Download Effects of Whole Yeast Cell Product Supplementation in Chickens

Effects of Whole Yeast Cell Product Supplementation in Chickens Post-coccidial and
Post-Salmonella Challenge
Thesis
Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in
the Graduate School of The Ohio State University
By
Ashley D. Markazi, B.S.
Graduate Program in Animal Sciences
The Ohio State University
2015
Master’s Examination Committee:
Ramesh K. Selvaraj, Advisor
Michael S. Lilburn
Renukaradhya Gourapura
Copyright by
Ashley D. Markazi
2015
ABSTRACT
This project studied the effects of whole yeast cell product supplementation in (1)
layer pullets and hens post-coccidial challenge and (2) in broiler chickens postSalmonella enterica serotype Enteritidis challenge. The whole yeast product is a
commercial-killed whole yeast consisting of all its inner components and the outer yeast
cell wall.
The first study consisted of two experiments. In the first experiment, day-old
layer chicks were supplemented with 0, 0.1 or 0.2% whole yeast cell product. After
21 days of whole yeast cell product feeding, the birds were challenged with live
coccidial oocysts. Whole yeast cell product supplementation improved body weight
gain and had no effect on feed consumption at 9 days post-coccidial challenge.
Whole yeast cell product supplementation decreased fecal oocyst count at 7, 8 and 9
days post-coccidial challenge. Whole yeast cell product supplementation did not
significantly alter CD4+ or CD8+ cell populations in the cecal tonsils or spleen.
ii In the second experiment, 40-week-old layer hens were supplemented with 0, 0.05
or 0.1% whole yeast cell product and challenged with live coccidial oocysts after 21 days
of whole yeast feeding. Whole yeast cell product supplementation did not significantly
alter body weight or feed consumption post-challenge. Supplementation with whole yeast
cell product decreased intestinal content ooocyst count at 5, 12 and 28 days post-coccidial
challenge. Whole yeast cell product supplementation increased CD8+ cell populations in
the cecal tonsils post-coccidial challenge.
The second study evaluated the effects of whole yeast cell product
supplementation on broiler production parameters, S. Enteritidis colony forming units,
relative proportions of Salmonella, Bifidobacteria and Lactobacillus within the cecal
contents and immune parameters at 9 days post-Salmonella challenge. Day-old broiler
chicks were supplemented with 0, 0.1 or 0.2% whole yeast cell product. At 21 d of
feeding, birds were challenged with S. Enteritidis. Whole yeast cell product did not
significantly alter body weight of feed consumption post-challenge. Supplementation
with whole yeast cell product numerically increased (P = 0.11) relative proportion of
Salmonella at 7 and 14 days post-Salmonella challenge and significantly decreased
relative proportion of Lactobacillus 7 days post-Salmonella challenge in the cecal
contents. Whole yeast cell product supplementation did not significantly alter relative
proportion of Bifidobacteria in the cecal contents at 7 or 14 days post-Salmonella
challenge. Whole yeast cell product supplementation downregulated IL-10 and TNF-α
and upregulated IL-1β mRNA amounts in the cecal tonsils post-Salmonella challenge.
There were no significant differences in IL-6 mRNA amounts in challenged birds
iii supplemented with whole yeast cell product. Whole yeast cell product supplementation
decreased CD8+ cell populations in the cecal tonsils 14 days post-challenge. Whole yeast
cell product supplementation decreased jejunum villi lengths and crypt depths 7 days
post-Salmonella challenge.
This study demonstrated that whole yeast cell product supplementation may lower
infection in layer pullets and hens post-coccidial challenge. Whole yeast cell product may
lower infection in broiler chickens post-Salmonella challenge.
iv Dedication
I dedicate my thesis to my parents and my sister. Thank you for your endless love,
support and belief in me.
v Acknowledgments
I would like to give a most sincere thank you to my advisor, Dr. Ramesh Selvaraj,
for giving me this opportunity to further my education and strengthen my knowledge in
science. I thank Dr. Michael Lilburn for his continual support, and for the invaluable
advice and knowledge he has given me in many subjects including experimental layouts,
classes, the poultry industry and nutrition. I also would like to thank Dr. Renukaradhya
Gourapura for the very appreciated support and advice he has given me about graduate
school, my experiments and explaining to me the importance of balancing both research
and lab work.
I thank Dr. Mamduh Sifri for his guidance and financial support with ADM
Alliance Nutrition. Without his generosity this project would not have been possible.
I thank Revathi for teaching me all the techniques in lab and for all the help she
gave me with my experiments. She really spent a lot of time instructing me, and I thank
her for her patience and for giving me the confidence in being comfortable in the lab
environment. I would also like to thank Keith, Jack, Jordan and Jarrod for their immense
help and hard work in caring for the birds in my study.
I would like to thank my dad, mom and sister for their continuous support and for
always being able to cheer me up whenever I was facing difficulties.
vi Finally I thank all the graduate students at OARDC who offered their support and
friendship, making research life a lot more enjoyable. I would especially like to thank
Matt W., Antrison, and Josh for all their help and advice in the lab. I would also like to
thank Amanda who helped calm me down during the last few weeks before my defense. I
thank Rachel for all the advice she kindly offered both in lab work and for my thesis. I
thank Chidozie, Chris, Matt F., Ashlee and Katie for all their help and friendship as well.
Thank you also to Janani and Deb for all their advice, support and close friendship during
my time in Wooster.
vii Vita
2008…………………................................................Barrington High School
Barrington, Illinois
2012…………………………………………………B.S. Natural Resources and
Environmental Sciences,
University of Illinois at UrbanaChampaign
2013-2015…………………………………………...Graduate Research Associate,
Graduate program in Animal
Sciences, The Ohio State University
Fields of Study
Major Field: Animal Sciences
Specialization: Poultry Nutrition Immunology
viii Table of Contents
ABSTRACT ....................................................................................................................... ii
Dedication .......................................................................................................................... v
Acknowledgments ............................................................................................................ vi
Vita .................................................................................................................................. viii
List of Tables .................................................................................................................... xi
List of Figures.................................................................................................................. xii
Chapter 1: Introduction ................................................................................................... 1
Chapter 2: Review of Literature ..................................................................................... 4
Introduction ................................................................................................................... 4
Composition of yeast cell wall products ...................................................................... 4
Immunomodulatory Effects of MOS and β-glucans .................................................. 5
Gut microflora............................................................................................................... 6
Villus and crypts ........................................................................................................... 6
Innate Immune System ................................................................................................. 7
Adaptive Immune System ............................................................................................ 8
Cytokines ..................................................................................................................... 10
Coccidiosis ................................................................................................................... 13
Salmonella .................................................................................................................... 17
Chapter 3: Effects of Whole Yeast Product Post-Coccidial Challenge ...................... 24
Abstract........................................................................................................................ 24
Introduction ................................................................................................................. 26
Materials and Methods ................................................................................................ 29
Results .......................................................................................................................... 33
Discussion and Conclusion ......................................................................................... 35
Chapter 4: Effects of Whole Yeast Cell Product Supplementation post-Salmonella
Challenge ......................................................................................................................... 37
Abstract........................................................................................................................ 37
Introduction ................................................................................................................. 39
Materials and Methods ............................................................................................... 41
Results .......................................................................................................................... 46
Discussion and Conclusion ......................................................................................... 50
Chapter 5: Conclusions .................................................................................................. 54
ix References ........................................................................................................................ 59
Appendix A: Tables ........................................................................................................ 70
Appendix B: Figures ....................................................................................................... 72
x List of Tables
Table 1. Bacterial primers…………………………………………………………….….70
Table 2. Cytokine primers………………………………………………………………..71
xi List of Figures
Figure 1. Effect of whole yeast cell product supplementation on body weight gain at 9 d
post-coccidial challenge .............................................................................................……72
Figure 2. Effect of whole yeast cell product supplementation on fecal oocyst count at 7, 8
and 9 d post-coccidial challenge ................................................................................……73
Figure 3. Effect of whole yeast cell product supplementation on intestinal content oocyst
count at 5, 12 and 28 d post-coccidial challenge .......................................................……74
Figure 4. Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell
populations in the cecal tonsils at 5 d post-coccidial challenge.................................……75
Figure 5. Effect of whole yeast cell product supplementation on relative proportion of
Lactobacillus in the cecal contents at 7 d post-Salmonella challenge. ......................……76
Figure 6. Effect of whole yeast cell product supplementation on relative proportion of S.
Enteritidis in the cecal contents at 7 and 14 d post-Salmonella challenge ................……77
Figure 7. Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell
populations in the cecal tonsils at 7 d post-Salmonella challenge .............................……78
Figure 8. Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell
populations in the cecal tonsils at 14 d post-Salmonella challenge ...........................……79
Figure 9. Effect of whole yeast cell product supplementation on CD4+CD25+ cell
populations in the cecal tonsils at 7 and 14 d post-Salmonella challenge .................……81
xii Figure 10. Effect of whole yeast cell product on IL-1β mRNA amounts in the cecal
tonsils at 14 d post-Salmonella challenge ..................................................................…....82
Figure 11. Effect of whole yeast cell product on IL-10 mRNA amounts in the cecal
tonsils at 7 and 14 d post-Salmonella challenge ........................................................…....83
Figure 12. Effect of whole yeast cell product on TNF-α mRNA amounts in the cecal
tonsils at 7 d post-Salmonella challenge ....................................................................…....84
Figure 13. Effect of whole yeast cell product on IL-6 mRNA amounts in the cecal
tonsils at 7 and 14 d post-Salmonella challenge .......................................................…....85
Figure 14. Effect of whole yeast cell product supplementation on jejunum villi length 7 d
post-Salmonella challenge .........................................................................................…....86
Figure 15. Effect of whole yeast cell product supplementation on jejunum crypt depth 7 d
post-Salmonella challenge .........................................................................................……87
xiii Chapter 1: Introduction
Whole yeast cell products are derived from yeast species including
“Saccharomyces cerevisiae”, “Torula utilis” and “Pichia guilliermondii”
(Shanmugasundaram and Selvaraj, 2012; Sohail et al., 2012). The whole yeast product is
a commercial-killed whole yeast consisting of all its inner components and the outer
yeast cell wall. The yeast cell wall contains the polysaccharides mannan oligosaccharides
and β-glucans (Lipke and Ovalle, 1998). These polysaccharides can have
immunomodulatory effects in several species including poultry (Shanmugasundaram et
al, 2013). Whole yeast cell products may become important in the poultry industry for
their potential, especially as anticoccidials and antibiotics decrease in use due to the
public’s concerns of antibiotic and drug resistance (Gustafson and Bowen, 1997).
Mannan oligosaccharides and β-glucans facilitate conditioning for gut immunity
through several different mechanisms. Mannan oligosaccharides can prevent bacterial
adhesion and colonization (Becker and Galletti, 2008). Pathogens such as Salmonella and
Escherichia coli have type-1 fimbriae, which are appendages used to attach to other cells.
Type-1 fimbriae adhere to MOS due to its high affinity for mannose residues of
glycoproteins present on the host’s cell surfaces (Badia et al., 2013). Mannose-rich
products such as whole yeast cell products have shown to inhibit pathogenic colonization
by adhering to type-1 fimbriae as opposed to the host’s enterocytes (Badia et al., 2013).
1 The specific structure of β-glucan monomers, which are linked at the 1,3 position
with branches at the 1,6 position, influences the activity of leukocytes by resembling
pathogen-associated molecular patterns (PAMPs) that stimulates innate immunity (Brown
and Gordon, 2003). The β-glucan PAMPs are recognized by the receptor dectin-1 on
macrophages (Brown and Gordon, 2003). This recognition signals dectin-1 receptor,
which then triggers the innate immune system to recruit leukocytes such as macrophages,
neutrophils and natural killer (NK) cells to the site of infection (Brown and Gordon,
2003).
Both mannan oligosaccharides and β–glucans are considered to be prebiotics
(Janardhana et al., 2009). Prebiotics are indigestible foods that stimulate the selective
growth and activity of beneficial microorganisms such as Bifidobacteria and
Lactobacillus in the gut, thus improving overall tissue health (Cummings and
Macfarlane, 2002).
Coccidiosis is a major disease in poultry caused by protozoan parasites of the
genus Eimeria (Dalloul and Lillehoj, 2006). Eimeria parasites produce lesions that
destroy the intestinal epithelia, thereby reducing feed efficiency and body weight gain
(Paris and Wong, 2013). Coccidiosis is spread through the chicken’s consumption of
coccidial oocysts within the feces (Allen & Fetterer, 2002). Each year coccidiosis causes
a loss of about $800 million in the United States alone (Sharman et al., 2010). Current
treatment protocols, such as the use of anticoccidial medications, are susceptible to
resistance and vaccination by itself is not always enough to control the problem
(Chapman, 1998).
2 Salmonella enterica serotype Enteritidis, one of the most commonly isolated
nontyphoidal serotypes of Salmonella, can lead to salmonellosis infection in humans,
with symptoms including diarrhea, fever and vomiting (Fabrega & Vila, 2013).
Approximately 40,000 cases of salmonellosis are reported each year in the United States,
although the real number may be 30-fold greater (Fabrega & Vila, 2013). Acute
salmonellosis in humans causes 400 deaths a year in the United States (Fabrega & Vila,
2013). Salmonella can be spread by feces or infected intestinal contents spilling and
contaminating the meat (Humphrey, 1988). Because vaccines are not effective in clearing
the persistence of S. enterica infections of chickens, the commercial poultry production
industry attempts to control S. enterica infections by supplementing vaccination
programs with several other procedures such as prebiotics (EFSA Scientific Panel, 2004).
The objectives of the present study are as follows:
Specific Aim 1
To study the effects of whole yeast cell product supplementation in layer chickens postcoccidial challenge
Specific Aim 2
To study the effects of whole yeast cell product supplementation in broiler chickens postSalmonella challenge
3 Chapter 2: Review of Literature
Introduction
Yeast cell wall products are derived from yeast species including “Saccharomyces
cerevisiae”, “Torula utilis” and “Pichia guillermondii” (Shanmugasundaram and
Selvaraj, 2012; Sohail et al., 2012). The yeast cell wall contains the polysaccharides
mannan oligosaccharides and β-glucans (Lipke and Ovalle, 1998).
These polysaccharides can have immunomodulatory effects in several species
including poultry (Shanmugasundaram et al., 2013). Yeast cell wall products may
become important in the poultry industry for their potential, especially as anticoccidials
and antibiotics are decreasing in use due to the public’s concerns with fear of antibiotic
and drug resistance (Gustafson and Bowen, 1997).
Composition of yeast cell wall products
Polysaccharides make up the majority of the yeast cell wall (Kogan et al., 2008).
Mannan oligosaccharides (MOS) represent about 40% of the cell wall’s dry matter, βglucans represent about 60% and chitin represents about 2% (Kogan et al., 2008). The
yeast cell wall’s composition and structure have immunomodulatory implications
(Lesage and Bussey, 2006).
4 Immunomodulatory Effects of MOS and β-glucans
MOS and β-glucans facilitate conditioning for gut immunity through several
different mechanisms. MOS can prevent bacterial adhesion and colonization (Becker and
Galletti, 2008). Pathogens such as Salmonella and E. coli have type-1 fimbriae, which are
appendages used to attach to other cells. Type-1 fimbriae adhere to the due to its high
affinity for mannose residues of glycoproteins present on the host’s cell surfaces (Badia
et al., 2013). Products derived from mannan have shown to inhibit pathogenic
colonization by adhering to type-1 fimbriae as opposed to the host’s enterocytes (Badia et
al., 2013).
β-glucans derived from the yeast cell wall have been shown to increase immune
signaling for macrophages to migrate to the site of the infection (Brown and Gordon,
2003). The specific structure of these glucose monomers, linked at the 1,3 position with
branches at the 1,6 position, influences the activity of immune cells by resembling
pathogen-associated molecular patterns (PAMPs) that stimulates innate immunity (Brown
and Gordon, 2003). The β-glucan PAMPs are recognized by the receptor dectin-1 on
macrophages (Brown and Gordon, 2003). This recognition signals dectin-1 receptor and
toll-like receptor 2, which then triggers the innate immune system to recruit leukocytes
such as macrophages, neutrophils and natural killer (NK) cells to the site of infection
(Brown and Gordon, 2003).
Both β-glucans and MOS are considered to be prebiotics (Janardhana et al.,
2009). Prebiotics are indigestible foods that stimulate the selective growth and activity of
5 beneficial microorganisms such as Bifidobacteria and Lactobacillus in the gut, thus
improving overall tissue health (Cummings and Macfarlane, 2002).
Gut microflora
The gastrointestinal (GI) tract is populated with bacteria, fungi, and protozoa,
with bacteria as the highest populated microorganism within the intestine (Gabriel et al,
2006). The intestinal tract of newly hatched chicks contain few if any microorganisms.
Over time, microbes colonize the gut through feeding, forming stable microflora
populations in two to four weeks (Mead and Adams, 1975). These microbes can be
classified as generally pathogenic or beneficial (Yegani and Korver, 2008). Pathogenic
microbes cause localized or systemic infections and toxin production, which ultimately
lead to disruption of the integrity of the gut and therefore less efficient production of the
animal (Jeurissen et al., 2002). Beneficial microbes can have effects such as vitamin
production, stimulation of the immune system, and inhibition of pathogenic microbe
colonization (Jeurissen et al, 2002).
Villus and crypts
Intestinal villi are finger-like projections that form the lining of the lumen of the
GI tract (McLin et al., 2009). Intestinal villi increase surface area for nutrient absorption
and longer villi are often associated with improved gut health and nutrient absorption
(Sims et al, 2004). Intestinal crypts surround the base of villi and contain stem cells that
continually divide and provide the sources of the epithelial cells on both the crypts and on
the villi (Barker and Clevers, 2012).
6 Both coccidial infection and S. Enteritidis can result in lower villus height and
greater crypt depths (Eustis and Nelson, 1981; Andrade et al., 2013). Greater crypt depth
can be related to the turnover of epithelial cells during an infection, suggesting a
compensatory response to the effects of S. Enteritidis (Morris et al., 2004). Higher cell
proliferation rate may cause the intestine to respond by reducing villus height (Andrade et
al., 2013).
Multiple studies have observed that MOS and β-glucan supplementation can
increase villus height and decrease crypt depth, suggesting that MOS and β-glucan
supplementation improves the intestinal gut health (Baurhoo et al., 2007; Shao et al.
2013).
Innate Immune System
The innate immune system is the first line of defense against pathogens (Akira et
al., 2006). The innate immune system uses a limited number of germ-line encoded pattern
recognition receptors (PPRs) that recognize pathogen-associated molecular patterns
(PAMPs) (Akira et al., 2006). PRRs such as toll-like receptors recognize these patterns
on antigens such as foreign microbes, leading to direct activation of immune cells
(Akiraet al., 2006). Toll-like receptors (TLRs) are expressed on macrophages, dendritic
cells, B cells, and some T cells. When these immune cells are exposed to the receptors’
ligands, adaptor proteins containing a TIR domain, such as myeloid differentiation factor
88 (MyD88), are recruited to the cytoplasmic region portion of the TLR through
interaction of the TIR domains. The resulting complex activates downstream signaling
7 cascades, resulting in the production of proinflammatory cytokines and chemokines
(Akira et al., 2006).
Macrophage and dendritic cells, known as antigen presenting cells (APCs),
activate the adaptive immune response by presenting antigens to naïve CD4+ T cells.
Additionally, dendritic cells can activate T cells, resulting in the transformation of naïve
CD4+ T cells to into T helper (Th1) cells. Th1 cells are essential in eliminating bacterial
and viral infection, as they produce interferon-γ (IFN-γ) (Akira et al., 2006). Th2 cells
produce IL-4 and IL-13, which are cytokines important in eliminating helminth infection.
TLR stimulation more often leads to Th1 differentation rather than Th2 differentiation.
As a result, innate immunity is an important activator of inflammatory response and
important for the immune response against pathogens (Akira et al., 2006).
The innate immune response is activated by foreign bacteria through molecules
collectively termed as modulins (Henderson et al., 1996). These modulins include
lipopolysaccharides (LPS), peptideglycans, lipoteichoic acid, lipoarbinomannan,
lipoproteins, and lipopeptides. Monocytes and macrophages respond to modulins by
producing proinflammatory cytokines such as IL-1β, IL-6, and TNF-α (Henderson et al.,
1996). These cytokines play a critical role in both the innate immune response and the
initiation of the adaptive immune response (Moors et al., 2001.)
Adaptive Immune System
The adaptive immune system has a more specific mechanism than the innate
immune system for recognizing self and non-self-antigens (Bonilla and Oettgen, 2010).
8 The adaptive immune system uses antigen-presenting cells and T and B lymphocytes to
signal pathogen-specific immunologic pathways.
Lymphocytes are white blood cells such as T cells and B cells. During
lymphocyte development, genes encode a diverse array of specific antigen receptors. The
interaction also generates immunologic memory (Bonilla and Oettgen, 2010). Long-lived
memory T and B cells are established during the first encounter with an antigen. When
these memory cells encounter the same antigen again, the memory cells respond more
rapidly (Bonilla and Oettgen, 2010).
T lymphocytes are comprised of two sub-populations: cytotoxic T lymphocytes
and helper T lymphocytes. These sub-populations are defined by their surface phenotypes
(Yun et al., 2000). Cytotoxic T lymphocytes recognize foreign antigens in the context of
MHC class I molecules, whereas T helper cells recognize antigens in the context of MHC
II molecules (Yun et al., 2000).
Intestinal lymphocytes within the intestinal mucosa are located in either the
epithelium (intestinal intraepithelial lymphocytes) or the lamina propria (lamina propria
lymphocytes). Intestinal intraepithelial lymphocytes (IELs) are present in the basal part of
the epithelium near the basement membrane (Yun, 2000). The number of these cells
ncrease in the presence of antigens in the intestine (Yun, 2000).
Although cytotoxic T cells are evident in the intestine of mammals, MHCrestricted intestinal epithelial lymphocytes (IELs) demonstrating cytotoxic activity have
not been seen in chickens (Yun, 2000). IELs are capable of processing antigens, although
the process is slower than in APCs (Brandeis et al., 1994). Additionally, IELs are
9 categorized as non-professional APCs since they do not express class II MHC (Guehler et
al., 1999). IELs secrete cytokines including IL-1, IL-2, IL-6, TGF-β, TNF-α, and IFN-γ.
IELs can also induce other intestinal cells to express class II molecules (Yun, 2000).
Cytokines
Cytokines are peptides involved in cell signaling and can affect the activity
behavior of other cells through autocrine, paracrine, and endocrine pathways (Cannon,
2000). Cytokines can be produced by almost all nucleated cells. Endothelial cells,
epithelial cells, and macrophages are especially strong producers of IL-1β and TNF-α
(Cannon, 2000). Cytokines can be produced in response to a wide a variety of stresses
including pathogenic microbes, endocrine stimuli, mechanical factors and environmental
factors (Cannon, 2000). T lymphocytes and macrophages are most likely the major
sources of cytokine production in the intestine (Lillehoj, 1994). Intestinal lymphocytes
have shown to be in direct contact with parasitized epithelial cells (Choi et al., 1999).
Chicken homologues to mammalian cytokines include IFN-γ, TGF-β, TNF-α,
and IL-2 (Lillehoj, 1998). IFN-γ stimulates proliferation and differentiation of
hematopoietic cells, and enhances non-specific immunity to tumors, bacteria, viruses and
parasites (Yun et al., 2000). Chicken IFN-γ (ChIFN-γ) regulates adaptive immunity by
activating lymphocytes and enhancing expression of MHC class II antigens (Kaspers et
al., 1994). Lymphocytes from Eimeria-infected chickens produce higher levels of IFN-γ
compared to uninfected controls (Martin et al., 1994). TGF-β is also produced by
lymphocytes in response to Eimeria (Jakowlew et al., 1997).
10 Il-1
Interleukin-1 cytokines induces inflammatory responses to infection (Dinarello,
2011). Both interleukin 1-α and interleukin 1-β bind to the IL-1 receptor (IL-1R)
resulting in the accessory protein 1RAcP to form a heterodimic complex with IL-1R1 and
IL-1 (Dinarello, 2011). The complex signals the adaptor protein MyD88 to join the IL-1
receptor domain, resulting in phosphorylated kinases and NF-kB translocation into the
nucleus (Dinarello, 2011). Translocation of NF-kB to the nucleus leads to transcription of
inflammatory genes (Dinarello, 2011).
Il-10
Interleukin-10 is an anti-inflammatory cytokine (Sabat et al., 2010). In mammals,
IL-10 cytokines are synthesized mainly by monocytes, macrophages and T helper cells
(Murai et al., 2009: Roers et al., 2004). IL-10 can additionally be produced from almost
all leukocytes, including dendritic cells, B cells, NK cells and mast cells (Wolk et al.,
2002). IL-10 targets monocytes and macrophages by suppressing antigen presentation,
phagocytosis, and cytokine production. IL-10 regulates these immune cells via the
transmembrane receptor complex (Sabat et al., 2010). The transmembrane receptor
complex is composed of IL-10R1 and IL-10R2 (Sabat et al., 2010). When IL-10 binds to
its receptors, it activates members of the Janus kinase family (Jak1 and Tyk2). These
kinases phosphorylate tyrosines of IL-10R1, which cause the transcription factor STAT3
to bind and become phosphorylated. STAT molecules are involved with inhibiting the
production of inflammatory molecules (Sabat et al., 2010).
11 Chicken IL-10 (chIL-10) has been cloned and isolated from the cecal tonsils of
chickens infected with Eimeria Tenella (Rothwell et al., 2004). ChIL-10 mRNA
expression is prominent within the cecal tonsils and bursa of fabricus, but is also
expressed in the thymus liver and lung (Rothwell et al., 2004). ChIL-10 downregulates
inflammatory responses by inhibiting the synthesis of proinflammatory cytokines
(including IL-1β, TNF-α, and IL-12), nitric oxide production, and MHC class II
expression (Rothwell et al., 2004).
IL-6
IL-6 has a wide variety of functions in regulating the immune system (Schneider
et al., 2001). IL-6 is produced by many different cell types and acts on B cells and T cells
(Hirano et al., 1986). IL-6 can modulate the Th1/Th2 response by inhibiting Th1
differentiation through upregulating the suppression of cytokine signaling (Diehl et al.,
2000). The IL-6 receptor alpha chain is responsible for ligand binding (Schneider et al.,
2001). Binding of IL-6 results in the activation of JAK/STAT and Ras/Raf signaling
pathway (Hibi et al., 1996).
TNF-α
TNF-α acts as the major inflammatory response to parasites, bacteria and viruses
(Hong et al., 2006). Hong et al. (2006) isolated a full-length cDNA encoding the chicken
homologue of LPS-induced TNA- α factor (LITAF) and concluded the chicken LITAF
(chLITAF) can serve as a homologue to the mammalian TNF-α. Upregulation of
chLITAF mRNA levels were observed after macrophages were stimulated with
12 Escherichia coli, Salmonella enterica serotype Typhimurium endoxtoxin, and coccidial
parasites Eimeria acervulina, Eimeria maxima, and Eimeria tenella (Hong et al., 2006).
Coccidiosis
There are seven species of Eimeria in chickens: Eimeria acervulina, Eimeria
maxima, Eimeria tenella, Eimeria necatrix, Eimeria mitis, Eimeria brunette, and Eimeria
praecox (McDougald, 1998). Each Eimeria species infects a specific part of the intestines
with a different lesion appearance (Paris and Wong, 2013). Five of the species, E.
acervulina, E. brunette, E. maxima, E. necatrix, and E. tenella are well known and easily
identified, as they produce characteristic gross lesions which range from moderate to
severe (Allen and Fetterer, 2002). Species such as E. praecox and E. miti are considered
to be benign as they do not kill chickens or produce lesions. However, even with these
two species, symptoms can include diarrhea and reduced feed efficiency, therefore
leading to potential commercial losses as well. Prophylactic use of anticoccidial feed
additives were the main way to control coccidiosis for many years however; anticoccidial
resistance has become a concern within the industry (Allen and Fetterer, 2002).
Avian Eimeria spp have homogenous life cycles (Allen and Fetterer, 2002).
Oocysts shed in feces undergo sporogony in the external environment and this process
takes about 23 hours. Sporogony is a meiotic process. The sporulated oocysts contain
four sporocysts, each of which contains two sporozoites. After the chicken ingests the
oocysts, the oocysts excycst within the intestinal lumen, while being aided by trypsin,
bile and CO2. The oocysts release sporozoites which can then penetrate the villous
epithelial cells. Some species such as E. brunette and E. praecox have sporozoites that
13 develop within the villous epithelial cells that were penetrated. Other species (E.
acervulina, E. maxima, E. necatrix, and E. tenella) have sporozoites that are transported
to other sites, such as the crypt epithelium, to undergo development (Allen and Fetterer,
2002).
Sporozoites undergo asexual reproduction which results in merozoites breaking
free and penetrating other host cells. The merozoites may carry out more merogenic
generations. Eventually, merozoites enter host cells and develop into either male
(microgamonts) or female (macrogamonts) forms. The microgametes fertilize
macrogamonts, which then results in oocysts. The oocysts are shed with the feces.
Prepatent periods generally range from 4 to 5 days after the infection, with the maximum
oocyst output ranges being from 6 to 9 days post infection (Allen and Fetterer, 2002).
Anticoccidial drugs
The poultry industry has been largely dependent on anticoccidial drugs (Allen et
al., 1997). Despite various anticoccidial drugs used in rotation, resistance has developed
to all of the anticoccidial drugs that have been introduced (Peek and Landman, 2011).
There are fewer new drugs being developed due to high cost, strict testing and regulatory
requirement (Peek and Landman, 2011).
Live anticoccidial vaccines are increasingly being incorporated to anticoccidial
drug rotation programs, resulting in an increase of drug-sensitive Eimeria spp (Peek and
Landman, 2011). This may result in ameliorated efficacy of anticoccidial drugs (Peek and
Landman, 2011). Despite this, anticoccidials are continuing to be banned due to public
fear of drug residues in the food supply and resistance to antibiotics (Chapman, 1994).
14 Management and biosecurity play a major role in lowering Eimeria spp. introduction to
the farm; however, they alone do not prevent coccidiosis outbreaks (Peek and Landman,
2011).
Anticoccidial drugs can be classified in three categories: synthetic compounds,
polyether antibiotics or ionophores, and mixed products (Allen and Fetterer, 2002).
Synthetic compounds are produced by chemical synthesis and have a specific mode of
action against the parasite metabolism. An example of this is amprolium, which competes
for the absorption of thiamine by the parasite (Allen and Fetterer, 2002). Polyether
antibiotics or ionophores are produced by the fermentation of Streptomyces spp. or
Actinomadura spp. and destroy coccidia by interfering with the balance of ions such as
sodium and potassium (Peek and Landman, 2011). Mixed products are drug mixtures
consisting of either a synthetic compound and ionophore or two synthetic compounds can
also be used again coccidiosis (Peek and Landman, 2011). Resistance to all three types of
anticoccidial drug products has been seen in Eimeria spp. (Peek and Landman, 2011).
Coccidial Vaccines
Due to anticoccidial drug resistance developed in Eimeria spp, vaccines are
becoming a popular alternative in large-scale production (Chapman, 2002). Types of
vaccines include Coccivac, Immucox, and Advent. These live vaccines are not
attenuated, and therefore can cause some lesions and occurrence of cocidiosis in birds
(Peek and Landman, 2011). Coccidiosis vaccines used in Europe and attenuated—not
disease-causing, and are more expensive than nonattenuated vaccines. These vaccines
include Paracox, Livacox, and Viracox (Peek and Landman, 2011). Anticoccidial
15 vaccines include mixtures of species of Eimeria that affect chickens, especially Eimeria
acervulina, Eimeria maxima, and Eimeria tenella, as these types cause the most damage
to chickens (Peek and Landman, 2011). Vaccines should be given at the hatchery or by
the first week of age, and can be applied through spray cabinets, edible gel, feed spray, or
drinking water (Chapman, 2002).
Immune Responses to Coccidiosis
Due to Eimeria parasites complex life cycle with both intracellular and
extracellular stages, the host immune response is complex, involving both innate and
adaptive immune responses, and both cellular and humoral immune responses within the
adaptive response (Dalloul and Lillehoj, 2005). Both innate and adaptive immune
responses react to Eimeria invasion of the host intestine (Dalloul and Lillehoj, 2005).
Physical barriers, phagocytes, leukocytes, chemokines and complement components
make up the innate immune response to Eimeria (Dalloul and Lillehoj, 2005).
Anitbodies, lymphocytes and cytokines mediate the adaptive immune response to
Eimeria (Dalloul and Lillehoj, 2005). In the naïve host, coccidia activates the antigenpresenting cells (APCs) dendritic cells and macrophages (Lillehoj, 1998). The APCs then
produce chemokines and cytokines (Lillehoj, 1998). In hosts that have previously been
infected with coccidia, after Eimeria enters the gut, the adaptive immunity inhibits further
development (Trout and Lillehoj, 1994).
A number of studies have shown that T cells are the primary effectors of
immunity to Eimeria (Lillehoj, 1987). T cells in adaptive immune response to coccidia
have been shown to be very important (Lillehoj, 1998). Cd8+ IELs were detected in
16 chickens given both a primary and secondary infection (Lillehoj and Bacon, 1991). The
increase in CD8+ cells correlated with reduced oocyst excretion (Lillehoj and Bacon,
1991). Additionally, studies have shown that CD4+ IELs increased 7 days after a primary
infection, and a higher number of CD8+ IELS were observed after a secondary infection,
suggesting that CD8+ IELs may contribute to adaptive immunity to Eimeria (Lillehoj,
1994).
Salmonella
The genus Salmonella is a gram-negative, non-spore-forming, rod-shaped bacteria
from the Enterobacteriaceae family (Fabrega & Vila, 2013). These bacteria have
diameters of .7 to 1.5 μm , lengths from 2 to 5 μm and peritrichous flagella that are all
around the cell body (Fabrega & Vila, 2013). Salmonella are chemoorganotrophs,
meaning that they get energy from oxidation and reduction reactions using organic
sources (Fabrega & Vila, 2013).
There are two species of Salmonella: Salmonella bongori and Salmonella
enterica. S. enterica can be divided into six subspecies:
S.enterica subsp.enterica (I), S.enterica subsp. salamae (II), S.enterica subsp. arizonae (I
IIa), S. enterica subsp. diarizonae (IIIb), S. enterica subsp. houtenae (IV), and S.
entericasubsp. indica (VI) (Fabrega and Vila, 2013)..
Almost all Salmonella organisms that cause disease in humans and domestic
animals belong to S. enterica subspecies enterica (I). S. enterica serotypes can be divided
into two groups: typhoidal and nontyphoidal. The typhoidal serotype can cause enteric
17 fever in humans. The more common nontyphoidal serotype causes diarrheal disease and
infect a wide range of animal hosts (Ohl and Miller, 2001).
S. Enteritidis and S. Typhimurium are the most commonly isolated nontyphoidal
serotypes in clinical practice (Fabrega and Vila, 2013). S. Enteritidis and S. Typhimurium
rarely cause clinical disease in chickens, but can colonize the gut of poultry (Barrow et
al., 1987).
Approximately 40,000 cases of the Salmonella-caused disease salmonellosis are
reported each year in the United States, although the real number may be 30-fold greater
(Fabrega & Vila, 2013). The illness occurs most commonly in young children, the
elderly, and those with compromised immune system. Acute salmonellosis causes 400
deaths in humans a year in the United States (Fabrega and Vila, 2013). Infection with
salmonellosis is caused by the interactions of the pathogen with multiple environments,
beginning from the hen house, to the poultry plant facility, and finally to the poultry
product in the customer’s home (Guard-Petter, 2001). Salmonella is shed in the feces and
can be spread by horizontal transmission to other birds by fecal-oral routes (Humphrey,
1988). Salmonella can also be spread by feces or infected intestinal contents spilling and
contaminating the meat. Additionally, Salmonella can colonize the reproductive tract,
leading to the contamination of eggs (Humphrey et al., 1988).
Infection from S. Enteritidis and S. Typhimurium, which begins from the
ingestion of the organism, have similar virulence mechanisms in regards to cellular
invasion, survival and growth within the host (Guard-Petter, 2001). To protect itself from
acidity of the stomach, S. Enteritidis activates an acid tolerance response which results in
18 a pH-homeostatic function that maintains the intracellular pH at values higher than the
extracellular environment (Foster & Hall, 1991).
The salmonellae travels through the intestinal mucus layer before adhering to
intestinal epithelial cells (Fabrega and Vila, 2013). After the adhesion, the engaged host
cell signals pathways that lead to cytoskeletal rearrangement (Francis et al., 1992). These
rearrangements disrupt the epithelial brush border, inducing the formation of membrane
ruffles that engulf adherent bacteria vesicles called Salmonella-containing vacuoles
(SCVs) where the Salmonella cells can survive and replicate (Garcia-del Portillo and
Finlay, 1995). The SCVs transports to the basolateral membrane and releases salmonella
cells into the submucosa. Phagocytes internalize the bacteria and are moved within an
SCV again. These phagocytes can move through the lymph and bloodstream, facilitating
a systemic infection (Fabrega and Vila, 2013).
In mammalian hosts, type III secretion systems play an important role in host cell
invasiveness and the production of proinflammatory cytokines (Darwin and Miller,
1999). The type III secretion results in an influx polymorphonuclear cell to the infection.
In chicken cells infected with S. Typhimurium, S. Enteritidis or S. Gallinarum, IFN-γ
production differed little compared to uninfected cells. IL-1β production had little effect
on S. Typhimurium and had a slight reduction with S. Gallinarum and S. Enteritidis. S.
Typhimurium and S. Enteritidis caused an eight to tenfold increased in IL-6 expression,
suggesting that that both S. Typhimurium and S. Enteritidis produced a strong
inflammatory effect. S. Gallinarum, in contrast, did not cause an increase in IL-6 (Kaiser
et al., 2000).
19 S. Enteritidis flagellin (FliC) activates monocytes to produce proinflammatory
cytokines (Moors et al, 2001). Lipopolysaccharides (LPS), a well-studied immune
stimulatory component of gram-negative bacteria, signals Toll-like receptor 4 (TLR4).
HeNC2 cells stimulated with LPS in the presence of a neutralizing anti-TLR4
monoclonal antibody reduced inflammatory TNF-α and nitric oxide production (Moors et
al., 2001). In contrast, FliC in the presence of anti-TLR4 has minimal effect on TNF-α
and nitric oxide production, suggesting that Flic may signal a toll-like receptor distinct
from TLR4 (Moors et al., 2001).
Immune Responses to Salmonella
Leghorn chicks inoculated on day of hatch with S. Enteritidis had an increase in S.
Enteritidis-specific mucosal immunoglobulin A (IgA) 14 and 28 days post-challenge and
an increase in number of gut-associated T cells 14, 28 and 56 days post-challenge (Sheela
et al., 2003). These results suggest that S. Enteritidis in chickens induces both mucosal
and systemic responses (Sheela et al., 2003).
S. Enteritidis infects chickens most commonly through contaminated feed and
feces. The infection is initiated by extensive colonization of S. Enteritidis in the intestine
(Carter and Collins, 1974). S. Enteritidis colonization can persist for as long as 18 weeks
in the intestine postinoculation in hens (Gast and Benson, 1995). After colonization
within the intestine, S. Enteritidis can spread to the liver, spleen, ovary and oviduct
postinoculation (Barrow, 1991; Gast and Beard, 1990). The persistence of S. Enteritidis
in infected laying hens contributes to the contamination of shell eggs (Gast and Beard,
1990).
20 The development of effective vaccines in chickens has been hindered due to
limited knowledge of the immune responses against Salmonella in chickens (Sheela et al.,
2003). The mucosal immune system of the intestine, which includes mucosal
immunoglobulin A (IgA) and mucosa-associated lymphocytes and leukocytes, form the
first line of defense against S. Enteritidis infection. Humoral and cell-mediated responses
are critical for the resistance and clearance of S. Enteritidis infection (Barrow, 1992).
Immune suppression of B cell precursors and B cells showed an increase of S. Enteritidis
intestinal shedding rate (Arnold and Holt, 1995). Secretory IgA limits mucosal
colonization of S. Enteritidis by preventing adherence of the bacteria (Shroff et al., 1995).
However, several studies have shown the number of IgA cells and secretory IgA in the
intestine increased slowly over time, suggesting the mucosal humoral immunity may not
be fully developed in newly hatched chicks and take time to mature (Sheela et al., 2003).
Furthermore, IgA response returned to baseline 56 days postinoculation, despite S.
Enteritidis infection still persisting (Sheela et al., 2003). Lymphocytes in the peripheral
blood and spleen were not altered by S. Enteritidis infection, suggesting that the mucosal
IgA response by S. Enteritidis may be a primary humoral response (Sheela et al., 2003).
S. Enteritidis is a facultative intracellular bacterium, suggesting that cell-mediated
immunity additionally plays a major role during Salmonella infection (George et al.,
1987). CD3+, CD4+ and CD8+ T cells have shown to proliferate in the reproductive tract
of hens infected with S. Enteritidis (Withanage et al., 1998). The increase in CD3+ T
cells may suggest that S. Enteritidis infection either stimulates gut-associated T cells to
expand or recruits more T cells to the infection (Sheela et al., 2003). However, T-cell
21 immunosuppression showed no significant effect of S. Enteritidis infection in chickens,
therefore the role of T cells in response to S. Enteritidis infection is still unclear (Arnold
and Holt, 1995). Sheela et al. (2003) suggests that the ineffectiveness of T cells in S.
Enteritidis infection may be due to S. Enteritidis avoiding or suppressing the activation of
T cells.
Although S. Enteritidis increases titers in the serum, the infection does not
increase mononuclear cells in the blood and spleen, suggesting that S. Enteritidis does not
activate peripheral or circulating lymphocytes specific for S. Enteritidis (Sheela et al.,
2003). These results may explain why Salmonella can persist in the chickens for their
lifetime without elimination from the immune system (Dunlap et al., 1991).
Salmonella Vaccines
S. Enteritidis, which does not normally cause a systemic disease, stimulates high
production of IL-1 and IL-6 from epithelial cells within the intestine (EFSA Scientific
Panel, 2004). S. Gallinarum and S. Pullorum, in contrast, suppresses production by these
cells (EFSA Scientific Panel, 2004). A Th1-type response against S. Enteritidis may
result in immune clearance, whereas a predominantly Th2-response may lead to
prolonged infection in S. Pullorum. Vaccines are required to induce a Th-1 type response
that leads to immunity and clearance after a challenge (EFSA Scientific Panel, 2004).
Salmonella vaccines are rarely used for broiler flocks due the cost of treatment
and short lifespan of the birds (EFSA Scientific Panel, 2004). In Germany, it has been
obligatory to vaccinate all layer chickens during rearing period using live
22 S. Typhimurium or S. Enteritidis vaccines. The use of inactivated Salmonella vaccines in
flocks for poultry meat is more preferable, since it eliminates possibility of live
Salmonella vaccine organisms in the end product. Some live vaccines can persist in birds
for several weeks (EFSA Scientific Panel, 2004).
Oral administration of vaccines in drinking water is more preferable than
parenteral administration by injection, as handling poultry can be time consuming and the
injection itself can be painful (EFSA Scientific Panel, 2004). Previous or simultaneous
live vaccine treatment with antimicrobials given to the chickens may affect the efficacy
of the vaccination (EFSA Scientific Panel, 2004). For reducing shedding and egg
contamination in layers, only inactivated vaccines can be used due to possible egg
contamination by the vaccine strain (EFSA Scientific Panel, 2004). Additionally, another
possible disadvantage of live vaccines is the spread of the strain to the environment or to
humans (EFSA Scientific Panel, 2004).
23 Chapter 3: Effects of Whole Yeast Product Post-Coccidial Challenge
Abstract
Two experiments were conducted to study the effects of whole yeast cell product
supplementation in layer chicken production parameters, fecal and intestinal coccidial
oocyst counts and immune parameters following an experimental coccidial infection. In
experiment I, one-day-old layer chicks were fed three experimental diets with 0, 0.1 or
0.2% whole yeast cell product. At 21 days of whole yeast cell product feeding, birds were
challenged with live coccidial oocysts, In experiment II, 40-week-old layer hens were fed
three experimental diets with 0, 0.05 or 0.1% whole yeast cell product and challenged
with live coccidial oocysts at 21 d of whole yeast cell product feeding.
In experiment I, supplementation with whole yeast product numerically increased
(P = 0.08) body weight gain post-coccidial challenge and had no significant effect on
feed consumption. Supplementation with whole yeast cell product decreased (P < 0.05)
the fecal coccidial oocyst count at 7 and 8 days post-coccidial challenge.
Supplementation with whole yeast cell product did not alter CD4+ and CD8+ cell
populations in the spleen or cecal tonsils post-coccidial challenge. In experiment II,
supplementation with whole yeast cell product did not significantly alter body weight
24 gain or feed consumption post-coccidial challenge. Supplementation with whole yeast
cell product decreased intestinal coccidial oocyst count (P < 0.05) at 5, 12 and 28 days
post-coccidial challenge. Supplementation with whole yeast cell product significantly
increased (P < 0.05) CD8+ cell populations and numerically (P = 0.08) increased CD4+
cell populations in the cecal tonsils at 5 days post-coccidial challenge. It could be
concluded that supplementing whole yeast cell product in layer diets can improve body
weight gain, decrease fecal and intestinal oocyst count and increase CD8+ cell
populations in cecal tonsils post-coccidial challenge.
25 Introduction
Whole yeast cell products are derived from yeast species including
“Saccharomyces cerevisiae”, “Torula utilis” and “Pichia guillermondii”
(Shanmugasundaram & Selvaraj, 2012; Sohail et al., 2012). The yeast cell wall contains
the polysaccharides mannan oligosaccharides and β-glucans (Lipke and Ovalle, 1998).
These polysaccharides can have immunomodulatory effects in several species including
poultry (Shanmugasundaram et al., 2013). Yeast products may become important in the
poultry industry for their potential, especially as anticoccidials and antibiotics are
decreasing in use due to the public’s concerns with fear of antibiotic resistance
(Gustafson and Bowen, 1997).
Coccidiosis is a major disease in the poultry industry caused by protozoan
parasites of the genus Eimeria (Dalloul and Lillehoj, 2006). Coccidiosis impairs growth
and feed utilization in poultry, resulting in major losses in productivity (Dalloul and
Lillehoj, 2006). Eimeria parasites causes lesions that impair the intestinal epithelia,
thereby reducing feed efficiency and body weight gain. This leads to severe economic
losses in the poultry industry (Dalloul and Lillehoj, 2006).
β-glucans are glucose polymers that form the structural components in the cell
wall of yeast, fungi, algae and cereal grains including oat and barley (Cox et al., 2010).
The structure of β-glucans from different sources results in differing functions (Volman
et al., 2008). The highly branched structure of 1,3/1,6-β-D-glucans are considered to be
the most effective of the β-glucans in modulating
26 the immune system (Vetvicka and Vetvickova, 2007). β-glucans influence the activity of
immune cells by resembling pathogen-associated molecular patterns (PAMPs) that
stimulate innate immunity (Brown and Gordon, 2003). The β-glucan PAMPs are
recognized by the receptor dectin-1 on macrophages (Brown and Gordon, 2003). This
recognition activates a cascade system leading to the production of proinflammatory
cytokines and chemokines (Brown and Gordon, 2003).
β-glucan supplementation in broilers has resulted in enhanced cell-mediated and
humoral immune responses (Chae et al., 2006; Cox et al., 2010). β-glucan supplemented
birds had lower intestinal coccidial lesion severity and upregulated nitric oxide synthase
(iNOS) expression 14 days post-coccidial challenge (Cox et al., 2010). Upregulated iNOS
mRNA implies increased nitric oxide production, which is an important product of
macrophages for defense against a wide scope of microbes (Ljungman et al., 1998).
Mannan oligosaccharide supplementation has additionally been shown to lower coccidial
infection in broilers (Elmusharaf et al., 2007). The anticoccidial properties of mannan
oligosacharides may result from its ability to improve gut integrity and uniformity due to
lower colonization of harmful pathogens (Hooge, 2004, Huyghebaert et al., 2011).
Shanmugasundaram et al. (2013) previously studied the effect of whole yeast cell
product supplementation post-coccidial challenge in broiler chickens and identified that
whole yeast cell product supplementation can improve production parameters, lower
fecal oocyst count and increase inflammatory cytokines production post-coccidial
infection. Layer chickens have shown to differ from broilers in their immunological
27 responses to antigens (Koenen et al., 2001). The present experiment was conducted to
study the effects of whole yeast cell wall product supplementation on layer production
performance, fecal and intestinal oocyst count and CD4+ and CD8+ cell populations in the
spleen and cecal tonsils following an experimental coccidial infection in unvaccinated
layer chickens.
28 Materials and Methods
Coccidiosis Experiment
Two experiments were conducted to study the effects of whole yeast cell product
supplementation on production parameters and intestinal immune parameters during an
experimental coccidial infection model. All animal protocols were approved by the
Institutional Animal Care and Use Committee at The Ohio State University.
Coccidiosis Experiment I
Birds
One day-old specific pathogen-free White Leghorn birds were randomly
distributed to one of three dietary treatments with 0, 0.1 or 0.2 % whole yeast cell product
(CitriStim, ADM, Quincy, IL). At 21 days of age, the birds were weighed individually to
identify birds of similar sizes to be used in the coccidial challenge studies. Six birds per
treatment (n = 6) were challenged with coccidiosis after 21 days of whole yeast cell
product feeding. Immediately after coccidial challenge, birds were placed in individual
battery cages (total of 36 battery cages).
Coccidial infection and production parameters post-coccidial infection
At 21 days of age, six birds from each treatment group were orally gavaged with
1 X 105 live coccidial oocysts (Inovocox, Pfizer Animal Health, NY) in 200 µl PBS
(Annamalai and Selvaraj, 2012). The birds were weighed individually at 0 and 9 d post-
29 coccidial challenge to analyze body weight gain of different treatment groups. Feed
consumption was measured at 9 d post-coccidial challenge.
Effect of whole yeast cell product supplementation on fecal coccidial oocyst count postcoccidial challenge
Feces were collected daily from six battery cages per treatment group (n = 6) at
six to nine days post-coccidial challenge. The fecal coccidial oocysts were counted using
a salt flotation technique and analyzed for the total number of coccidial oocysts using a
McMaster chamber as described previously (Annamalai and Selvaraj, 2012).
Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell populations in
the cecal tonsils post-coccidial challenge
CD4+ and CD8+ cell populations in cecal tonsils were analyzed. At nine days postcoccidial challenge, cecal tonsils were collected from six birds per treatment group (n =
6). Cells were collected from cecal tonsils using a 0.45 μm cell strainer (Fisher
Scientific). Cells from each sample were placed into 5 ml of RPMI, centrifuged at 3000
RPM for 5 minutes, resuspended and centrifuged again at 3000 RPM for 5 minutes. Cells
were then resuspended in wash buffer (1xPBS, 2mM EDTA, 1.5% FBS) at a
concentration of 106 cells per well. For the CD4+/CD8+ plate, 106 cells were added to each
well containing CD4+ (1:200 dilution) and CD8+ (1:450 dilution) and then incubated for
20 minutes at 4 °C. Plates were then centrifuged at 2000 RPM for 3 minutes. Cells were
washed 3 times and
30 then analyzed by flow cytometry using cytosoft software (Guava Easycyte, Millipore,
Billerica, MA) as described previously (Shanmugasundaram and Selvaraj, 2012).
Coccidiosis Experiment II
Birds
Specific pathogen-free 40-week-old layer hens were fed experimental diets with
0, 0.05 or 0.1% whole yeast cell product (Citristim, ADM, Quincy, IL). At 28 days of
whole yeast cell product feeding, 15 birds per treatment were challenged with
coccidiosis. The experimental design, animal husbandry, and coccidial challenge
protocols were similar to Coccidiosis Experiment I.
Effect of whole yeast cell product supplementation on intestinal content coccidial oocyst
count post-coccidial challenge
At 5, 12 and 28 days post-coccidial challenge, intestinal content were collected
from five birds per treatment group (n = 5), enriched for coccidial oocysts using a salt
flotation technique and analyzed for total number of coccidial oocysts using a McMaster
chamber as described previously (Annamalai and Selvaraj, 2012).
31 Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell populations in
the spleen and cecal tonsils post-coccidial challenge
At 5, 12 and 28 d post-coccidial challenge, cecal tonsils were collected from five
birds per treatment group (n = 5). The protocol for analysis of CD4+ and CD8+ cell
populations were as described in Coccidial Experiment I.
Statistical analysis
A one-way ANOVA (JMP, SAS, Cary, NC) was used to examine the effect of
whole yeast cell product supplementation on dependent variables. When main effects
were significant (P <0.05), differences between means were analyzed by Tukey’s least
square means comparison. Data was trimmed for outliers.
32 Results
Coccidiosis Experiment I.
Effect of whole yeast product supplementation on production parameters pre- and postcoccidial challenge
Supplementation with whole yeast cell product did not significantly increase the
body weight gain between 0-21 d of age. Supplementation with whole yeast cell product
numerically (P = .08) increased body weight gain by 32% between 0 and 9 days postcoccidial challenge (Fig. 1). Feed consumption was not significantly different between
the experimental groups at 9 days post-coccidial challenge.
Effect of whole yeast cell product supplementation on fecal oocyst count post-coccidial
challenge
Supplementation with whole yeast cell product decreased (P = 0.05) the fecal
coccidial oocyst count at seven through eight days post-coccidial challenge (Fig. 2).
Supplementation with whole yeast cell product numerically (P = 0.18) lowered fecal
oocyst count by 75% at nine days post-coccidial challenge.
Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell populations
the cecal tonsils
Supplementation with whole yeast cell product did not alter (P > 0.05) CD4+ and
CD8+ populations in the cecal tonsils at nine days post-coccidial infection.
33 Coccidiosis Experiment II.
Effect of whole yeast product supplementation on production parameters pre- and postcoccidial challenge
Supplementation with whole yeast cell product did not significantly increase body
weight gain at 21 days of feeding. Body weight gain and feed consumption were not
significantly different between the experimental groups at 5, 12 and 28 d post-coccidial
challenge.
Effect of whole yeast cell product supplementation on intestinal content oocyst count
post-coccidial challenge
Supplementation with whole yeast cell product decreased (P < 0.01) the intestinal
content coccidial oocyst count at 5, 12 and 28 days post-coccidial challenge compared to
the challenged birds supplemented with 0% whole yeast cell product supplementation
(Fig. 3).
Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell populations in
the cecal tonsils
Supplementation with whole yeast cell product increased CD8+ cell populations
(P < 0.05) at 5 days post-coccidial challenge (Fig. 4). Supplementation with whole yeast
cell product increased CD4+ cell populations numerically (P = 0.13) at 5 days postcoccidial challenge (Fig. 4). Supplementation with whole yeast cell product did not alter
(P > 0.05) CD4+ and CD8+ cell populations at 12 and 28 days post-coccidial challenge.
34 Discussion and Conclusion
This experiment studied the effects of whole yeast cell product supplementation
on layer chicken production parameters, fecal and intestinal content coccidial oocyst
count and immune parameters following an experimental coccidial infection in
unvaccinated layer chickens. Whole yeast cell product supplementation improved the
production performance, decreased the fecal and intestinal content oocyst count and
increased CD8+ cell populations in the cecal tonsils.
The results of this experiment are similar to a study by Elmusharaf et al. (2007),
in which day-old broilers were supplemented with a yeast cell wall product and
challenged at eight days of age with Eimeria tenella. The study found that birds
supplemented with yeast cell wall product had reduced oocyst excretion, indicating that
the yeast cell wall may have anticoccidial characterisics (Elmusharaf et al., 2007).
Anticoccidial effects due to mannan oligosaccharides within the yeast cell wall may be
caused by increased villi length and improved integrity and uniformity of the gut, as seen
in previous studies with chickens fed mannan oligosaccharide-supplemented diets
(Hooge, 2004). Mannan oligosaccharide supplementation may counteract the symptoms
of coccidial infection such as reduced weight gain and compromised intestinal wall
(Mcdougald, 2003; Chapman et al., 2004),
The results of our experiment observed a significant increase in CD8+ cell
populations and a numerical increase in CD4+ cell populations 5 days post-coccidial
challenge. Studies have shown that T cells in the adaptive immune response are the
35 primary response to Eimeria (Lillehoj et al., 1998). CD8+ T intraepithelial lymphocytes
(IELs) were detected in chickens after both a primary and secondary infection (Lillehoj
and Bacon, 1991). The increase in CD8+ cells correlated with reduced oocyst excretion
(Lillehoj and Bacon, 1991). Additionally, studies have shown that CD4+ IELs increased
seven days after a primary infection and a higher number of CD8+ IELs were observed
after a secondary infection, further suggesting that CD8+ IELs may contribute to adaptive
immunity to Eimeria (Lillehoj and Trout, 1994).
The increase in CD4+ and CD8+ T cells in the cecal tonsils of the whole yeast cell
product supplemented chickens may be due to both the ability of β-glucans and mannan
oligosaccharides to enhance immunity (Brown and Gordon 2003; Ferket, 2002).
Β-glucans derived from yeast resembles pathogen-associated molecular patterns
(PAMPs) that stimulate innate immunity (Brown & Gordon, 2003). Additionally some
studies have shown that mannan oligosaccharides stimulate gut associated and systemic
immunity by acting as a non-pathogenic microbial antigen, giving an adjuvant-like effect
(Ferket et al., 2002).
It could be concluded that supplementing whole yeast cell products to layer diets
can improve production parameters, decrease fecal oocyst count and increase CD8+ cell
populations in the cecal tonsils post-coccidial infection.
Acknowledgements
Animal Husbandry help from K. Patterson and J. Sidle and technical help from R.
Shanmugasundaram are acknowledged.
36 Chapter 4: Effects of Whole Yeast Cell Product Supplementation post-Salmonella
Challenge
Abstract
This experiment studied the effects of whole yeast cell product supplementation
on broiler production parameters, S. Enteritidis colony forming units from cecal content,
relative proportions of Salmonella, Bifidobacteria and Lactobacillus within the cecal
contents and immune parameters following an experimental S. Enteritidis infection. Dayold birds were fed experimental diets with 0, 0.1 or 0.2% whole yeast cell product. At 21
days of age, birds were challenged with 1x109 CFU/ml S. Enteritidis. Supplementation
with whole yeast cell product had no significant effect on body weight gain or feed
consumption post-Salmonella challenge. Supplementation with whole yeast cell product
increased (P < 0.05) relative proportion of Lactobacillus in the cecal content 7 days postSalmonella challenge and did not significantly alter relative proportion of Bifidobacteria
post-Salmonella challenge. Whole yeast cell product supplementation decreased (P <
0.05) IL-10 and TNF-α and increased IL-1β expression in the cecal tonsils postSalmonella challenge. Whole yeast cell product supplementation decreased (P < 0.05)
CD4+ and CD8+ cell populations in the cecal tonsils 14 days post-Salmonella infection.
Whole yeast cell product supplementation decreased (P < 0.05) villi lengths and crypt
depths in the jejunum 7 days post-Salmonella challenge. It could be concluded that
supplementing whole yeast cell product to broiler diets can significantly alter gut
37 microflora in the cecal contents, cytokine mRNA amounts and CD4+ and CD8+ cell
populations in the cecal tonsils post-Salmonella challenge.
38 Introduction
Whole yeast cell products are derived from several species of yeast such as
Saccharomyces cerevisiae or Pichia guilliermondii. Whole yeast cell products are rich in
mannan oligosaccharides, β-glucan, D-mannose, alpha methyl-D-mannoside and several
other compounds (Shanmugasundaram and Selvaraj, 2012). The polysaccharides mannan
oligosaccharide and β-glucan have immunomodulatory effects when supplemented either
individually or as a mixture with other compounds as immune stimulators in several
species including poultry (Shanmugasundaram et al., 2013).
Mannan oligosaccharides have the ability to agglutinate gram-negative pathogenic
bacteria containing type-2 fimbriae (including Salmonella and E. Coli), resulting in the
pathogenic bacteria attaching to the mannan oligosaccharide product and moving out of
the intestine as opposed to adhering to the host’s intestinal epithelial cells (Badia et al.,
2013). β-glucans derived from yeast resemble pathogen-associated molecular patterns
(PAMPs) that when recognized by the innate immune system can trigger a cascade
reaction that results in an increase in inflammatory cytokines such as IL-1β and TNF-α
(Brown and Gordon, 2003).
Salmonella enterica serotype Enteritidis is one of the most commonly isolated
nontyphoidal serotypes of Salmonella (Fabrega and Vila, 2013). S. Enteritidis rarely
causes clinical disease in chickens, but can colonize the gut of poultry, eventually
affecting the poultry plant facility and the final poultry product in the customer’s home
(Barrow et al., 1987; Humphrey, 1988). Approximately 40,000 cases of Salmonellacaused disease salmonellosis are reported in the United States (Fabrega and Vila, 2013).
39 Acute salmonellosis in humans causes 400 deaths a year in the United States (Fabrega
and Vila 2013). Salmonella can be spread by feces or infected intestinal contents spilling
and contaminating the meat (Humphrey, 1988). Because most Salmonella vaccines do
not completely clear S. Enteritidis colonization in chickens, the commercial poultry
production industry attempts to control S. Enteritidis infections by supplementing
vaccination programs with probiotics or prebiotics (Davies and Breslin, 2003; Patterson
and Burkholder, 2003). Additionally, prebiotics may serve as a substitute for antibiotics,
as antibiotic use is decreasing due to concern of antibiotic resistance (Gustafason and
Bowen, 1997).
Fernandez et al. (2002) observed that day-old broiler chicks supplemented with
2.5% mannose-oligosaccharide and challenged at one week of age with S. Enteritidis had
lower S. Enteritidis caecal colonization compared to birds fed the control diet at two
weeks post-challenge. In broilers supplemented with whole yeast cell product and
challenged with coccidiosis, increased anti-inflammatory cytokines and decreased
inflammatory cytokines in the cecal tonsils post-coccidial infection were observed
(Shanmugasundarm and Selvaraj, 2012a). The present experiment was conducted to
study the effects of whole yeast cell product supplementation on broiler production
performance, jejunum villi length and crypt depth, S. Enteritidis colony forming units,
relative proportions of gut microflora in the cecal content, inflammatory and antiinflammatory cytokine expression in the cecal tonsils, and CD4+ and CD8+ cell
populations in the cecal tonsils following an experimental S. Enteritidis infection in
unvaccinated broiler chickens.
40 Materials and Methods
Salmonella Experiment
An experiment was conducted to study the effects of whole yeast cell product
supplementation on production parameters and intestinal immune parameters during an
experimental Salmonella infection model. All animal protocols were approved by the
Institutional Animal Care and Use Committee at The Ohio State University.
Birds
Day-old specific pathogen-free broiler chickens were provided (Gerber Farms,
Kidron, OH). All birds were given ad libitum water and feed, housed in battery cages and
raised using standard animal husbandry practices. All animal protocols were approved by
the Institutional Animal Care and Use Committee at The Ohio State University. 72 birds
were individually weighed, wing banded, and distributed evenly into 18 battery cages.
Birds were assigned one of three diets: 0, 0.1 or 0.2% whole yeast cell product (n = 6
battery cages). At 21 days of age, 24 birds per diet group were challenged with S.
Enteritidis. Birds that received the challenge were placed in a separate room to avoid
contamination of control group. For both rooms, birds were placed in pairs into a total of
18 separate cages and continued their previous assigned diets of 0, 0.1 or 0.2% whole
yeast cell product supplementation (n = 6).
41 Salmonella infection
At 21 days of age, 24 birds from each treatment group were orally challenged
with 150 ul of 1x109 CFU/ml S. Enteritidis to induce a Salmonella infection. Birds were
previously tested negative for Salmonella colonization by cloacal swab sampling. The
birds were weighed 0, 7 and 14 days post-Salmonella challenge to analyze body weight
gain of different treatment groups. Feed consumption was measured at 7 and 14 days
post-Salmonella challenge.
Effect of whole yeast cell product on Salmonella colonization formation units in cecal
contents post-Salmonella challenge
Culture plates with XLD agar were prepared on the day of collection. During
sample collection, cecal contents were placed in a separate plastic bag containing two ml
of peptone water. Samples were brought to the lab directly after the collection. Each cecal
content sample was massaged in the plastic bag to spread bacteria around as much as
possible. Serial dilutions were done for each sample. The dilutions 100, 101, 102, and 104
were plated for each sample (100 ul of each solution were put onto each plate). Plates
were then incubated at 37 °C for 24 hours. At 24 hours, colonies were counted (Desmidt
et al., 1998).
Effect of whole yeast cell product supplementation gut microflora post-Salmonella
challenge
At 7 and 14 days post-Salmonella challenge, cecal content was collected from six
birds per treatment (n = 6). Cecal contents (0.2 g) were diluted in 10 mL of sterile PBS
42 and centrifuged at 14000 RPM for two minutes to remove debris. The pellet was then
resuspended in EDTA and treated with lysozyme (20 mg/ml) for 45 minutes at 37°C.
After incubation, samples were centrifuged at 14000 RPM for two minutes and
supernatant discarded. Samples were then treated with lysis buffer and Proteinase K
(20mg/ml) for five minutes at 80°C. 6M NaCl and isopropanol were added to the cell
lysate and centrifuged at 14000 RPM for two minutes. DNA pellets were resuspended
and washed in 70% ethanol and then resuspended in TE buffer. Extracted DNA samples
were stored at -20°C (Amit-Romach et al., 2004). Cecal microflora was analyzed by realtime PCR as described earlier (Selvaraj et al., 2010). Bacterial primers are described in
Table 1.
Effect of whole yeast cell product supplementation on CD4+, CD8+ and CD4+CD25+ cell
populations in the cecal tonsils post-Salmonella challenge
Regulatory T cells, CD4+ and CD8+ populations of cecal tonsils were analyzed.
Cecal tonsils were stored in RPMI + Penicillin-Streptomycin at 4°C overnight. CD4+ and
CD8+ cells were prepared as described in the Coccidiosis Experiment. To analyze
regulatory T cells, 106 cells were added to each well containing CD25+ antibodies (1 μg
per well) and then incubated for 40 minutes at 4 °C. Plates were then centrifuged at 2000
RPM for three minutes. Cells were washed three times, then analyzed by flow cytometry.
Protocol for analysis of CD4+, CD8+ and CD25+ cells using flow cytometry were as
described in the Coccidiosis Experiment.
43 Effect of whole yeast cell product supplementation on IL-1β, IL-10, TNF-α and IL-6
mRNA expression in the cecal tonsils post-Salmonella challenge
At 7 and 14 days post-Salmonella challenge, total RNA was collected from cecal
tonsils (n = 6). RNA was then reverse transcribed into cDNA (Selvaraj and Klasing,
2006). The mRNA was analyzed for IL-1β, IL-10, IL-6 and TNF-α by real-time PCR
(iCycler, BioRad, Hercules, CA) using SyBr green after normalizing for β-actin mRNA.
Primers are described in Table 2. The annealing temperature for IL-10 was 57.5°C. The
annealing temperature for IL-1β, TNF-α and β-actin was 57°C. Fold change from the
reference was calculated using the comparative Ct method so that 2(Ct Sample - Housekeeping)/2(Ct
Reference – Housekeeping)
, where Ct is the threshold cycle (Schmittgen and Livak, 2008). The Ct
was determined by iQ5 software (Biorad) when the fluorescence rises exponentially 2fold above the background.
Effect of whole yeast cell product supplementation on jejunum villi length and crypt
depth post-Salmonella challenge
Six jejunum samples per treatment group were collected (cut from the end of the
duodenal loop and before the Meckel’s diverticulum) and stored in 10% formalin at 7 and
14 d post-Salmonella challenge. Samples were dehydrated at room temperature in a
graded series of alcohols (15 min in 50% ethanol, 15 min in 70% ethanol, 15 min in 96%
ethanol, 30 min in 100% ethanol with one change at 15 min), cleared in Pro-par
(Anatech, Battle Creek, MI) for 45 min with two changes at 15 and 30 min and infiltrated
with paraffin at 60 °C overnight with one change at 15 min using a Leica TP 1020 tissue
44 processor (GMI Inc., Ramsey, MN). Paraffin blocks were cut into 5 μm cross-sections
and mounted on frosted slides. Slides were then stained with hematoxylin and eosin
(Velleman et al., 1998). Cross sections were viewed using CellSense Imaging software
(Olympus America, Central Valley, PA) to measure villi length and crypt depth. Five villi
and crypts per section and five sections per sample were analyzed (total of 25 villi and
crypts per bird).
Statistical analysis
A one-way ANOVA (JMP, SAS, Cary, NC) was used to examine the effect of
CitriStim supplementation on dependent variables. When main effects were significant (P
<0.05), differences between means were analyzed by Tukey’s least square means
comparison. Data was trimmed for outliers.
45 Results
Effect of whole yeast cell product supplementation on production parameters pre- and
post-Salmonella challenge
Supplementation of whole yeast cell product did not significantly increase the
body weight gain between 0-21 days of age. Supplementation of whole yeast cell product
did not significantly increase body weight gain or feed consumption 7 or 14 days postSalmonella challenge.
Effect of whole yeast cell product on Salmonella colonization formation units in cecal
content post-Salmonella challenge
Supplementation of whole yeast cell product did not significantly alter Salmonella
colonization formation units in the cecal contents post-Salmonella challenge.
Effect of whole yeast cell product supplementation on gut microflora in the cecal content
post-Salmonella challenge
In the absence of a Salmonella infection, supplementation with whole yeast cell
product decreased relative proportion of Lactobacillus (P < 0.05) compared to the control
(Fig. 5). Supplementation with 0.2% whole yeast cell product increased relative
proportion of Lactobacillus (P < 0.05) compared to the control group supplemented with
0% whole yeast cell product at 7 days post-Salmonella challenge (Fig. 5).
Supplementation with whole yeast cell product did not alter relative proportion of
Lactobacillus (P > 0.5) compared to the control at 14 days post-Salmonella challenge.
Supplementation with whole yeast cell product did not alter relative proportion of
46 Bifidobacteria (P > 0.5) compared to the control at 7 and 14 days post-Salmonella
challenge. Supplementation with whole yeast cell product numerically increased (P =
0.11) relative proportion of S. Enteritidis compared to the control at 7 days postSalmonella challenge (Fig. 6).
Effect of whole yeast cell product supplementation on CD4+, CD8+, and CD4+CD25+
cell populations in the cecal tonsils
In the absence of a Salmonella infection, supplementation with whole yeast cell
product decreased (P < 0.5) CD4+ and CD8+ populations compared to the control at 7
days post-Salmonella challenge (Fig. 7). In the absence of a Salmonella infection,
supplementation with 0.1% whole yeast cell product increased CD4+ populations
compared to the control at 14 days post-Salmonella challenge (Fig. 8). Supplementation
with whole yeast cell product did not alter (P > 0.05) CD8+ cell populations at 14 days
post-Salmonella challenge. Supplementation with whole yeast cell product numerically
(P = 0.08) increased CD4+CD25+ cell populations at 14 days post-Salmonella challenge
compared to both the control and the challenged group supplemented with 0% whole
yeast cell product (Fig. 9).
47 Effect of whole yeast cell product supplementation on IL-1β, IL-10, TNF-α and IL-6
mRNA amounts in the cecal tonsils post-Salmonella challenge
Supplementation with whole yeast cell product did not alter (P > 0.05) IL-1β
mRNA amounts 7 days post-Salmonella challenge. In the absence of a Salmonella
infection, 0.2% whole yeast cell product supplementation decreased (P < 0.05) IL-1β
mRNA amounts in the cecal tonsils at 14 days post-Salmonella challenge (Fig. 10).
Supplementation with 0.1% whole yeast cell product increased (P < 0.05) IL-1β mRNA
amounts in the cecal tonsils compared to both the control and the challenged group
supplemented with 0% whole yeast cell product at 14 days post-Salmonella challenge
(Fig. 10) In the absence of a Salmonella infection, whole yeast cell product
supplementation increased (P < 0.05) IL-10 mRNA amounts in the cecal tonsils
compared to the control at 7 days post-Salmonella infection (Fig. 11). Whole yeast cell
product supplementation increased (P < 0.05) IL-10 mRNA amounts in the cecal tonsils
compared to the control at 7 days post-Salmonella infection (Fig. 11). In the absence of a
Salmonella infection, whole yeast cell product supplementation increased (P < 0.05) IL10 mRNA amounts in the cecal tonsils compared to the control at 14 days postSalmonella infection (Fig. 11). Whole yeast cell product supplementation decreased (P <
0.05) IL-10 mRNA amounts in the cecal tonsils compared to the challenged group
supplemented with 0% whole yeast cell product at 14 days post-Salmonella infection
(Fig. 11). In the absence of a Salmonella infection, 0.2% whole yeast cell product
supplementation increased (P < 0.05) TNF-α mRNA amounts in the cecal tonsils
compared to the control at 7 days post-Salmonella challenge (Fig. 12). Supplementation
48 with 0.2% whole yeast cell product decreased (P < 0.05) TNF-α mRNA amounts in the
cecal tonsils compared to both the control and the challenged group supplemented with
0% whole yeast cell product at 7 days post-Salmonella challenge (Fig. 12). In the absence
of a Salmonella infection, whole yeast cell product supplementation increased (P < 0.05)
IL-6 mRNA amounts in the cecal tonsils compared to the control at 7 and 14 days postSalmonella challenge (Fig. 13).
Effect of whole yeast cell product supplementation on jejunum villi length and crypt
depth post-Salmonella challenge
In the absence of a Salmonella infection, supplementation with 0.2% whole yeast
cell product increased (P < 0.05) jejunum villi length at 7 days post-Salmonella challenge
compared to the control (Fig. 14). Supplementation with whole yeast cell product
decreased (P < 0.05) jejunum villi length compared to both the control and the control
group supplemented with 0% whole yeast cell product at 7 days post-Salmonella (Fig.
14). In the absence of a Salmonella infection, 0.1% whole yeast cell product
supplementation increased (P < 0.05) jejunum crypt depth compared to the control (Fig.
15). Supplementation with whole yeast cell product decreased (P < 0.05) jejunum crypt
depth compared to both the control and the control group supplemented with 0% whole
yeast product at 7 days post-Salmonella challenge (Fig. 15). Supplementation with whole
yeast cell product did not alter jejunum villi length or crypt depth at 14 days postSalmonella challenge (P > 0.05).
49 Discussion and Conclusion
This experiment studied the effects of whole yeast cell product supplementation
on production parameters, gut microflora and immune parameters following an
experimental Salmonella infection in unvaccinated broiler chickens. In the absence of
infection, whole yeast cell product supplementation increased villi lengths and crypt
depths in the jejunu`m, increased IL-10, TNF-α and IL-6 and lowered IL-1β mRNA
amounts in the cecal tonsils compared to the control. Whole yeast cell product
supplementation decreased villi lengths and crypt depths in the jejunum, increased IL-1 β
compared to the challenged group supplemented with 0% whole yeast cell product, and
decreased TNF- α, IL-6, and IL-10 mRNA amounts compared to the challenged group
supplemented with 0% whole yeast cell product. Whole yeast cell product
supplementation increased Lactobacillus post-Salmonella infection. In the absence of
infection, whole yeast cell product supplementation decreased CD4+ and CD8+ cell
populations in the cecal tonsils compared to the control. Supplementation with whole
yeast cell product did not significantly alter CD4+ or CD8+ cell percentage in the cecal
tonsils compared to the challenged group supplemented with 0% whole yeast cell product
7 days post-Salmonella challenge.
Broilers challenged with S. Enteritidis can result in lower weight gain due to a
compromised intestinal wall (Gorham et al., 1994; Dhillon et al., 1999). Prebiotics have
had varied results on body weight gain in broilers. Markovic et al. (2009) observed that
day-old broilers supplemented with yeast cell wall product for 42 days had higher body
weight gain than unsupplemented broilers. Bozkurt et al. (2012) observed similar results
50 with laying hens supplemented with mannan oligosaccharides. Smith et al. (2010)
supplemented mice with mannan oligosaccharides for 12 weeks and did not see
significant differences in body weight gain. In a study by Midilli et al. (2008), day-old
broilers supplemented for 42 days with 0.1% yeast cell wall product did not significantly
increase in feed intake or body weight gain.
Commensal bacteria within the gut, such as Lactobacillus and Bifidobacteria,
protect the host from colonization of pathogenic bacteria such as Salmonella through
several mechanisms. These include competing for epithelial binding sites and nutrients,
strengthening the intestinal immune response and producing antimicrobial bacteriocins
(Guarner and Malagelada, 2003). Prebiotics act as a source of nutrients for commensal
bacteria, therefore reducing pathogen colonization within the gut (Patterson and
Burkholder, 2003). Additionally, the fermentation of prebiotics by intestinal microbes
produces volatile fatty acids, which promote epithelial cell proliferation, enhancing the
integrity of the intestinal wall (Macfarlane et al., 2008). Mannan oligosaccharides have
the ability to agglutinate gram-negative bacteria containing type-1 fimbriae (such as
Salmonella), resulting in the pathogens adsorbing to the mannan oligosaccharide product
and moving out of the intestine as opposed to adhering to the host’s intestinal wall (Badia
et al., 2013). However in the current study, whole yeast cell product supplementation
numerically increased relative proportions of S. Enteritidis in the cecal contents at 7 days
post-challenge. Whole yeast cell products increases IL-10 and decreases IL-1β mRNA
amounts in the cecal tonsils in the absence of an infection (Shanmugasundaram and
Selvaraj, 2012). Increased levels of IL-10 and decreased levels of IL-1β present in the
51 cecal tonsils during the 21 days of whole yeast cell product feeding prior to the
Salmonella infection may have contributed to the increase of S. Enteritidis in the cecal
contents at 7 days post-challenge.
Chicken cell cultures infected with S. Enteritidis showed an eight to tenfold
increased in IL-6 mRNA expression, concluding that S. Enteritidis results in a strong
inflammatory response (Kaiser et al., 2000). The study also showed a slight downregulation of IL-1β during the Salmonella infection. This is interesting, since IL-1β is a
pro-inflammatory cytokine that may act to inhibit Salmonella crossing the intestinal
epithelium (Kaiser et al., 2000). In study by Setta et al. (2012), chickens infected with S.
Enteritidis were associated with an increase in macrophage percentage and an
upregulation of TNF-α and IL-10 in the cecal tonsils. S. Enteritidis results in an increase
in CD4+ cells in the cecal tonsils 4-6 days post-infection in chickens (Setta et al., 2012).
In addition, CD4+ and CD8+ cells have been observed to proliferate in the reproductive
tract of S. Enteritidis infected layer hens (Withanage et al., 1998). The current experiment
observed an increased inflammation in challenged birds supplemented with whole yeast
cell product at 14 days post-challenge. β-glucans and mannan oligosaccharides can
enhance immunity and increase proinflammatory cytokines to the site of infection
(Brown and Gordon 2003; Ferket, 2002).
The current experiment observed that whole yeast cell product supplementation
increased villi lengths in the absence of an infection. In the challenged birds, whole yeast
cell product supplementation decreased villi lengths and crypt depths in infected birds at
7 days post-Salmonella challenge. The current study additionally showed as increase in
52 relative proportions of S. Enteritidis in the cecal tonsils of the challenged birds
supplemented with whole yeast cell products, which may correlate to the shorter villi
lengths and crypt depths that were observed. Broiler chicks hatched from eggs inoculated
with S. Enteritidis had a decrease in villi length and an increase in crypt depth in the
duodenum and ileum during early infection with S. Enteritidis (Andrade et al., 2013).
High crypt depth is related to the turnover of epithelial cells, which may be due to
compensation for cell destruction during an infection (Rose et al., 1992). However, lower
crypt depths in birds infected with Salmonella has also been observed (Rieger et al.,
2014). This may be due to the stress of Salmonella decreasing the absorptive epithelium
of the intestine, resulting in both the reduction of villus height and crypt depth (Yamauchi
et al., 1996). Whole yeast cell product supplementation in unchallenged birds has lead to
in an increase in villi length and decrease in crypt depth in several studies (MoralesLopez et al., 2009; Shanmugasundaram et al., 2012; M’Sadeq et al., 2015).
It could be concluded that supplementing whole yeast cell products to broiler diets
can improve immune parameters and alter gut microflora post-coccidial infection.
Acknowledgements
Animal Husbandry help from K. Patterson and J. Sidle and technical help from R.
Shanmugasundaram are acknowledged.
53 Chapter 5: Conclusions
Whole yeast cell products are derived from yeast species such as “Saccharomyces
cerevisiae” and “Pichia guillermondii” (Shanmugasundaram and Selvaraj, 2012; Sohail
et al., 2012)). Whole yeast cell products contains mannan oligosaccharides, β-glucan, Dmannose, alpha methyl-D-mannoside and several other compounds (Shanmugasundaram
and Selvaraj, 2012). Mannan oligosaccharides and β-glucans have immunomodulatory
effects in several species including poultry (Shanmugasundaram et al., 2013). Mannan
oligosaccharides can agglutinate gram-negative pathogenic bacteria containing type-1
fimbriae (including Salmonella and E. Coli), resulting in the pathogenic bacteria
attaching to mannan oligosaccharides and moving out of the intestine as opposed to
adhering to the host’s intestinal epithelial cells (Badia et al., 2013). β-glucans derived
from yeast resembles pathogen-associated molecular patterns (PAMPs) that when
recognized by the innate immune system triggers a cascade reaction that results in an
increase in proinflammatory cytokines (Brown and Gordon, 2003). The
immunomodulatory effects of whole yeast cell products have important implications in
the poultry industry, especially as anticoccidial and antibiotic use decreases due to the
public’s concern of antibiotic and drug resistance (Gustafson and Bowen, 1997).
54 Coccidiosis is a major disease in poultry caused by protozoan parasites of the
genus Eimeria (Dalloul and Lillehoj, 2006). Eimeria parasites produce lesions that
destroy the intestinal epithelia, thereby reducing feed efficiency and body weight gain.
This leads to severe economic losses in the poultry industry (Paris and Wong, 2013).
Coccidiosis causes the poultry industry a loss of about $800 million a year in the United
States (Sharmen et al., 2010). Anticoccidial drugs are commonly used in the poultry
industry; however Eimeria resistance has developed to all of the anticoccidial drugs that
have been introduced (Allen et al., 1997; Peek and Landman, 2011).
Salmonellosis is a disease caused by the gram-negative bacteria, Salmonella, with
symptoms ranging from diarrhea and fever to life threatening systemic illness (Giannella,
1979). Salmonella enterica serotype Enteritidis is one of the most commonly isolated
nontyphoidal serotypes of Salmonella (Fabrega and Vila, 2013). Although S. Enteritidis
does not commonly cause clinical disease in chickens, the bacteria can colonize the gut of
poultry, which can then affect the poultry plant facility and the final poultry product in
the customer’s home (Barrow et al., 1987; Humphrey, 1988). Approximately 40,000
cases of salmonellosis are reported in the United States annually (Fabrega & Vila, 2013).
Acute salmonellosis in humans causes 400 deaths a year in the United States (Fabrega &
Vila 2013).
The objectives of this thesis were to
(1) Study the effects of whole yeast cell product supplementation in layer chickens
post-coccidial challenge
55 (2) Study the effects of whole yeast cell product supplementation in broiler chickens
post-Salmonella challenge
The study presented in chapter 3 identified production parameters, relative T cell
populations, and coccidial oocyst count in layer pullets and hens supplemented with whole
yeast cell product and challenged with coccidiosis. The objectives of the study were to
evaluate the effects of whole yeast cell product supplementation post-coccidial challenge
on, (1) body weight gain and feed consumption, (2) CD4+ and CD8+ cell populations in the
cecal tonsils and spleen and (3) coccidial oocyst count within the fecal and intestinal
content.
Whole yeast cell product supplementation numerically increased body weight
gain in layer pullets 9 days post-coccidial challenge. Whole yeast did not alter feed
consumption. Whole yeast product supplementation did not have an effect on body weight
gain or feed consumption post-coccidial challenge in layer hens.
In layer pullets, whole yeast cell product supplementation lowered the fecal
coccidial oocyst count at 7, 8 and 9 days post-coccidial challenge. In layer hens, whole
yeast cell product supplementation lowered intestinal content coccidial oocyst count at 5,
12 and 28 days post-coccidial challenge.
In layer pullets, whole yeast cell product supplementation did not alter CD4+ and
CD8+ populations in the cecal tonsils at 9 days post-coccidial infection. In layer hens,
whole yeast product supplementation increased CD4+ and CD8+ populations in the cecal
tonsils 5 days post-coccidial challenge.
56 The study presented in chapter 4 identified production parameters, gut microflora,
relative T cell populations, and cytokine levels in broiler chickens supplemented with
whole yeast cell product and challenged with Salmonella. The objectives of the study were
to evaluate the effects of whole yeast cell product supplementation post-Salmonella
challenge on, (1) body weight gain and feed consumption, (2) Salmonella colony
formation units in the cecal contents, (3) relative proportions of Lactobacillus,
Bifidobacteria and Salmonella in the cecal contents, (4) regulatory T cells, CD4+ and CD8+
cell populations in the cecal tonsils, (5) inflammatory and anti-inflammatory cytokine
expression in the cecal tonsils and (6) jejunum villi length and crypt depth.
Supplementation of whole yeast cell product did not significantly increase body
weight gain or feed consumption post-Salmonella challenge. In the absence of infection,
whole yeast cell product supplementation increased villi lengths and crypt depths in the
jejunum. Whole yeast cell product supplementation decreased villi lengths and crypt
depths in the jejunum 7 days post-Salmonella challenge. Whole yeast cell product
supplementation did not significantly alter villi lengths or crypt depths at 14 days postSalmonella challenge.
Supplementation of whole yeast cell product increased IL-10, TNF-α and IL-6
and lowered IL-1β mRNA amounts in the cecal tonsils in the absence of a Salmonella
infection. Whole yeast product supplementation decreased IL-10 and TNF-α in birds
challenged with Salmonella. Whole yeast product supplementation increased IL-1β
mRNA amounts in the cecal tonsils post-Salmonella challenge. Whole yeast cell product
supplementation decreased CD4+ and CD8+ cell populations in the cecal tonsils 14 days
57 post-Salmonella infection. Supplementation of whole yeast cell product increased relative
proportion of S. Enteritidis 7 and 14 days post-Salmonella challenge. Supplementation of
whole yeast cell product increased Lactobacillus in the cecal contents 7 days postSalmonella challenge.
In conclusion whole yeast cell product supplementation,
1. Improved body weight gain in layer pullets post-coccidial challenge
2. Lowered fecal and intestinal content oocyst count in layer chickens post-coccidial
challenge
3. Lowered CD8+ and CD4+ cell populations in the cecal tonsils post-coccidial
challenge
4. Increased Lactobacillus post-Salmonella infection
5. Decreased CD4+ and CD8+ cell populations in the cecal tonsils post-Salmonella
infection
6. Increased IL-10, TNF-α and IL-6 and lowered IL-1β mRNA amounts in the cecal
tonsils in the absence of a Salmonella infection, while decreasing IL-10, TNF-α
and increasing IL-1β expression in the cecal tonsils post-Salmonella challenge
7. Increased villi lengths and crypt depths in the jejunum in the absence of a
Salmonella infection and decreased villi lengths and crypt depths post-Salmonella
challenge
58 References
Akira, S., Uematsu, S., & Takeuchi, O. (2006). Pathogen recognition and innate
immunity. Cell, 124(4), 783-801.
Allen, P. C., & Fetterer, R. H. (2002). Recent advances in biology and immunobiology of
eimeria species and in diagnosis and control of infection with these coccidian
parasites of poultry. Clinical Microbiology Reviews, 15(1), 58-65.
Andrade, M., Stringhini, J., Minafra-Rezende, C., Andrade, L., de Sá Jayme,V. (2013).
Histomorphometrical evaluation of gastrointestinal tract and performance of ross
broilers hatched from eggs inoculated with salmonella enteritidis phage type
4. Italian Journal of Animal Science, 12(3)
Annamalai, T., & Selvaraj, R. K. (2012). Effects of in ovo interleukin-4-plasmid injection
on anticoccidia immune response in a coccidia infection model of chickens. Poultry
Science, 91(6), 1326-1334.
Annamalai, T., & Selvaraj, R. K. (2012). Effects of in ovo interleukin-4-plasmid injection
on anticoccidia immune response in a coccidia infection model of chickens. Poultry
Science, 91(6), 1326-1334.
Arnold, J. W., & Holt, P. S. (1995). Response to salmonella enteritidis infection by the
immunocompromised avian host. Poultry Science, 74(4), 656-665.
Badia, R., Lizardo, R., Martinez, P., & Brufau, J. (2013). Oligosaccharide structure
determines prebiotic role of beta-galactomannan against salmonella enterica ser.
typhimurium in vitro. Gut Microbes, 4(1), 72-75.
Barker, N., van Oudenaarden, A., & Clevers, H. (2012). Identifying the stem cell of the
intestinal crypt: Strategies and pitfalls. Cell Stem Cell, 11(4), 452-460.
Barrow, P. A. (1991). Experimental infection of chickens with salmonella
enteritidis. Avian Pathology : Journal of the W.V.P.A, 20(1), 145-153.
59 Barrow, P. A. (1992). ELISAs and the serological analysis of salmonella infections in
poultry: A review. Epidemiology and Infection, 109(3), 361-369.
Baurhoo, B., Phillip, L., & Ruiz-Feria, C. A. (2007). Effects of purified lignin and
mannan oligosaccharides on intestinal integrity and microbial populations in the ceca
and litter of broiler chickens. Poultry Science,86(6), 1070-1078.
Becker, P. M., & Galletti, S. (2008). Food and feed components for gut health-promoting
adhesion of E. coli and salmonella enterica. Journal of the Science of Food and
Agriculture, 88(11), 2026-2035.
Bonilla, F. A., & Oettgen, H. C. (2010). Adaptive immunity. The Journal of Allergy and
Clinical Immunology, 125(2 Suppl 2), S33-40.
Bozkurt, M., Kucukyilmaz, K., Catli, A. U., Cinar, M., Bintas, E., & Coven, F. (2012).
Performance, egg quality, and immune response of laying hens fed diets
supplemented with mannan-oligosaccharide or an essential oil mixture under
moderate and hot environmental conditions. Poultry Science, 91(6), 1379-1386.
Brandeis, J. M., Sayegh, M. H., Gallon, L., Blumberg, R. S., & Carpenter, C. B. (1994).
Rat intestinal epithelial cells present major histocompatibility complex allopeptides
to primed T cells. Gastroenterology, 107(5), 1537-1542.
Brown, G. D., & Gordon, S. (2003). Fungal β-glucans and mammalian
immunity. Immunity, 19(3), 311-315.
Cannon, J. G. (2000). Inflammatory cytokines in nonpathological
states. Physiology, 15(6), 298-303.
Carter, P. B., & Collins, F. M. (1974). The route of enteric infection in normal mice. The
Journal of Experimental Medicine, 139(5), 1189-1203.
Chae, B. J., Lohakare, J. D., Moon, W. K., Lee, S. L., Park, Y. H., & Hahn, T. W. (2006).
Effects of supplementation of beta-glucan on the growth performance and immunity
in broilers. Research in Veterinary Science, 80(3), 291-298.
Chapman, H. D. (1998). Evaluation of the efficacy of anticoccidial drugs against eimeria
species in the fowl. International Journal for Parasitology, 28(7), 1141-1144.
Choi, K. D., Lillehoj, H. S., & Zalenga, D. S. (1999). Changes in local IFN-gamma and
TGF-beta4 mRNA expression and intraepithelial lymphocytes following eimeria
acervulina infection. Veterinary Immunology and Immunopathology, 71(3-4), 263275.
60 Cox, C. M., Sumners, L. H., Kim, S., McElroy, A. P., Bedford, M. R., & Dalloul, R. A.
(2010). Immune responses to dietary beta-glucan in broiler chicks during an eimeria
challenge. Poultry Science, 89(12), 2597-2607.
Cummings, J. H., & Macfarlane, G. T. (2002). Gastrointestinal effects of prebiotics. The
British Journal of Nutrition, 87 Suppl 2, S145-51.
Dalloul, R. A., & Lillehoj, H. S. (2006). Poultry coccidiosis: Recent advancements in
control measures and vaccine development. Expert Review of Vaccines, 5(1), 143163.
Darwin, K. H., & Miller, V. L. (1999). Molecular basis of the interaction of salmonella
with the intestinal mucosa. Clinical Microbiology Reviews, 12(3), 405-428.
Davies, R. H., & Breslin, M. (2003). Investigations into possible alternative
decontamination methods for salmonella enteritidis on the surface of table
eggs. Journal of Veterinary Medicine.B, Infectious Diseases and Veterinary Public
Health, 50(1), 38-41.
Desmidt, M., Ducatelle, R., & Haesebrouck, F. (1997). Pathogenesis of salmonella
enteritidis phage type four after experimental infection of young
chickens. Veterinary Microbiology, 56(1-2), 99-109.
Dhillon, A. S., Alisantosa, B., Shivaprasad, H. L., Jack, O., Schaberg, D., & Bandli, D.
(1999). Pathogenicity of salmonella enteritidis phage types 4, 8, and 23 in broiler
chicks. Avian Diseases, 43(3), 506-515.
Diehl, S., Anguita, J., Hoffmeyer, A., Zapton, T., Ihle, J. N., Fikrig, E., et al. (2000).
Inhibition of Th1 differentiation by IL-6 is mediated by SOCS1. Immunity, 13(6),
805-815.
Dinarello, C. A. (2011). Interleukin-1 in the pathogenesis and treatment of inflammatory
diseases. Blood, 117(14), 3720-3732.
Dunlap, N. E., Benjamin, W. H.,Jr, McCall, R. D.,Jr, Tilden, A. B., & Briles, D. E.
(1991). A 'safe-site' for salmonella typhimurium is within splenic cells during the
early phase of infection in mice. Microbial Pathogenesis, 10(4), 297-310.
EFSA Scientific Panel. (2004). Opinion of the Scientific Panel on Biological Hazards on
a request from the Commission related to the use of vaccines for the control of
Salmonella in poultry. The EFSA Journal, 114, 1-74.
61 Elmusharaf, M. A., Peek, H. W., Nollet, L., & Beynen, A. C. (2007). The effect of an infeed mannanoligosaccharide preparation (MOS) on a coccidiosis infection in broilers
[Abstract]. Animal Feed Science and Technology, 134(3) 347-354.
Eustis, S. L., & Nelson, D. T. (1981). Lesions associated with coccidiosis in nursing
piglets. Veterinary Pathology, 18(1), 21-28.
Fabrega, A., & Vila, J. (2013). Salmonella enterica serotype typhimurium skills to
succeed in the host: Virulence and regulation. Clinical Microbiology Reviews, 26(2),
308-341.
Fantasia, M., & Filetici, E. (1994). Salmonella enteritidis in italy. International Journal
of Food Microbiology, 21(1-2), 7-13.
Ferket, P., Parks, C., & Grimes, J. (2002). Benefits of dietary antibiotic and
mannanoligosaccharide supplementation for poultry. Multi-State Poultry Meeting, ,
14.
Fernandez, F., Hinton, M., & Van Gils, B. (2002). Dietary mannan-oligosaccharides and
their effect on chicken caecal microflora in relation to salmonella enteritidis
colonization. Avian Pathology : Journal of the W.V.P.A, 31(1), 49-58.
Francis, C., Starnbach, M., & Falkow, S. (1992). Morphological and cytoskeletal changes
in epithelial cells occur immediately upon interaction with salmonella typhimurium
grown under low‐oxygen conditions.Molecular Microbiology, 6(21), 3077-3087.
GABRIEL, I., LESSIRE, M., MALLET, S., & GUILLOT, J. F. (2006). Microflora of the
digestive tract: Critical factors and consequences for poultry. World's Poultry
Science Journal, 62(03), 499-511.
Garcia-del Portillo, F., & Finlay, B. B. (1995). Targeting of salmonella typhimurium to
vesicles containing lysosomal membrane glycoproteins bypasses compartments with
mannose 6-phosphate receptors. The Journal of Cell Biology, 129(1), 81-97.
Gast, R. K., & Beard, C. W. (1990). Production of salmonella enteritidis-contaminated
eggs by experimentally infected hens. Avian Diseases, 34(2), 438-446.
Gast, R. K., & Benson, S. T. (1995). The comparative virulence for chicks of salmonella
enteritidis phage type 4 isolates and isolates of phage types commonly found in
poultry in the united states. Avian Diseases,39(3), 567-574.
George, A., Nair, R., Rath, S., Ghosh, S. N., & Kamat, R. S. (1987). Regulation of cellmediated immunity in mice immunised with salmonella enteritidis. Journal of
Medical Microbiology, 23(3), 239-246.
62 Giannella, R. A. (1979). Importance of the intestinal inflammatory reaction in
salmonella-mediated intestinal secretion. Infection and Immunity, 23(1), 140-145.
Gorham, S. L., Kadavil, K., Vaughan, E., Lambert, H., Abel, J., & Pert, B. (1994). Gross
and microscopic lesions in young chickens experimentally infected with salmonella
enteritidis. Avian Diseases, 38(4), 816-821.
Guard-Petter, J. (2001). The chicken, the egg and salmonella enteritidis. Environmental
Microbiology, 3(7), 421-430.
Guarner, F., & Malagelada, J. R. (2003). Gut flora in health and disease. Lancet (London,
England), 361(9356), 512-519.
Guehler, S. R., Bluestone, J. A., & Barrett, T. A. Activation and peripheral expansion of
murine T-cell receptor γδ intraepithelial lymphocytes. Gastroenterology, 116(2),
327-334.
Gustafson, R. H., & Bowen, R. E. (1997). Antibiotic use in animal agriculture. Journal of
Applied Microbiology, 83(5), 531-541.
Henderson, B., Poole, S., & Wilson, M. (1996). Bacterial modulins: A novel class of
virulence factors which cause host tissue pathology by inducing cytokine
synthesis. Microbiological Reviews, 60(2), 316-341.
Hibi, M., Nakajima, K., & Hirano, T. (1996). IL-6 cytokine family and signal
transduction: A model of the cytokine system. Journal of Molecular Medicine
(Berlin, Germany), 74(1), 1-12.
Hirano, T., Yasukawa, K., Harada, H., Taga, T., Watanabe, Y., Matsuda, T., et al. (1986).
Complementary DNA for a novel human interleukin (BSF-2) that induces B
lymphocytes to produce immunoglobulin. Nature,324(6092), 73-76.
Hong, Y. H., Lillehoj, H. S., Lee, S. H., Park, D., & Lillehoj, E. P. (2006). Molecular
cloning and characterization of chicken lipopolysaccharide-induced TNF-alpha
factor (LITAF). Developmental and Comparative Immunology, 30(10), 919-929.
Hooge, D. M. (2004). Meta-analysis of broiler chicken pen trials evaluating dietary
mannan oligosaccharide, 1993-2003. Int.J.Poult.Sci, 3(3), 163-174.
Humphrey, T. J., Mead, G. C., & Rowe, B. (1988). Poultry meat as a source of human
salmonellosis in england and wales. epidemiological overview. Epidemiology and
Infection, 100(2), 175-184.
63 Huyghebaert, G., Ducatelle, R., & Van Immerseel, F. (2011). An update on alternatives
to antimicrobial growth promoters for broilers. Veterinary Journal (London,
England : 1997), 187(2), 182-188.
Jakowlew, S. B., Mathias, A., & Lillehoj, H. S. (1997). Transforming growth factor-beta
isoforms in the developing chicken intestine and spleen: Increase in transforming
growth factor-beta 4 with coccidia infection.Veterinary Immunology and
Immunopathology, 55(4), 321-339.
Janardhana, V., Broadway, M. M., Bruce, M. P., Lowenthal, J. W., Geier, M. S., Hughes,
R. J., et al. (2009). Prebiotics modulate immune responses in the gut-associated
lymphoid tissue of chickens. The Journal of Nutrition, 139(7), 1404-1409.
Jeurissen, S. H., Lewis, F., van der Klis, J. D., Mroz, Z., Rebel, J. M., & ter Huurne, A.
A. (2002). Parameters and techniques to determine intestinal health of poultry as
constituted by immunity, integrity, and functionality. Current Issues in Intestinal
Microbiology, 3(1), 1-14.
Kaiser, P., Rothwell, L., Galyov, E. E., Barrow, P. A., Burnside, J., & Wigley, P. (2000).
Differential cytokine expression in avian cells in response to invasion by salmonella
typhimurium, salmonella enteritidis and salmonella gallinarum. Microbiology
(Reading, England), 146 Pt 12, 3217-3226.
Kaspers, B., Lillehoj, H. S., Jenkins, M. C., & Pharr, G. T. (1994). Chicken interferonmediated induction of major histocompatibility complex class II antigens on
peripheral blood monocytes. Veterinary Immunology and Immunopathology, 44(1),
71-84.
Koenen, M. E., Boonstra-Blom, A. G., & Jeurissen, S. H. (2002). Immunological
differences between layer- and broiler-type chickens. Veterinary Immunology and
Immunopathology, 89(1-2), 47-56.
Lesage, G., & Bussey, H. (2006). Cell wall assembly in saccharomyces
cerevisiae. Microbiology and Molecular Biology Reviews : MMBR, 70(2), 317-343.
Lillehoj, H. S. (1987). Effects of immunosuppression on avian coccidiosis: Cyclosporin
A but not hormonal bursectomy abrogates host protective immunity. Infection and
Immunity, 55(7), 1616-1621.
Lillehoj, H. S., & Bacon, L. D. (1991). Increase of intestinal intraepithelial lymphocytes
expressing CD8 antigen following challenge infection with eimeria
acervulina. Avian Diseases, 35(2), 294-301.
64 Lillehoj, H. S., & Trout, J. M. (1994). CD8+ T cell-coccidia interactions. Parasitology
Today (Personal Ed.), 10(1), 10-14.
Lipke, P. N., & Ovalle, R. (1998). Cell wall architecture in yeast: New structure and new
challenges. Journal of Bacteriology, 180(15), 3735-3740.
Ljungman, A. G., Leanderson, P., & Tagesson, C. (1998). (1-->3)-beta-d-glucan
stimulates nitric oxide generation and cytokine mRNA expression in
macrophages. Environmental Toxicology and Pharmacology, 5(4), 273-281.
Macfarlane, G. T., Steed, H., & Macfarlane, S. (2008). Bacterial metabolism and healthrelated effects of galacto-oligosaccharides and other prebiotics. Journal of Applied
Microbiology, 104(2), 305-344.
Markovi, R., Â?efer, D., Krsti, M., & Petrujki, B. (2009). Effect of different growth
promoters on broiler performance and gut morphology. Archivos De Medicina
Veterinaria, 41(2), 163-169.
Martin, A., Lillehoj, H. S., Kaspers, B., & Bacon, L. D. (1994). Mitogen-induced
lymphocyte proliferation and interferon production following coccidia
infection. Avian Diseases, 38(2), 262-268.
McDougald, L. R. (1998). Intestinal protozoa important to poultry. Poultry
Science, 77(8), 1156-1158.
McLin, V. A., Henning, S. J., & Jamrich, M. (2009). The role of the visceral mesoderm
in the development of the gastrointestinal tract. Gastroenterology, 136(7), 20742091.
Mead, G. C., & Adams, B. W. (1975). Some observations on the caecal microflora of the
chick during the first two weeks of life. British Poultry Science, 16(2), 169-176.
Midilli, M., Alp, M., Kocabach, N., Muglah, O., Turan, N., Yilmaz, H., et al. (2008).
Effects of dietary probiotic and prebiotic supplementation on growth performance
and serum IgG concentration of broilers. South African Journal of Animal
Science, 38(1), 21-27.
Moors, M. A., Li, L., & Mizel, S. B. (2001). Activation of interleukin-1 receptorassociated kinase by gram-negative flagellin. Infection and Immunity, 69(7), 44244429.
Morales-Lopez, R., Auclair, E., Garcia, F., Esteve-Garcia, E., & Brufau, J. (2009). Use of
yeast cell walls; beta-1, 3/1, 6-glucans; and mannoproteins in broiler chicken
diets. Poultry Science, 88(3), 601-607.
65 Morris, B. C., Danforth, H. D., Caldwell, D. J., Pierson, F. W., & McElroy, A. P. (2004).
Intestinal mucosal mast cell immune response and pathogenesis of two eimeria
acervulina isolates in broiler chickens. Poultry Science, 83(10), 1667-1674.
M'Sadeq, S. A., Wu, S., Swick, R. A., & Choct, M. (2015). Towards the control of
necrotic enteritis in broiler chickens with in-feed antibiotics phasing-out
worldwide. Animal Nutrition, 1(1), 1-11.
Munyaka, P. M., Echeverry, H., Yitbarek, A., Camelo-Jaimes, G., Sharif, S., Guenter,
W., et al. (2012). Local and systemic innate immunity in broiler chickens
supplemented with yeast-derived carbohydrates. Poultry Science, 91(9), 2164-2172.
Murai, M., Turovskaya, O., Kim, G., Madan, R., Karp, C. L., Cheroutre, H., et al. (2009).
Interleukin 10 acts on regulatory T cells to maintain expression of the transcription
factor Foxp3 and suppressive function in mice with colitis. Nature
Immunology, 10(11), 1178-1184.
Paris, N. E., & Wong, E. A. (2013). Expression of digestive enzymes and nutrient
transporters in the intestine of eimeria maxima-infected chickens. Poultry
Science, 92(5), 1331-1335.
Patterson, J. A., & Burkholder, K. M. (2003). Application of prebiotics and probiotics in
poultry production. Poultry Science, 82(4), 627-631.
Peek, H. W., & Landman, W. J. (2011). Coccidiosis in poultry: Anticoccidial products,
vaccines and other prevention strategies. The Veterinary Quarterly, 31(3), 143-161.
Rieger, J., Janczyk, P., Hunigen, H., Neumann, K., & Plendl, J. (2015). Intraepithelial
lymphocyte numbers and histomorphological parameters in the porcine gut after
enterococcus faecium NCIMB 10415 feeding in a salmonella typhimurium
challenge. Veterinary Immunology and Immunopathology, 164(1-2), 40-50.
Roers, A., Siewe, L., Strittmatter, E., Deckert, M., Schluter, D., Stenzel, W., et al. (2004).
T cell-specific inactivation of the interleukin 10 gene in mice results in enhanced T
cell responses but normal innate responses to lipopolysaccharide or skin
irritation. The Journal of Experimental Medicine, 200(10), 1289-1297.
Rose, M. E., Millard, B. J., & Hesketh, P. (1992). Intestinal changes associated with
expression of immunity to challenge with eimeria vermiformis. Infection and
Immunity, 60(12), 5283-5290.
Russo, P., Lopez, P., Capozzi, V., de Palencia, P. F., Duenas, M. T., Spano, G., et al.
(2012). Beta-glucans improve growth, viability and colonization of probiotic
microorganisms. International Journal of Molecular Sciences, 13(5), 6026-6039.
66 Sabat, R., Grutz, G., Warszawska, K., Kirsch, S., Witte, E., Wolk, K., et al. (2010).
Biology of interleukin-10. Cytokine & Growth Factor Reviews, 21(5), 331-344.
Schmittgen, T. D., & Livak, K. J. (2008). Analyzing real-time PCR data by the
comparative C(T) method. Nature Protocols, 3(6), 1101-1108.
Schneider, K., Klaas, R., Kaspers, B., & Staeheli, P. (2001). Chicken interleukin-6.
cDNA structure and biological properties. European Journal of Biochemistry /
FEBS, 268(15), 4200-4206.
Sekirov, I., Russell, S. L., Antunes, L. C., & Finlay, B. B. (2010). Gut microbiota in
health and disease. Physiological Reviews, 90(3), 859-904.
Setta, A. M., Barrow, P. A., Kaiser, P., & Jones, M. A. (2012). Early immune dynamics
following infection with salmonella enterica serotypes enteritidis, infantis, pullorum
and gallinarum: Cytokine and chemokine gene expression profile and cellular
changes of chicken cecal tonsils. Comparative Immunology, Microbiology and
Infectious Diseases, 35(5), 397-410.
Shanmugasundaram, R., & Selvaraj, R. K. (2012). Effect of killed whole yeast cell
prebiotic supplementation on broiler performance and intestinal immune cell
parameters. Poultry Science, 91(1), 107-111.
Shanmugasundaram, R., Sifri, M., & Selvaraj, R. K. (2013). Effect of yeast cell product
(CitriStim) supplementation on broiler performance and intestinal immune cell
parameters during an experimental coccidial infection. Poultry Science, 92(2), 358363.
Shao, Y., Guo, Y., & Wang, Z. (2013). Beta-1,3/1,6-glucan alleviated intestinal mucosal
barrier impairment of broiler chickens challenged with salmonella enterica serotype
typhimurium. Poultry Science, 92(7), 1764-1773.
Sharman, P. A., Smith, N. C., Wallach, M. G., & Katrib, M. (2010). Chasing the golden
egg: Vaccination against poultry coccidiosis. Parasite Immunology, 32(8), 590-598.
Sheela, R. R., Babu, U., Mu, J., Elankumaran, S., Bautista, D. A., Raybourne, R. B., et al.
(2003). Immune responses against salmonella enterica serotype enteritidis infection
in virally immunosuppressed chickens.Clinical and Diagnostic Laboratory
Immunology, 10(4), 670-679.
Shroff, K. E., Meslin, K., & Cebra, J. J. (1995). Commensal enteric bacteria engender a
self-limiting humoral mucosal immune response while permanently colonizing the
gut. Infection and Immunity, 63(10), 3904-3913.
67 Sims, M. D., Dawson, K. A., Newman, K. E., Spring, P., & Hoogell, D. M. (2004).
Effects of dietary mannan oligosaccharide, bacitracin methylene disalicylate, or both
on the live performance and intestinal microbiology of turkeys. Poultry
Science, 83(7), 1148-1154.
Smirnov, A., Perez, R., Amit-Romach, E., Sklan, D., & Uni, Z. (2005). Mucin dynamics
and microbial populations in chicken small intestine are changed by dietary probiotic
and antibiotic growth promoter supplementation. The Journal of Nutrition, 135(2),
187-192.
Smith, D. L., Nagy, T. R., Wilson, L. S., Dong, S., Barnes, S., & Allison, D. B. (2010).
The effect of mannan oligosaccharide supplementation on body weight gain and fat
accrual in C57Bl/6J mice. Obesity (Silver Spring, Md.), 18(5), 995-999.
Velleman, S. G., Bacon, W., Whitmoyer, R., & Hosso, S. J. (1998). Changes in
distribution of glycosaminoglycans during the progression of cholesterol induced
atherosclerosis in japanese quail. Atherosclerosis,137(1), 63-70.
Vetvicka, V., & Vetvickova, J. (2007). Physiological effects of different types of betaglucan. Biomedical Papers of the Medical Faculty of the University Palacky,
Olomouc, Czechoslovakia, 151(2), 225-231.
Volman, J. J., Ramakers, J. D., & Plat, J. (2008). Dietary modulation of immune function
by beta-glucans. Physiology & Behavior, 94(2), 276-284.
Withanage, G. S., Sasai, K., Fukata, T., Miyamoto, T., Baba, E., & Lillehoj, H. S. (1998).
T lymphocytes, B lymphocytes, and macrophages in the ovaries and oviducts of
laying hens experimentally infected with salmonella enteritidis. Veterinary
Immunology and Immunopathology, 66(2), 173-184.
Wolk, K., Kunz, S., Asadullah, K., & Sabat, R. (2002). Cutting edge: Immune cells as
sources and targets of the IL-10 family members? Journal of Immunology
(Baltimore, Md.: 1950), 168(11), 5397-5402.
Yamauchi, K., Kamisoyama, H., & Isshiki, Y. (1996). Effects of fasting and refeeding on
structures of the intestinal villi and epithelial cells in white leghorn hens. British
Poultry Science, 37(5), 909-921.
Yegani, M., & Korver, D. R. (2008). Factors affecting intestinal health in poultry. Poultry
Science, 87(10), 2052-2063.
Yitbarek, A., Echeverry, H., Brady, J., Hernandez-Doria, J., Camelo-Jaimes, G., Sharif,
S., et al. (2012). Innate immune response to yeast-derived carbohydrates in broiler
68 chickens fed organic diets and challenged with clostridium perfringens. Poultry
Science, 91(5), 1105-1112.
Yun, C. H., Lillehoj, H. S., & Lillehoj, E. P. (2000). Intestinal immune responses to
coccidiosis. Developmental and Comparative Immunology, 24(2-3), 3.
69 Appendix A: Tables
Bacterial Group
Primer
Sequence (5’-3’)
Universal
Uni-f
CGTGCCAGCCGCGGTAATACG
Uni-R
GGGTTGCGCTCGTTGCGGGACTTAACCCAACAT
LAA-F
CATCCAGTGCAAACCTAAGAG
LAA-R
GATCCGCTTGCCTTCGCA
Bif164-f
GGGTGGTAATGCCGGATG
Bif662-r
CCACCGTTACACCGGGAA
Sal201-f
CGGGCCTCTTGCCATCAGGTG
Sal597-r
CACATCCGACTTGACAGACCG
Lactobacillus
Bifidobacterium
Salmonella
Table 1. Bacterial primers
70 Primer
Sequence (5’-3’)
IL-1β-F
TCCTCCAGCCAGAAAGTGA
IL-1β-R
CAGGCGGTAGAAGATGAAGC
IL-10-F
CAATCCAGGGACGATGAACT
IL-10-R
GGCAGGACCTCATCTGTGTAG
IL-6-F
CGCGGATCCCCGCTGCCCGCCGCCGCG
IL-6-R
CCCAAGCTTTCAGGCACTGAAACTCCT
TNF-α-F
TGTGTATGTGCAGCAACCCGTAGT
TNF-α-R
GGCATTGCAATTTGGACAGAAGT
β-actin-F
ACCGGACTGTTACCAACACC
β-actin-R
GACTGCTGCTGACACCTTCA
Table 2. Cytokine primers
71 (Hong et al., 2006)
(Shanmugasundaram and
Selvaraj, 2010)
Appendix B: Figures
1!
2!
3!
Body Weight Gain (g)!
4!
100!
5!
90!
6!
80!
70!
60!
50!
40!
30!
20!
10!
1 2 3 4 5 6
0!
Figure 1. Effect of whole yeast cell product supplementation on body weight gain
at 9 d post-coccidial challenge. Day-old layer birds were fed 0, 0.1 or 0.2 % whole
yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1 x 105
live coccial oocysts (Cocci). n = 6. P values Yeast cell P < 0.05, Cocci P = 0.09,
Yeast cell X Cocci P = 0.09.
72 35!
0% Yeast Product!
a!
0.1% Yeast Product!
30!
0.2% Yeast Product!
Oocyst Count (102 )!
4!
b!
25!
0% Yeast Product + Cocci!
0.1% Yeast Product + Cocci!
20!
5!
0.2% Yeast Product + Cocci!
15!
a!
c!
10!
5!
4!
b!
c! c! c!
6!
5! c!
c! c! c!
0!
6!
1! 2! 3!
1! 2! 3!
7 d!
4!
1! 2! 3!
8 d!
5! 6!
9 d!
Figure 2. Effect of whole yeast cell product supplementation on fecal oocyst count
1!
at 7, 8 and 9 d post-coccidial challenge. Day-old layer chicks were fed 0, 0.1 or 0.2%
whole yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1
x 10 5 live coccial oocysts (Cocci). Feces were collected daily from six battery cages
per treatment group (n = 6) at 7 through 9 d post-coccidial challenge. Bars (± SEM)
without a common superscript differ significantly within a day (P < 0.05). n = 6. P
values, 7 d: Yeast cell P = 0.05, Cocci P < 0.01, Yeast cell X Cocci P = 0.05, 8 d:
Yeast cell P < 0.01, Cocci P < 0.01, Yeast cell X Cocci P < 0.01, 9 d: Yeast cell P <
0.18, Cocci P < 0.01, Yeast cell X Cocci P = 0.18.
73 350!
0% Yeast Product!
a!
300!
0.05% Yeast Product!
4! b!
5!
250!
Oocyst Count (103 )!
0.1% Yeast Product!
0% Yeast Product + Cocci!
0.05% Yeast Product + Cocci!
200!
0.1% Yeast Product + Cocci!
150!
100!
c!
a!
6!
4!
b!
5!
50!
c!
6!
0!
d! d! d!
1! 2! 3!
c! c! c! a! a! b!
1! 2! 3! 4! 5! 6!
d! d! d!
1! 2! 3!
5 d!
12 d!
28 d!
Figure 3. Effect of whole yeast cell product supplementation on intestinal content oocyst
count at 5, 12 and 28 d post-coccidial challenge. 40-week-old layer hens were fed 0, 0.05
or 0.1% whole yeast cell product. At 21 d of whole yeast cell product feeding, birds were
challenged with 0 (control) or 1 x 105 live coccial oocysts (Cocci). Intestinal content were
collected at 5, 12 and 28 d post-coccidial challenge from five battery cages per treatment
group (n = 5). Bars (± SEM) without a common superscript differ significantly within a
day (P < 0.05). n = 5. P values, 5 d: Yeast cell P < 0.01, Cocci P < 0.01, Yeast cell X
Cocci P < 0.01, 12 d: Yeast cell P < 0.01, Cocci P < 0.01, Yeast cell X Cocci P < 0.01, 28
d: Yeast cell P < 0.01, Cocci P < 0.01, Yeast cell X Cocci P < 0.01.
74 18!
16!
Gated Cells (%)!
14!
12!
a!
10!
8!
a!
a!
a!
a!
6!
4!
2!
b!
1! 2! 3! 4! 5! 6!
1! 2! 3! 4! 5! 6!
CD4+!
CD8+!
0!
Figure 4. Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell
populations in the cecal tonsils at 5 d post-coccidial challenge. 40-week-old layer hens
were fed 0, 0.05 or 0.1% whole yeast cell product. At 21 d of whole yeast cell product
feeding, birds were challenged with 0 (control) or 1 x 105 live coccial oocysts (Cocci).
Cecal tonsils were processed for isolating lymphocytes by density centrifugation and
incubated with a fluorescent-conjugated anti-chicken CD4 and CD8 mAb and analyzed
using flow cytometry. Bars (± SEM) without a common superscript differ significantly
within a day (P < 0.05). n = 5. P values, CD4+: Yeast cell P = 0.30, Cocci P < 0.01, Yeast
cell X Cocci P = 0.13; CD8+: Yeast cell P = 0.02, Cocci P < 0.01, Yeast cell X Cocci P <
0.01.
75 0% Yeast Product!
70!
0.1% Yeast Product!
a!
0.2% Yeast Product!
60!
0% Yeast Product + Salmonella!
Relative Percent!
50!
1!
0.1% Yeast Product + Salmonella!
0.2% Yeast Product + Salmonella!
40!
b!
b!
b!
30!
20!
2!
c!
3!
6!
c!
5!
10!
4!
0!
Figure 5. Effect of whole yeast cell product supplementation on relative proportion of
Lactobacillus in the cecal contents at 7 d post-Salmonella challenge. Day-old broilers
were fed 0, 0.1 or 0.2% whole yeast cell product. At 21 d of age, birds were challenged
with 0 (control) or 1x109 CFU/ml S. Enteritidis (Salmonella). The relative proportion of
Lactobacillus in the cecal content was measured by real-time PCR after normalizing to
the total DNA content of the cecal content. The proportion of Lactobacillus is presented
where the total of the examined bacteria was set at 100%. Bars (± SEM) without a
common superscript differ significantly within a day (P < 0.05). n = 6. P values Yeast
cell P = 0.48, Salmonella P = 0.01, Yeast cell X Salmonella P < 0.05.
76 0.3!
Relative Percent (10-2)!
0.25!
0.2!
6!
0.15!
5!
0.1!
0.05!
5!
0!
1!
2!
3!
4!
1!
4!
2!
3!
6!
Figure 6. Effect of whole yeast cell product supplementation on relative proportion of S.
Enteritidis in the cecal contents at 7 and 14 d post-Salmonella challenge. Day-old broilers
were fed 0, 0.1 or 0.2% whole yeast cell product. At 21 d of age, birds were challenged
with 0 (control) or of 1x109 CFU/ml S. Enteritidis (Salmonella). The relative proportion
of S. Enteritidis in the cecal content was measured by real-time PCR after normalizing to
the total DNA content of the cecal content. The proportion of S. Enteritidis is presented
where the total of the examined bacteria was set at 100%. n = 6. P values, 7 d: Yeast cell
P = 0.11, Salmonella P = 0.04, Yeast cell X Salmonella P = 0.11, 14 d: Yeast cell P =
0.28, Salmonella P = 0.05, Yeast cell X Salmonella P = 0.28.
77 25!
Gated Cells (%)!
20!
a!
a!
b!
a!
b!
15!
1! 2!
10!
a!
a!
c!
3!
b!
b!
4! 5! 6!
1!
2!
c!
4!
a!
5!
6!
3!
5!
0!
CD4+!
CD8+!
Figure 7. Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell
populations in the cecal tonsils at 7 d post-Salmonella challenge. Day-old broilers were
fed 0, 0.1 or 0.2% whole yeast cell product. At 21 d of age, birds were challenged with 0
(control) or 1x109 CFU/ml S. Enteritidis (Salmonella). Cecal tonsils were processed for
isolating lymphocytes by density centrifugation and incubated with a fluorescentconjugated anti-chicken CD4 and CD8 mAb and analyzed using flow cytometry. Bars (±
SEM) without a common superscript differ significantly within a day (P < 0.05). n = 6. P
values, CD4+: Yeast cell P < 0.01, Salmonella P < 0.01, Yeast cell X Salmonella P =
0.01, CD8+: Yeast cell P < 0.01, Salmonella P < 0.01, Yeast cell X Salmonella P = 0.01.
78 25!
Gated Cells (%)!
20!
4!
1!
15!
2! 3!
a!
b!
10!
5!
b!
1!
2!
b!
b!
3! 4!
5!
c!
5!
6!
6!
0!
CD8+!
CD4+!
Figure 8. Effect of whole yeast cell product supplementation on CD4+ and CD8+ cell
populations in the cecal tonsils at 14 d post-Salmonella challenge. Day-old broilers were
fed 0, 0.1 or 0.2% whole yeast cell product. At 21 d of age, birds were challenged with 0
(control) or of 1x109 CFU/ml S. Enteritidis (Salmonella). Cecal tonsils were processed
for isolating lymphocytes by density centrifugation and incubated with a fluorescentconjugated anti-chicken CD4 and CD8 mAb and analyzed using flow cytometry. Bars (±
SEM) without a common superscript differ significantly within a day (P < 0.05). n = 6. P
79 values, CD4+: Yeast cell P = 9.48, Salmonella P = 0.04, Yeast cell X Salmonella P <
0.01, CD8+: Yeast cell P < 0.01, Salmonella P = 0.05, Yeast cell X Salmonella P = 0.09.
80 3!
Gated Cells (%)!
2.5!
2!
1!
5!
2!
1.5!
2! 3!
3!
1!
6!
6!
1!
4! 5!
0.5!
4!
0!
7 d!
14 d!
Figure 9. Effect of whole yeast cell product supplementation on CD4+CD25+ cell
populations in the cecal tonsils at 7 and 14 d post-Salmonella challenge. Day-old broilers
were fed 0, 0.1 or 0.2% whole yeast cell product. At 21 d of age, birds were challenged
with 0 (control) or of 1x109 CFU/ml S. Enteritidis (Salmonella). Cecal tonsils were
processed for isolating lymphocytes by density centrifugation and incubated with a
fluorescent-conjugated anti-chicken CD4 and CD25 mAb and analyzed using flow
cytometry. n = 6. P values, 7 d: Yeast cell P = 0.74, Salmonella P = 0.01, Yeast cell X
Salmonella P = 0.16; 14 d: Yeast cell P < 0.01, Salmonella P = 0.74, Yeast cell X
Salmonella P = 0.08.
81 Relative Fold Change Compared to Control!
1.6"
a!
!
1.4"
1.2"
b!
b!
1"
0.8"
0.6"
1!
b!
b!
2!
c!
5!
6!
4!
0.4"
0.2"
3!
0"
Figure 10. Effect of whole yeast cell product on IL-1β mRNA amounts in the cecal
tonsils at 14 d post-Salmonella challenge. Day-old broilers were fed 0, 0.1 or 0.2% whole
yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1x109
CFU/ml S. Enteritidis (Salmonella). At 14 d post-Salmonella challenge, mRNA amount
was analyzed by real time PCR, correct for β-Actin and normalized to the mRNA content
for the uninfected birds so all bars represent fold change compared to the control group.
Bars (± SEM) without a common superscript differ significantly within a day (P < 0.05).
n = 6. P values, Yeast cell P = 0.09, Salmonella P = 0.07, Yeast cell X Salmonella P =
0.03.
82 14!
a!
Fold Change Compared to Control!
12!
3!
10!
b!
8!
b!
2!
6!
b!
b
a!
4!
4!
5!
c!
2!
0!
6!
b!
c
b
1! 2!
1!
7 d!
4!
b
3!
b
5! 6
14 d!
Figure 11. Effect of whole yeast cell product on IL-10 mRNA amounts in the cecal
tonsils at 7 and 14 d post-Salmonella challenge. Day-old broilers were fed 0, 0.1 or 0.2%
whole yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1x109
CFU/ml S. Enteritidis (Salmonella). At 7 and 14 d post-Salmonella challenge, mRNA
amount was analyzed by real time PCR, corrected for β-Actin and normalized to the
mRNA content for the uninfected birds so all bars represent fold change compared to the
control group. Bars (± SEM) without a common superscript differ significantly within a
day (P < 0.05). n = 6. P values, 7 d: Yeast cell P = 0.10, Salmonella P = 0.15, Yeast cell
X Salmonella P = 0.02, 14 d: Yeast cell P = 0.18, Salmonella P = 0.20, Yeast cell X
Salmonella P = 0.02.
83 Relative Fold Change Compared to Control!
2!
a!
1.8!
1.6!
3!
1.4!
1.2!
0.6!
b!
c!
c!
1!
0.8!
b!
b!
4!
1!
2!
5!
6!
0.4!
0.2!
0!
Figure 12. Effect of whole yeast cell product on TNF-α mRNA amounts in the cecal
tonsils at 7 d post-Salmonella challenge. Day-old broilers were fed 0, 0.1 or 0.2% whole
yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1x109
CFU/ml S. Enteritidis (Salmonella). At 7 d post-Salmonella challenge, mRNA amount
was analyzed by real time PCR, corrected for β-Actin and normalized to the mRNA
content for the uninfected birds so all bars represent fold change compared to the control
group. Bars (± SEM) without a common superscript differ significantly within a day (P <
0.05). n = 6. P values Yeast cell P = 0.15, Salmonella P = 0.12, Yeast cell X Salmonella
P = 0.03.
84 Relative Fold Change Compared to Control!
700!
c!
600!
b!
500!
3
b!
b!
5!
6!
400!
4!
300!
b!
c!
b!
b!
b!
b!
200!
3!
2!
100!
4!
5!
6!
a!
2!
a!
0!
1!
1!
7 d!
14 d!
Figure 13. Effect of whole yeast cell product on IL-6 mRNA amounts in the cecal tonsils
at 7 and 14 d post-Salmonella challenge. Day-old broilers were fed 0, 0.1 or 0.2% whole
yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1x109
CFU/ml S. Enteritis (Salmonella). At 7 and 14 d post-Salmonella challenge, mRNA
amount was analyzed by real time PCR, corrected for β-Actin and normalized to the
mRNA content for the uninfected birds so all bars represent fold change compared to the
control group. Bars (± SEM) without a common superscript differ significantly within a
day (P < 0.05). n = 6. P values, 7 d: Yeast cell P = 0.05, Salmonella P = 0.13, Yeast cell
X Salmonella P = 0.01; 14 d: Yeast cell P = 0.07, Salmonella P = 0.18, Yeast cell X
Salmonella P < 0.01.
85 1200!
a!
1000!
b!
Length (μm)"
a!
800!
1!
2!
3!
a!
4!
600!
c!
5!
d!
6!
400!
200!
0!
Figure 14. Effect of whole yeast cell product supplementation on jejunum villi length 7 d
post-Salmonella challenge. Day-old broiler chickens were randomly distributed to one of
three dietary treatments with 0, 0.1 or 0.2% whole yeast cell product. At 21 d of age,
birds were challenged with 0 (control) or 1x109 CFU/ml S. Enteritidis (Salmonella).
Jejunum villi lengths were measured. Bars (± SEM) without a common superscript differ
significantly within a day (P < 0.05). n = 6. P values Yeast cell P = 0.47, Salmonella P <
0.01, Yeast cell X Salmonella P = 0.01.
86 200!
180!
a!
160!
Depth (μm)"
140!
b!
b!
1!
2!
3!
b!
c!
4!
120!
100!
5!
d!
80!
6!
60!
40!
20!
0!
Figure 15. Effect of whole yeast cell product supplementation on jejunum crypt depth 7
d post-Salmonella challenge. Day-old broiler chickens were fed 0, 0.1 or 0.2% whole
yeast cell product. At 21 d of age, birds were challenged with 0 (control) or 1x109
CFU/ml S. Enteritidis (Salmonella). Jejunum crypt lengths were measured. Bars (± SEM)
without a common superscript differ significantly within a day (P < 0.05). n = 6. P
values Yeast cell P = 0.01, Salmonella P < 0.01, Yeast cell X Salmonella P = 0.01.
87