Z-line associated protein (ZASP)
The ZASP (Z-line associated protein) is a Z-line associated protein that helps
stabilize the sarcomere during contraction. There are multiple splice variants. These
multiple splice variants make it possible for ZASP to interact with alpha actinin,
myotilin, and other Z-line proteins (Lin et al., 2014). The Z-line is important in
maintaining the structural integrity of the sarcomere and in cases where a mutation arises
in ZASP, such as in zaspopathy, actin disruption follows. Zaspopathy is an autosomal
dominant myofibrillar myopathy with mutations in titin, dysferlin, GNE (UDP-Nacetylglucosamine 2-epimerase/N-acetylmannosamine kinase), desmin and myosin
(Griggs et al., 2007).
17
Troponin T3 (TNNT3)
Troponin T is part of the troponin complex (Troponin C, Troponin T, and Tropnin
I). Troponin T binds tropomyosin and modulates the Ca2+-induced activation of the thin
filament. Troponin T3 aids in skeletal muscle contraction and studies by Ju et al. (2013)
show that troponin T3 is expressed not only in skeletal muscles, but smooth muscles
located in the aorta, bronchus and bladder. They concluded that this protein is important
for normal growth and breathing for postnatal survival. In addition, skeletal muscles do
not include Fetal Exon, as shown in DM studies conducted by Hao et al. (2008).
Alpha Actinin 1 (ACTN1)
Alpha actinin 1 helps anchor the myofibrillar actin filaments to the Z-line and it’s
an important participant in muscle contraction. The sarcomeric Z-line functions by
linking “titin and actin filaments from opposing sarcomere halves in a lattice connected
by alpha-actinin” (Young et al., 1998). Mammals, such as humans, have four α-actinin
encoding genes (ACTN1, ACTN2, ACTN3, and ACTN4). ACTN1 was studied for the
purpose of this experiement. Actinins are important for muscle contraction, and
disruption of its normal function may lead to muscle disorder such as Hereditary
Inclusion Body Myopathy (Amsili et al., 2008). Previous studies have shown
alternatively spliced mRNAs of ACTN1 (Suzuki et al., 2012; Murphy and Young, 2015).
There are two alternatively spliced isoforms, for the purpose of this study, they include
Titin-L and Titin-S.
18
Thesis Objectives
Since the trinucleotide CAG encodes for glutamine during translation, the CAG
repeats encode for the polyglutamine, poly Q (Q is the single letter amino acid code for
glutamine), regions at the N-terminus (exon 1) of the huntingtin gene. The poly-Q
regions appear to cause mutant huntingtin (mHTT) protein misfolding, aggregation,
nuclear entry and toxicity to the nuclei of striatal neurons (Atwal et al., 2007). In
addition, the poly-Q causes miss-splicing of mHTT resulting in the production of toxic
N-terminal fragments (Gipson et al., 2013). Up until now, minimal research has been
conducted to determine the cellular mechanism by which mHTT causes muscle
dysfunction. As stated previously, the data from Waters et al. (2013) are reminiscent of
DM, in which skeletal muscles have dramatic debilitations in the regulation of premRNA splicing due to the CUG trinucleotide expansion in the DMPK gene (Brook et al.,
1992; Fu et al., 1992; Mahadevan et al., 1992). HD is associated with a CAG
trinucleotide expansion and R6/2 mice (mouse model of HD) have miss-splicing of the
CLCN1 gene, similar to the aberrant splicing defects that occur with DM. Therefore, this
study proposes to investigate the changes in pre-mRNA splicing in multiple muscles of
R6/2 mice for several genes that are known to be aberrantly spliced in DM1, and may be
aberrantly spliced in HD (Charlet-B. et al., 2002; Santoro et al., 2013). These genes
include the chloride channel (CLCN1), insulin receptor (INSR), sarco(endo)plasmic
reticulum Ca2+- ATPase pump (SERCA1), titin protein (TTN), troponin (TNNT3), alpha
actinin 1 (ACTN1), and Z-line associated protein (ZASP).
19
Study Questions
Two questions to be addressed in this study are: Is Huntington’s disease also
associated with aberrant alternative splicing of multiple genes? Are different skeletal
muscles similarly affected by aberrant alternative splicing of multiple genes?
Hypotheses
We hypothesized aberrant alternative splicing of multiple genes such as TTN,
INSR, SERCA1, TNNT3, ACTN1, and ZASP would occur in R6/2 muscles compared to
WT. We also hypothesized that different skeletal muscles would be differentially affected
by aberrant alternative splicing of CLCN1, INSR, SERCA1, TTN, TNNT3, ACTN1, and
ZASP.
20
MATERIALS AND METHODS
Animal Model
The R6/2 [B6CBA-Tg(HDexon1)62Gbp/13 hemizygous] transgenic mouse model
was used as a model system to study the influence of HD on muscle gene splicing. The
R6/2 mouse has the progressive phenotype associated with HD and expresses the
expanded CAG trinucleotide repeat in exon 1 of the human huntingtin (HTT) gene
observed in human HD patients and represents a model of early onset HD (Mangiarini et
al., 1996). The R6/2 transgenic mouse is the most widely used animal model to study the
pathogenesis of HD. R6/2 mice express a transgene which includes exon 1 of the human
huntingtin gene containing approximately 150 CAG repeats (Mangiarini et al., 1996).
Specifically, R6/2 diseased mice are hemizygous for the transgene. Wild-type litter mates
do not have the transgene and were used as controls. In the R6/2 diseased mice the
transgene is expressed in skeletal muscle (Mangiarini et al., 1996). The mice used in this
study ranged between 10 – 13 weeks of age, fully expressed the progressive phenotype of
HD and represent late-stage HD mice.
In order to analyze CLCN1, INSR, SERCA1, TTN, TNNT3, ACTN1, and ZASP
gene splicing we obtained 12 HD and 12 WT tibialis anterior (TA) muscle samples, 6
HD and 7 WT pooled soleus (Sol) muscle samples, 5 HD and 5 WT diaphragm (Dia)
muscle samples, and 3 HD and 3 WT interosseous (IO) muscle samples. Because of the
small size of the mouse Sol (~10 mg), three Sol muscles were pooled together to generate
one pooled sample. For example, 3 HD Sol muscles were pooled together to make
Sample A. Sample A accounted for one Sol sample overall.
21
The muscles were removed from euthenized mice in accordance with institutional
animal care and use practices (Cal Poly Animal use protocol #13.017). Specifically, the
mice were euthenized by exposure to a euthanizing dose of isoflurane followed by
cervical dislocation. The muscles listed above were dissected from the mice, and frozen
in liquid nitrogen. The frozen muscles were stored at -80° C until analyzed. The four
different skeletal muscle samples used are of different fiber phenotypes and allow for an
assessment of the influence of fiber phenotype on susceptibility to HD-pathology. The
TA is glycolytic and composed primarily of Type 2 or fast-twitch fibers (mostly Type
2b), and is used for dorsiflexion of the leg. The Sol is oxidative and is composed largely
of Type 1 or slow-twitch fibers, and is used for plantar flexion (walking and running).
The Dia is highly oxidative and composed largely of Type 2 (mostly type 2x, with high
amounts of type 1) fibers, and is a constantly active respiratoy muscle. The IO muscle is
oxydative and composed primarily of Type 2 (mostly type 2a) fibers, and are useful for
controlling the toes by adducting the digits.
Experimental Procedures
RNA Isolation
RNeasy Fibrous Tissue Mini Kits (Qiagen) were used to isolate RNA from each
skeletal muscle sample. Each frozen muscle was placed in a 5 mL beaker and submerged
into 300 µl of a cell lysis buffer. The samples were then minced with scissors. Then, 590
µl RNase free H2O and 10 µl Protenase K was added to each skeletal muscle sample. The
samples were then homogenized and transferred to a centrifuge tube and incubated for 10
minutes at 55° F to digest myofibrillar protein components. The samples were then
centrifuged at 10,000 RCF (g) for 10 minutes and the supernatant, containing RNA, was
22
transferred to a new centrifuge tube. Fifty µl of 100% ethanol was added to each tube and
inverted. Afterwards, the samples were applied to a nucleic acid binding column and
centrifuged for 27 seconds at 8,000 RCF (g). Both RNA and DNA bind to the column.
The flow through was discarded. A Wash Buffer (300 µl) was added to the column.
DNase was applied to each column and incubated for 10 minutes at room temperature to
digest any DNA in the column. Again, Wash Buffer (350 µl) was added to each column
and centrifuged for 27 seconds at 8,000 RCF (g). The flow-through was discarded and
RPE buffer (500 µl) was added to each column and centrifuged for 27 seconds at 8,000
RCF. The flow-through was discarded and then 500 µl of 80% ethanol was added to
each column and centrifuged for 2 minutes at 8,000 RCF (g) and the flow-through was
discarded. Then, 20 µl of RNase free water was added to each column and centrifuged for
1 minute at 22,000 RCF (g). The final step eluted the bound RNA from the column. The
isolated RNA was stored frozen at -20°C.
RNA Quantification and Dilution
A 1:200 dilution of the isolated RNA was made using sterile filtered PBS by
adding 597 µl of sterile filtered PBS and 3 µl of RNA to each corresponding tube sample.
A Bio-Ras SmartSpec 300 was used to read the A260 and A280 in order to assess the purity
and concentration of RNA in each sample. Only samples with an A260 /A280 above 1.7
were used for analysis.
23
Splicing Analysis
In order to analyze splicing of CLCN1, TTN, INSR, SERCA1, TNNT3, ACTN1,
and ZASP first cDNAs were synthesized with Superscript III reverse transcriptase
(Invitogen) using random primers. The PCR conditions for each gene mentioned above
are noted in Table 1. To assess splicing patterns, PCR reactions were performed using
specific primer pairs for each gene (Table 2).
Table 1. PCR conditions.
Gene
Annealing Temperature
Number of Cycles
CLCN1
52.0° C
30
INSR
60.0° C
32
SERCA1
52.0° C
27
TTN
52.0° C
27
TNNT3
52.0° C
27
ACTN1
52.0° C
27
ZASP
52.0° C
27
One µl of cDNA was added for each PCR reaction. See Table 1 for specific PCR
conditions and Table 2 for primer sequences. Following PCR, the PCR products were
separated using 2% Tris,borate,EDTA (TBE) agarose gels (CLCN1 and INSR) and 1.5%
TBE agarose gels (SERCA1, TTN, TNNT3, ACTN1, and ZASP). The gels were stained
24
with ethidium bromide and quantified using a FluorChem SP (Alpha Innotech) and UVtransilluminate, the splicing products were quantified in order to calculate the percentage
of each splice variant.
Table 2. Primer Conditions
Gene
Exon
Primer Sequence (5’ – 3’)
Inclusion/Exclusion
CLCN1
INSR
SERCA1
TTN
TNNT3
ACTN1
ZASP
F: GGAATACCTCACACTCAAGGCC
R: CACGGAACACAAAGGCACTGAATGT
F: CCTTCGAGGATTACCTGCAC
R: TGTGCTCCTCCTGACTTGTG
F : GCTCATGGTCCTCAAGATCTCAC
R: GGGTCAGTGCCTCAGCTTTG
F: GTGTGAGTCGCTCCAGAAACG
R: CCACCACAGGACCATGTTATTC
F: TCTGACGAGGAAACTGAACAAG
R: TGTCAATGAGGGCTTGGAG
F: CGCCTCTTTCAACCACTTTG
R: TCATGATTCGGGCAAACTCT
F: GGAAGATGAGGCTGATGAGTGG
R: TGCTGACAGTGGTAGTGCTCTTTC
Exon 7a
Exon 11
Exon 22
Exon 5 and Exon 45
Fetal (F) Exon
Exon SM and Exon
19a
Exon 10 and Exon 11
Genes of Interest
The genes for analysis were chosen based on previous data suggesting they are
miss-spliced in DM, which shows some similarity to HD (Table 2).
25
Statistical Methods
HD and WT control samples were used and a two-tailed t-test was conducted to
test for the significance between the graphs (the p-value was set at 0.05). Error bars were
reported as standard error of mean.
26
RESULTS
Chloride Channel (CLCN1)
The TA muscle showed an elevation in aberrant alternative splicing as evidenced
by an increase in exon 7a inclusion in late-stage R6/2 mice (Miranda et al., 2016). In this
study, we found that the Sol and Dia from R6/2 mice did not show significant elevations
in exon 7a inclusion, but the IO did (p < 0.05) in agreement with Waters et al. (2013)
(Figures 2 and 3).
27
A
B
C
Figure 2. Gel showing Clcn1 mRNA splicing that contains exon 7a (exon 7a+) and normal adult
Clcn1 mRNA that lack exon 7a (exon 7a-) (A) Gel showing spliced Clcn1 mRNA in HD (n = 6)
compared to WT (n = 7) Sol muscle (B) Gel showing spliced Clcn1 mRNA in HD (n = 5)
compared to WT (n = 5) Dia muscle (C) Gel showing aberrantly spliced Clcn1 mRNA in HD (n =
3) compared to WT (n = 3) IO muscle.
28
A
B
25.0
% Exon 7A Inclusion
% Exon 7A Inclusion
25.0
20.0 15.0 10.0 5.0 0.0
WT
20.0 15.0 10.0 5.0 0.0
HD
WT
HD
% Exon 7A Inclusion
C
12.0
*
9.0
6.0
3.0
0.0
WT
HD
Figure 3. Expression of Clcn1 mRNA (A) Alternatively spliced Clcn1 mRNA expressed at a similar
proportional level in HD (n = 6) compared to WT (n = 7) Sol skeletal muscle. (B) Alternatively
spliced Clcn1 mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5)
Dia muscle (C) Aberrantly spliced Clcn1 mRNA expressed at a higher proportional level in HD (n =
3) compared to WT (n = 3) IO muscle. Error bars were reported as standard error of mean.
*Significant difference of HD compared to WT muscle (p < 0.05)
29
Insulin Receptor (INSR)
The TA muscle showed an elevation in aberrant alternative splicing as evidenced
by a decrease in IR-B in late-stage R6/2 mice (McKee, unpublished). In this study, we
found that the Sol and Dia from R6/2 mice did not show a significant decrease in IR-B,
but the IO did (p < 0.05) (Figures 4 and 5).
30
A
IR-B (exon 11+)
IR-A (exon 11-)
B
IR-B (exon 11+)
IR-A (exon 11-)
C
IR-B (exon 11+)
IR-A (exon 11-)
Figure 4. Gel showing INSR mRNA splicing that contains IR-B isoform (exon 11a+) and IR-A
isoform (exon 11-) (A) Gel showing spliced INSR mRNA in HD (n =6) compared to WT (n = 7)
Sol muscle (B) Gel showing spliced INSR mRNA in HD (n = 5) compared to WT (n = 5) Dia
muscle (C) Gel showing aberrantly spliced INSR mRNA in HD (n = 3) compared to WT (n = 3)
IO muscle.
31
B
Relative mRNA abundance
Relative mRNA Abundance
A
50.0 40.0 30.0 20.0
10.0
0.0
WT
HD
50.0 40.0 30.0 20.0 10.0 0.0 WT
HD
Relative mRNA Abundance
C
60.0 *
45.0
30.0
15.0
0.0
WT
HD
Figure 5. Expression of INSR mRNA (A) Alternatively spliced IR-B mRNA expressed at a similar
proportional level in HD (n = 6) compared to WT (n = 7) Sol muscle. (B) Alternatively spliced IR-B
mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5) Dia muscle
(C) Aberrantly spliced IR-B mRNA expressed at a higher proportional level in HD (n = 3) compared
to WT (n = 3) IO muscle. Error bars were reported as standard error of mean. *Significant difference
of HD compared to WT muscle (p < 0.05)
32
Sarco(endo)plasmic reticulum Ca2+-ATPase Pump (SERCA1)
In this study, we also found that the TA, Sol, and Dia from R6/2 mice showed
100% inclusion of SERCA1a (exon 22+), but no significant elevations in SERCA1a
when compared to WT (Figure 6). Interestingly, the IO from R6/2 mice showed 100%
exclusion of SERCA1b (exon 22-), but did not show significant differences when
compared to WT (Figure 6).
33
A
SERCA1a
(Exon 22+)
B
SERCA1a
(Exon 22+)
C
SERCA1a
(Exon 22+)
D
SERCA1b
(Exon 22-)
Figure 6. Gel showing SERCA1 mRNA splicing isoforms with exon 22 inclusion (SERCA1a) and
exon 22 (SERCA1b) exclusion (A) Gel showing 100% inclusion, SERCA1a, in HD (n =12)
compared to WT (n = 12) TA muscle (B) Gel showing 100% inclusion, SERCA1a, in HD (n = 6)
compared to WT (n = 7) Sol muscle (C) Gel showing 100% inclusion, SERCA1a, in HD (n = 5)
compared to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion, SERCA1b, in HD (n = 3)
compared to WT (n = 3) IO muscle.
34
Titin (TTN)
In this study, the TA muscle showed significant elevations in TTN-L (exon 5+
and exon 45+) in late-stage R6/2 mice (p < 0.001) (Figures 7 and 8). Also, the Sol of
R6/2 mice showed 100% inclusion of TTN-L, but no significant differences when
compared to WT (Figure 7). We also found that the Dia and IO from R6/2 mice did not
show a significant difference for TTN-L when compared to WT (Figures 8).
35
A
TTN-L (Exon 5+, 45+)
TTN-M (Exon 5+, 45-)
TTN-S (Exon 5-, 45+)
B
TTN-L (Exon 5+, 45+)
C
TTN-L (Exon 5+, 45+)
TTN-S (Exon 5-, 45+)
D
TTN-L (Exon 5+, 45+)
TTN-S (Exon 5-, 45+)
Figure 7. Gel showing TTN mRNA splicing (A) Gel showing three spliced variants for TTN
mRNA in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing TTN-L 100%
inclusion in HD ( (n = 6) compared to WT (n = 7) Sol muscle (C) Gel showing two spliced TTN
mRNA in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing two spliced variants
for TTN mRNA in HD (n = 3) compared to WT (n = 3) IO muscle.
36
B
75.0 Relative mRNA Abundance
Relative mRNA Abundance
A
*
60.0 45.0 30.0 15.0 0.0 WT
HD
100.0 80.0 60.0 40.0 20.0 0.0
WT
HD
Relative mRNA Abundance
C
100.0
80.0
60.0
40.0
20.0
0.0
WT
HD
Figure 8. Expression of TTN mRNA (A) Aberrantly spliced TTN-L mRNA expressed at a higher
proportional level in HD (n = 12) compared to WT (n = 12) TA muscle. (B) Alternatively spliced
TTN-L mRNA expressed at a similar proportional level in HD (n = 5) compared to WT (n = 5)
Dia muscle (C) Alternatively spliced TTN-L mRNA expressed at a similar proportional level in
HD (n = 3) compared to WT (n = 3) IO muscle. Error bars were reported as standard error of
mean. *Significant difference of HD compared to WT muscle (p < 0.05)
37
Troponin T3 (TNNT3)
In this study, we found that the TA, Sol, Dia, and IO from R6/2 mice showed
100% exclusion of Fetal exon for TNNT3, but did not show a significant difference when
compared to WT mice (Figure 9).
38
A
TNNT3
(Fetal Exon -)
B
TNNT3
(Fetal Exon -)
C
TNNT3
(Fetal Exon -)
D
TNNT3
(Fetal Exon -)
Figure 9. Gel showing spliced TNNT3 mRNA (A) Gel showing 100% exclusion of Fetal exon in
HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing 100% exclusion Fetal exon in
HD ( (n = 6) compared to WT (n = 7) Sol muscle (C) Gel showing 100% exclusion of Fetal exon
in HD (n = 5) compared to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion of Fetal
exon in HD (n = 3) compared to WT (n = 3) IO muscle.
39
Alpha Actinin 1 (ACTN1)
In this study, we found that the TA, Dia, and IO showed 100% exclusion of exon
SM and inclusion of exon 19 (Figure 10). The Sol showed two spliced variants for
ACTN1 (Figure 11). The TA, Sol, Dia, and IO from R6/2 mice did not show significant
differences when compared to WT mice (Figures 10 and 11).
40
A
ACTN1-S
(Exon SM-, 19a+)
B
ACTN1-L
(Exon SM+, 19a+)
ACTN1-S
(Exon SM-, 19a+)
C
ACTN1-S
(Exon SM-, 19a+)
D
ACTN1-S
(Exon SM-, 19a+)
Figure 10. Gel showing spliced ACTN1 mRNA (A) Gel showing 100% exclusion of SM and 100%
inclusion of exon 19 in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing two
spliced variants of ACTN1 mRNA splicing in HD ( (n = 6) compared to WT (n = 7) Sol muscle
(C) Gel showing 100% exclusion of SM and 100% inclusion of exon 19 in HD (n = 5) compared
to WT (n = 5) Dia muscle (D) Gel showing 100% exclusion of SM and 100% inclusion of exon 19
in HD (n = 3) compared to WT (n = 3) IO muscle.
41
Relative mRNA Abundance
30.0
20.0
10.0
0.0
WT
HD
Figure 11. Expression of ACTN1 mRNA splicing. ACTN1 mRNA splicing showing the expression
of ACTN1-S in HD (n=3) was expressed at similar proportional levels when compared to WT
(n=2) Sol muscle.
42
Z-line associated protein (ZASP)
In this study, we found that the TA and IO showed 100% exclusion of exon 10
and exon 11 (Figure 12). The Sol showed two spliced variants of ZASP, while Dia
showed three spliced variants of ZASP (Figure 12). The TA, Sol, Dia, and IO from R6/2
mice did not show significant differences when compared to WT mice (Figure 13).
43
A
ZASP-S (Exon 10-,
11-)
B
ZASP-L
(Exon 10+, 11+)
ZASP-S (Exon 10-,
11-)
C
ZASP-L
(Exon 10+, 11+)
ZASP-M (Exon 10-,
11+)
ZASP-S (Exon 10-,
11-)
D
ZASP-S (Exon 10-,
11-)
Figure 12. Gel showing ZASP mRNA splicing (A) Gel showing 100% exclusion of exon 10 and
exon 11 in HD (n =12) compared to WT (n = 12) TA muscle (B) Gel showing two spliced variants
of ZASP mRNA splicing in HD (n = 2) compared to WT (n = 2) Sol muscle (C) Gel showing three
spliced variants of ZASP mRNA splicing in HD (n = 5) compared to WT (n = 5) Dia muscle (D)
Gel showing 100% exclusion of exon 10 and exon 11 in HD (n = 3) compared to WT (n = 3) IO
muscle.
44
B
20.0
Relative mRNA Abundance
Relative mRNA Abundance
A
15.0
10.0 5.0 0.0 WT
HD 12.0 9.0 6.0 3.0 0.0
WT
HD
Figure 13. Expression of ZASP mRNA. (A) ZASP-L mRNA expressed at similar level in HD (n =
2) compared to WT (n = 2) Sol muscle. (B) ZASP-L mRNA expressed at a similar proportional
level in HD (n = 5) compared to WT (n = 5) Dia muscle.
45
DISCUSSION
The main objective of this study was to determine if Huntington’s disease (HD) is
associated with aberrant alternative splicing of multiple genes. Previous studies from our
lab showed defects in skeletal muscle chloride channel expression were in part due to
aberrant alternative processing of Clcn1 mRNA (Waters et al., 2014). In R6/2 transgenic
mice, the level of Clcn1+7a (exon7a inclusion) was elevated (Waters et al., 2013; Charlet
et al., 2002). Miranda et al. (2016) also found an increase in the level of Clcn1+7a in TA
R6/2 transgenic mice, indicating an increase in aberrant alternative splicing of Clcn1
mRNA (Table 3). As a result muscle defects developed in R6/2 transgenic mice. In this
study, we also found an increase in the level of Clcn1+7a in the IO of R6/2 mice relative
to WT (Table 3).
In young WT mice the level of Clcn1+7a is normally high, representing a normal
early developmental splicing pattern, and as WT mice age and undergo normal skeletal
muscle maturation, the level of Clcn1+7a decreases (Charlet et al., 2002; Miranda et al.,
2016). In contrast, in the R6/2 HD transgenic mice, the level of Clcn1+7a remains high.
This implies that the embryonic splicing pattern was maintained in HD mice during
maturation suggesting that the HD mice may have defects in normal muscle maturation.
Other studies have shown that aberrant alternative splicing may be due to mutated
huntingtin mRNA with expanded trinucleotide repeats, sequestering muscleblind-like
proteins (MBNL), which play an important role in the adult splicing pattern of Clcn1
mRNA (Lin et al., 2006). For example, the expressed mRNAs from the expanded CTG
repeats of myotonic dystrophy (DM) patients bind to muscleblind proteins affecting their
RNA splicing ability (Ranum and Cooper, 2006). Muscleblind family members include
46
MBNL1, MBNL2, and MBNL3. Konieczny et al. (2014) stated that muscleblind family
members “share structural similarities including four zinc-finger (ZnF) domains critical
for recognizing a common consensus sequence in pre-mRNA and mRNA targets.” Since
transgenic mice with disrupted expression of MBNL genes also show miss-regulation of
Clcn1 splicing including elevated exon 7a inclusion (Hao et al., 2007) the elevation in
Clcn1 exon 7a inclusion in HD mice could also be due to the trinucleotide repeat
expansion in the huntingtin gene sequestering MBNL proteins. Thus, two possible
mechanisms could cause the elevation in Clcn1 exon 7a inclusion with HD: 1) defective
muscle maturation and 2) MBNL protein sequestration by expanded trinucleotide repeats.
Table 3. Summary of Aberrant Alternative Splicing.
*
#
CLCN1
INSR
SERCA1
TTN
TNNT3
ACTN1
ZASP
TA
p<0.05*
p<0.05#
NS
p<0.001
NS
NS
NS
SOL
NS
NS
NS
NS
NS
NS
NS
DIA
NS
NS
NS
NS
NS
NS
NS
IO
p<0.05
p<0.05
NS
p=0.0774
NS
NS
NS
Miranda et al. (2016)
McKee et al. (unpublished)
NS: Non-Significant
47
Since Mbnl2 was found to be involved in alternative splicing of the insulin
receptor (IR) (Ho et al., 2004), our lab studied the impact of HD on IR mRNA splicing.
McKee et al. (unpublished data) found an increase in the level of the insulin receptor IRA isoform (exon 11-) and a decrease in the IR-B isoform (exon 11+) of TA of R6/2
transgenic mice compared to WT (Table 3). Similarly, in this study, we found a relative
increase in the level of the insulin receptor IR-A isoform and a decrease in the IR-B
isoform in the IO of R6/2 transgenic mice compared to WT. The IR-A isoform
predominates in embryonic tissue and the IR-B isoform is highty expressed in adult
skeletal muscle, liver, and adipose tissues. This data suggests that an increase in aberrant
alternative splicing of INSR mRNA may be linked to defective Mbnl2 function. However,
as IR-A isoform is highly expressed in embryonic tissues, a role for defective maturation
cannot be ruled out.
Interestingly, we found no significant differences in aberrantly spliced CLCN1
and INSR mRNAs in the Dia or Sol of R6/2 relative to WT. The Sol and Dia, unlike the
TA and IO skeletal muscles, have high proportions of slow type 1 fibers. Our data
suggests that the difference in muscle fiber composition may play an important role in the
extent of aberrant alternative splicing of various genes in HD mice. It would be
interesting to assesss the MBNL expression levels in Fast vs. Slow musles during
development and in adult mice and humans.
The Hao et al. (2007) study on Mbnl2 deficient mice also found no significant
impact on the splicing of ZASP, SERCA1, and m-TTN mRNA compared to WT in the
fast vastus muscle. We also examined ZASP, SERCA1, TNNT3, and TTN mRNA
splicing in the TA and IO muscles and found similar results. These two skeletal muscles,
48
like the vastus skeletal muscle, are also fast-twitch glycolytic (Type 2). We found no
significant differences in aberrantly spliced TTN mRNA in the IO muscle of R6/2
transgenic mice, but did find a significant difference in aberrantly spliced TTN in the TA
of R6/2 transgenic mice. The differences in our study and the Hao et al. (2007) study
could be explained by muscle specificity unrelated to fiber type or perhaps the
disruptions in splicing are mainly due to maturational deficiencies, and not a simple
disruption in MBNL2 function.
We found no disruptions in gene splicing for ZASP, SERCA1, and TNNT3 in
either the TA or the IO in R6/2 mice. Curiously, while all other muscles expressed the
SERCA1a (adult) isoform (exon 22+) the IO in WT and R6/2 mice expressed the
SERCA1b (developmental) isoform (exon 22-). This suggests that the IO undergoes an
altered maturation process compared to other skeletal muscles.
The Dia and Sol were also analyzed for ZASP, SERCA1, TTN, and TNNT3
splicing to see if there were any differences between muscles of varying fiber type
composition. No differences in mRNA splicing were observed for any of these genes in
these muscles.
Finally, the TA, IO, Sol, and Dia were examined for ACTN1 splicing. No
differences in splicing were observed for any of the muscles examined.
49
CONCLUSION
Two possible mechanisms could cause aberrant splicing patterns in HD. One
possible mechanism involves defects in normal muscle maturation of R6/2 HD transgenic
mice. Previous studies, using TA, and in our studies, using IO, the high levels of
Clcn1+7a (inclusion) implies that the embryonic splicing pattern was maintained in HD
mice during muscle maturation. Secondly, the mutated huntingtin mRNA may be caused
by expanded trinucleotide repeats sequestering muscleblind-like proteins, which lead to
functional disturbance and subsequent aberrant alternative splicing. Also, late-stage R6/2
mice express elevated level of developmental myosin heavy chain isoforms suggesting a
disruption in muscle maturation (Miranda et al., 2016). Thus, the disruptions in splicing
may be due to maturational deficiencies, and not a simple disruption in muscleblind-like
protein function.
We conclude that the effect of HD on aberrant alternative splicing seems to be
muscle specific. The faster muscles (TA and IO) showed a higher degree of significant
difference between R6/2 HD transgenic mice and WT mice. The data implies that faster
muscles show a greater number of genes, at least the ones we looked at, that show
aberrant alternative splicing.
50
FUTURE STUDIES
The next steps from this study would be to examine other RNA binding proteins,
such as CUG-BP, to help us understand its role of aberrant alternative splicing in HD.
CUG-BP plays an important role in regulating various steps in RNA processing in the
nucleus and cytoplasm, such as pre-mRNA alternative splicing, C to U RNA editing,
deadenylation, mRNA decay, and translation (Dasgupta and Ladd, 2012). In addition,
more research will need to be conducted to better understand the extent of aberrant
altervative splicing of various genes of different skeletal muscle types.
Moreover, much research has been conducted in regards to the effects of mutant
huntingtin aggregates on nucleus of neurons, however, research lacks in studying the
effects of huntingtin aggregates in the nucleus of HD skeletal muscle cells. It has been
shown that huntingtin aggregates in the nucleus disrupt the normal function of neurons,
causing cell cycle re-entry and neuronal cell death (Liu et al., 2015). It is unknown how
mutant huntingtin aggregates in the nucleus of muscle cells contribute to skeletal muscle
atrophy in HD (Zielonka et al., 2014). Atrophy is described as the degeneration of muscle
fibers. Also, it is uncertain whether mutant huntingtin aggregates in skeletal muscle
nuclei affect aberrant alternative splicing of various genes important for normal skeletal
muscle function. Understanding these underlying mechanisms will help us slow or halt
the progression of HD by discovering better treatments.
51
REFERENCES
Amsili, S., Zer, H., Hinderlich, S., Krause, S., Becker-Cohen, M., et al. (2008). UDP-Nacetylglucosamine 2-epimerase/N-acetylmannosamine kinase (GNE) binds to
alpha-actinin 1: novel pathways in skeletal muscle? PLoS One. 3(6):e2477
Atwal, R.S., Xiz, J., Pinchev, D., Taylor, J., Epand, R. M., & Truant, R. (2007).
Huntingtin has a membrane association signal that can modulate huntingtin
aggregation, nuclear entry and toxicity. Hum Mol Genet. 16(21), 2600-15
Bano, D., Zanetti, D., Mende, Y., Nicotera, P. (2011). Neurodegenerative processes in
Huntington’s disease. Cell Death and Disease. 1-7.
Bates, G.P. (2015). Huntington’s Disease. Nature Reviews: Disease Primers. 1: 1-21
Bates, G.P. (2005). The molecular genetics of Huntington disease – a history. History of
Genetic Disease.
Bates, G.P., Tabrizi, S. J., Jones, L. (2014). Huntington’s Disease. Oxford University
Press. 4th Edition.
Bota, A., Malena, A., Loro, E., Del Moro, G., Suman, M., et al. (2013). Altered
Ca2+ Homeostasis and Endoplasmic Reticulum Stress in Myotonic Dystrophy
Type 1 Muscle Cells. Genes. 4(2), 275-292
Brook, J.D., McCurrach, M.E., Harley, H.G., et al. (1992). Molecular basis of myotonic
dystrophy: expansion of a trinucleotide (CTG) repeat at the 3-prime end of a
transcript encoding a protein kinase family member. Cell. 68:799-808.
Brouillet, E., Hantraye, P., Ferrente, R.J., Dolan, R., Leroy-Willig, A., et al. (1995).
Chronic mitochondrial energy impairment produces selective striatal degeneration
and abnormal choreiform movements in primates. Proc. Natl Acad. Sci. USA
92:7105-7109
Carter, R.J., Lione, L.A., Humby, T., Mangiarini, L., Mahal, A., Bates, G.P., et al.
(1999). Characterization of progressive motor deficits in mice transgenic for the
human huntington’s disease mutation. The Journal of Neuroscience. 19(8)32483257.
Charlet-B, N., Savkur, R. S., Singh, G., Philips, A. V., Grice, E. A., & Cooper, T. A
(2002). Loss of the muscle-specific chloride channel in type 1 myotonic
dystrophy due to misregulated alternative splicing. Mol Cell. 10(1):45-53.
Cloud, L., Rosenblatt, A,, Margolis, R,, et al. (2012). Seizures in juvenile Huntington’s
disease: frequency and characterization in the multicenter cohort. Mov Disord.
27:1797-1800
52
Cowan, C.M., Fan, M.M., Fan, J., Shehadeh, J., Zhang, L.Y., Graham, R.K., et al. (2008).
Polyglutamine-modulated striatal calpain activity in YAC transgenic huntington
disease mouse model: impact on NMDA receptor function and toxicity. J
Neurosci. 28:12725–12735
Dasgupta, T., & Ladd, A.N. (2012), The importance of CELF control: molecular and
biological roles of the CUG-BP, Elav-like family of RNA-binding protein. Wiley
Interdiscip. Rev. RNA. 3,104–121
Dzialowski, E.M. (2016). Sarcomere. Unpublished lecture, Department of Biological
Sciences, University of North Texas, Texas, USA.
Duyao, M., et al. (1993). Trinucleotide repeat length instability and age of onset in
Huntington’s disease. Nature Genet. 4, 387–392
Faber, P.W., Alter, J.R., MacDonald, M.E., et al. (1999). Polyglutamine-mediated
dysfunction and apoptotic death of Caenorhabditis elegans sensory neuron. Proc.
Natl Acad. Sci. USA 96, 179-184
Fernandes, V.S., Santos, J.R., et al. (2016) Repeated treatment with a low dose of
reserpine as a progressive model for Parkinson’s disease. 231(1):154-63
Fu, Y.H., Pizzuti, A., Fenwich, R.G. Jr., King J., Rajnarayan, S., et al. (1992). An
unstable triplet repeat in a gene related to myotonic muscular dystrophy. Science.
255(5049):1256-8.
Gharehbaghi-Schnell, E,B., Finsterer, J., Korschineck, I., et al. (1998). Genotypephenotype correlation in myotonic dystrophy. Clin Genet. 53:20-6.
Gipson, T.A, Andreas, N., Wexler, N.S., et al. (2013). Aberrantly spliced HTT, a new
player in Huntington’s disease pathogenesis. RNA Biol. 10(11):1647-1652
Griggs, R., Vihola, A., Hackman, P., Talvinen, K., Haravuori, H., Faulkner, G., Eymard,
B., Richard, I., Selcen, D., Engel, A., Carpen, O., Udd, B. (2007). Zaspopathy in a
large classic late-onset distal myophathy family. Brain. 130(Pt 6): 1477-84
Hackman, P., Vihola, A., Haravuori, H., Marchand, S., Sarparanta, J., et al. (2002). Tibial
Muscular Dystrophy is a Titinophathy Caused by Mutations in TTN, the Gene
Encoding the Giant Skeletal-Muscle Protein Titin. Am. J. Hum. Genet. 71, 492500
Haddad, M. S., & Cummings, J.L. (1997). Huntington’s Disease. Psychiatr Clin North
Am. 20(4):791-807
53
Hamshere, M.G., Harley, H., Harper, P., et al. (1999). Myotonic dystrophy: the
correlation of (CTG) repeat length in leucocytes in age at onset is significant only
for patients with small expansions. J Med Genet. 36:59-61.
Harper PS. (2001). Myotonic dystrophy. 3rd edition. London: Saunders
Harris, S., Moncrieff, C., Johnson, K. (1996). Myotonic dystrophy; will the real gene
please step forward! Hum Mol Genet. 5 Spec No:1417-23.
Hao, M., Akrami, K., Wei, K., de Diego, C., Che, N., Ku, J.-H., Tidball, J., Graves, M.C.,
Shieh, P.B., & Chen F. (2007) Muscleblind-like 2 (Mbnl2) – Deficient Mice as a
Model for Myotonic Dystrophy. Developmental Dynamics. 237:403-410
Heiser, V. et al. (2002). Identification of benzothiazoles as potential polyglutamine
aggregation inhibitors of Huntington’s disease by using an automated filter
retardation assay. Proc. Natil Acad. Sci. USA. 99:16440-16406
Hino, S.-H., Kondo, S., Sekiya, H., Saito, A., et al. (2007). Molecular mechanisms
responsible for aberrant splicing of SERCA1 in myotonic dystrophy type 1.
Human Molecular Genetics. Vol 16. No 23.
Ho, L.W. et al. (2001) The molecular biology of Huntington’s disease. Psychol. Med. 31,
3–14
Ho, T.H., Charlet, B.N., Poulos, M.G., Singh, G., Swanson, M.S., Cooper, T.A. (2004).
Muscleblind proteins regulate alternative splicing. EMBO J. 23:3103–3112
Hopkins, P.M. (2006). Skeletal muscle physiology. Contin Educ Anaesth Crit Care Pain.
6 (1): 1-6
Huntington, G. (1872). On chorea. Medical and Surgical Reporter. 26:320-321
Huntington’s Disease Collaborative Research Group (1993). A novel gene containing a
trinucleotide repeat that is unstable on Huntington’s disease chromosomes. Cell.
72, 971-983
Huntington’s Disease Medication. (2015). Retrieved from www.
Emedicine.medscape.com/article/1150165-medication
Huntington’s Disease Society of America. (2016). Retrieved from http://hdsa.org
Jakovcevski, M., & Akbarian, S. (2012). Epigenetic mechanisms in neurodevelopmental
and neurodegenerative disease. Nat Med. (18)1194-1204
54
Ju, Y., Li, J., Xie, C., Ritchlin, C.T., Xing, L., Hilton, M.J., & Schwarz, E.M. (2013).
Troponin T3 expression in skeletal and smooth muscle is required for growth and
postnatal survival: characterization of Tnnt3(tm2a(KOMP)Wsi) mice. Genesis.
51(9):667-75
Kaltenbach, L.S., et al. (2007). Huntingtin interacting proteins are genetic modifiers of
neurodegeneration. PLoS Genet. 3, e82
Kimura, T., Nakamori, M., Lueck, J.D., Pouliquin, P., Aoike, F., et al. (2005). Altered
mRNA splicing of the skeletal muscle ryanodine receptor and
sarcoplasmic/endoplasmic reticulum CA2+- ATPase in myotonic dystrophy type
1. Hum Mol Genet. 14(15):2189-200
Kirkwood, S.C, Su, J.L., Conneally, P.M., Foroud, T. (2001). Progression of Symptoms
in the early and Middle Stages of Huntington’s Disease. Archives of
Neurobiology. 58(2):273-8
Konieczny, P., Stepniak-Konieczna, E., & Sobczak, K. (2014). MBNL proteins and their
target RNAs, interaction adn splicing regulation. Nucleic Acids Research. 1: 1-15
doi: 10.1093/narlgku767
Li, H., Li, S.H., Yu, A.X., Shelbourne, P., & Li, X.J. (2001). Huntingtin AggregateAssociated Axonal Degeneration is an Early Pathological Even in Huntington’s
Disease Mice. The Journal of Neuroscience. 21(21):8473-8481
Lin X., Ruiz J., Bajraktari I., Ohman R., Banerjee S., Gribble K., Kaufman JD., et al.
(2014). Z-disc-associated, Alternatively Spliced, PDZ Motif-containing Protein
(ZASP) Mutations in teh Actin-binding Domain Cause Disruption of Skeletal
Muscle Actin Filaments in Myofibrillar Myopathy. The Journal Of Biological
Chemistry. 289, 13615-13626
Lin, X., Miller, J.W., Mankodi, A., Kanadia, R.N., Yuan, Y., Moxley, R.T., Swanson,
M.S., & Thornton, C.A. (2006). Failure of MBNL1-dependent post-natal splicing
transitions in myotonic dystrophy. Hum Mol Genet. 15, 2087-2097
Liu, K.Y., Shyu, Y.C., Barbaro, B.A., Lin, Y.T., Chern, Y., Thompson, L.M., et al.
(2015). Disruption of the nuclear membrane by perinuclear inclusions of mutant
huntingtin causes cell-cycle re-entry and striatal cell death in mouse and cell
models of Huntington’s disease. Hum Mol Genet. 15;24(6):1602-16
Louis, E.D., Lee, P., Quinn, L., Marder, K. (1999). Dystonia in Huntington's disease:
prevalence and clinical characteristics. Mov Disord.14(1):95-101
Lundbeck. (2015). Xenazine. Deerfield, IL.
55
Mahadevan, M., Tsilfidis, C., Sabourin, L., Shutler, G., Amemiya, C., et al. (1992).
Myotonic dystrophy mutation: an unstable CTG repeat in the 3' untranslated
region of the gene. Science. 255(5049):1253-5
Mangiarini, L., Sathasivam, K., Seller, M., Cozens, B., Harper, A., et al. (1996). Exon 1
of the HD gene with an expanded CAG repeat is sufficient to cause a progressive
neurological phenotype in transgenic mice. Cell. (87) 493–506
Marshall, F.J. (2004). Clinical Features and Treatments of Huntington’s Disease. Clinical
Disorders. Chapter 35.
Martorell, L., Monchkton, D.G., Sanchez, A., et al. (2001). Frequency and stability of the
myotonic dystrophy type 1 premutation. Neurology. 56:328-35
Mayo Clinic. (2015). Retrieved from www.mayoclinic.org/diseasesconditions/huntingtons-disease/basics/treatment/con-20030685
Miller, J.P., et al. (2010). Matrix metalloproteinases are modifiers o huntingtin
proteolysis and toxicity in Huntingon’s disease. Neuron. 67, 199-212
Murphy, A.C.H., & Young, P.W. (2015). The actinin family of acting cross-linking
proteins – a genetic perspective. Cell and Bioscience. 5:49 DOI: 10.1186/s13578015-0029-7
Nasir, J., Floresco, S.B., O’Kusky, J.R., Diewet, V.M., Richman, J.M., Zeisier, J., et al.
(1995). Targeted distruption of the Huntington’s disease gene results in
embryonic lethality and behavioral and morphological chnages in heterozygotes.
Cell. 81:811-823
Ortega, Z., & Lucas, J.J. (2014). Ubiquitin-proteosome system involvement in
Huntington’s disease. Frontiers in Molecular Neuroscience. 1-11
Parkinson’s Disease Foundation. (2016). Retrieved from pdf.org/en/symptoms
Punnett, R. C. (1908). Mendelian inheritance in man. Proc. Nat. Hist. Soc. Med. 1, 135 –
168
Quarrell, O., O’Donovan, K.L., Strong, M., & Bandmann, O. (2012). The prevalence of
juvenile Huntington’s disease: a review of the literature and meta-analysis. PloS
Curr. 4:e4f8606b742ef3
Ranum, L.P., & Cooper, T.A. (2006). RNA-mediated neuromuscular disorders. Annu Rev
Neurosci. 29:259–277
56
Ribai, P., Nguyen, K., Hahn-Barma, V., Gourfinkel-An, I., Vidailhet, M., Legout, A, et
al. (2007). Psychiatric and cognitive difficulties as indicators of juvenile
huntington disease onset in 29 patients. Arch Neurol. 64, 813-819
Rubinsztein, D.C. (2002). Lessons from animal models o Huntington’s disease. TRENDS
in Genetics. Vol. 18 No.4
Santoro, M., Masciullo, M., Bonvissuto, D., Bianchi, M.L., Michetti, F., & Silvestri, G.
(2013). Alternative splicing of human insulin receptor gene (INSR) in type I and
type II skeletal muscle fibers of patients with myotonic dystrophy type 1 and type
2. Mol Cell Biochem. 380(1-2):259-65
Siesling, S., Vegter-van der Vlix, M., & Roos, R.A. (1997). Juvenile Huntington’s
disease in the Netherlands. Pediatr Neurol.17:37 – 45
Skarnes, W.C., von Melchner, H., Wurst, W., Hicks, G., Nord, A.S., Cox, T., et al.
(2004). A public gene trap resource for mouse functional genomics. Nat Genet.
36:543–544
Snell, R.G., MacMillan, J. C., Cheadle, J. P., Fenton, I., Lazarou, L. P., Davies, P., et al.
(1993). Relationship between trinucleotide repeat expansion and phenotypic
variation in Huntington’s disease. Nat Genet. 4:393-397
Steffan, J.S., et al. (2001). Histone deacetylase inhibitors arrest polyglutamine-dependent
neurodegeneration in Drosophila. Nature. 413, 739-743
Steffan, J.S., et al. (2004). SUMO modification of Huntingtin and Huntington’s disease
pathology. Science. 304, 100-104
Storey, E., & Beal M.F. (1993). Neurochemical substrates of rigidity and chorea in
huntington’s disease. Brain. 116 (Pt 5):1201-22
Stryke, D., Kawamoto, M., Huang, C.C., Johns, S.J., King, L.A., Harper, C.A., Meng,
E.C., Lee, R.E., Yee, A., et al. (2003). BayGenomics: a resource of insertional
mutations in mouse embryonic stem cells. Nucleic Acids Res. 31:278–281
Suzuki, H., Takeuchi, M., Sugiyama, A., et al. (2012). Alternative splicing produces
structural and functional changes in CUGBP2. BMC Biochemistry. 13:6
Turner, C., & Hilton-Jones, D. (2010). The myotonic dystrophies: diagnosis and
management. J Neurol Neurosurg Psychiatry. 81:358-367.
Doi:10.1136/jnnp.2008.158261
Vonsattel, J.P., & DiFiglia, M. (1998) Huntington disease. J. Neuropathol. Exp. Neurol.
57, 369–384
57
Waters, C.W., Varuzhanyan, G.; Talmadge, R.J., & Voss, A.A. (2013). Hutington disease
skeletal muscle in hyperxcitable owing to chloride and potassium channel
dysfunction. PNAS. 110 (22) 9160-9165
Wang, K., McCarter, R., Wright, J., Beverly, J., & Ramirez-Mitchell R. (1991).
Regulation of skeletal muscle stiffness and elasticity by titin isoforms: A test of
the segmental extension model of resting tension. Proc. Natl. Acad. Sci. USA. 88,
7101-7105
Zhao, Y., Ogawa, H. Yonekura, S., Mitsuhashi, H., Mitsuhashi, S., Nishino, I., et al.
(2015). Functional analysis of SERCA1b, a highly expresed SERCA1 variant in
myotonic dystrophy type 1 muscle. Biochim Biophys Acta. 1852(10 Pt A): 2042-7
Zakzanis, K.K. (1998). The subcortical dementia of Huntington’s disease. J. Clin. Exp.
Neuropsychol. 20(4):565-78
Zeitlin, S., Liu, J.P., Chapman, D.L., Papaioannou, V.E., & Efstratiadis, A. (1995).
Increased apoptosis and early embryonic lethality in mice nullizygous for the
Huntington’s disease gene homologue. Nat Genet. 11:155-163
Zielonka, D., Piotrowska, I., Marcinkowski, J.T., & Mielcarek, M. (2014). Skeletal
muscle pathology in Huntington’s disease. Frontiers in Physiology. Volume 5.
Article 380: 1 – 5
58