Download Synthetic Biology presentation Linköping

Synthetic Biology
The engineering of biology
Systems Biology Seminar
Linköping University
2012-04-25
Erik Gullberg
Dept. of Medical Biochemistry and Microbiology
Uppsala University
Synthetic Biology – definitions
“Synthetic biology is a new area of
biological research that combines
science and engineering.”
“… emphasis on developing foundational
technologies that make the engineering
of biology easier and more reliable.”
Wikipedia – Synthetic Biology
Synthetic Biology – definitions
“The engineering of biology: the synthesis of
complex, biologically based (or inspired)
systems which display functions that do
not exist in nature.”
“… synthetic biology will enable the design
of ‘biological systems’ in a rational and
systematic way.”
European Commission, 2005
An engineering view on biology
•  Cells work like machines, or computers
•  DNA is a programming language
–  Controls not only how they process
information, but also the hardware.
•  A transition from
Science – knowledge
to
Engineering - building
Illustration by Harry Campbell
Prokaryotic systems
•  Genes expressed in operons
–  Several genes transcribed to one mRNA
•  Coupled transcription and translation
•  Splicing of mRNA is very rare
•  No mRNA cap or added poly(A) tail
•  Little or no compartmentation
History of Synthetic Biology
•  2000 – Genetic toggle switch and repressilator
•  2002 – Stochastic gene expression measured
•  2003 – Registry of Standard Biological Parts
•  2004 – First iGEM held at MIT
•  2006 – Production of artemisinin drug precursor
•  2010 – First synthetic genome assembled
Genetic Engineering vs.
Synthetic Biology
•  Reading DNA
•  Cutting and pasting DNA
Genetic
Engineering
--------------------------------•  Writing DNA
•  Abstraction and design
•  Standardization
Synthetic
Biology
Writing DNA – gene synthesis
•  Gene synthesis prices are decreasing
•  Enormous amount of genetic information
•  Much time is spent on DNA construction
•  Fast and cheap
DNA synthesis is
increasing general
research productivity
•  Simplifies ”genetic
programming”
Illustration from Carlson, Nature Biotechnology, May 2009
Abstraction and design
•  Designing genetic circuits should be like
programming a computer.
–  No one programs a computer in binary
101010101001110010110010110
–  Don t design devices on sequence level
TTGACATGAGGCAGTATTGAGC
–  Design using characterized parts
DNA based devices
•  DNA circuits based on standardized parts
•  What is a standard biological part?
”A genetically encoded object that
performs a biological function and that
has been engineered to meet specified
design or performance requirements”
Drew Endy, 2008
•  Parts can be genes, promoters, RNA…
Abstraction hierarchy
•  DNA
”TTGACATGAGGCAGTATTGAGC…”
•  Parts
Gene = coding sequence
•  Devices
Inverter = logic NOT gate
•  Systems
Sender
Receiver
Inverter
Output
Engineering workflow
•  Specification
•  Design
•  Modeling
•  Construction
•  Testing and validation
Decoupling!
Synthetic biosensors
•  Transcriptional
•  Translational
•  Logic gates
Illustrations from Khalil and Collins, Nature Reviews Genetics May 2010
Standardization
•  Standardized assembly of parts
–  How do we put different parts together?
•  Defining function
–  How to quantify i.e. promoter strength?
•  System operations parameters
–  Organism (“chassi”), media, temperature?
Standards for assembly
•  How to physically connect different parts
•  Often defining flanking restriction sites
•  BioBrick standard 10
–  The most widely used standard so far
Illustration from Canton et al., Nature Biotechnology July 2008
Registry of Standard Biological Parts
•  Registry with thousands of standardized
parts, open for everyone to access
Defining function – data sheets
Reciever
BBa_F2620
3OC6HSL -> PoPS
•  Static performance – Transfer function
•  Dynamic performance – Response time
•  Reliability – Genetic stability
•  Compatibilities – Genetic crosstalk
•  Conditions – chassi, plasmid, medium, T
Illustration from Canton et al., Nature Biotechnology July 2008
Static performance
•  Transfer function
Illustration from Canton et al., Nature Biotechnology July 2008
Dynamic performance
•  Response time to step increase in input
Illustration from Canton et al., Nature Biotechnology July 2008
Reliability – genetic stability
•  Limited by a “metabolic budget”
•  Many promoters used are very strong
•  High expression or toxic product
–  High fitness cost -> selection pressure
–  Evolution leads to loss of function
“How many generations of growth
before a mutant device represents
at least 50% of the population?”
Drew Endy, 2008
Compatibilities
•  Very few well defined regulators
•  Often using native systems -> Crosstalk
•  Need more regulators
orthogonal to
–  Native systems
–  Each other
Illustration from Rao, Current Opinion in Biotechnology, 2011
Conditions
•  Organism / chassi
–  E coli? Bacillus subtilis? Yeast?
•  Plasmid / genomic
–  Copy number
•  Growth medium
–  Rich / poor?
–  Well defined?
Chassis – minimal systems
•  Desired properties of a chassi
–  Robust
–  Well defined
•  Ideal - minimal cell
–  Top-down - minimize existing cells by
deleting non-essential genes
–  Bottom-up - construct minimal cell from well
defined parts
Examples of DNA circuits
•  Early switches and oscillators
Illustrations from Khalil and Collins, Nature Reviews Genetics May 2010
Synthetic metabolic pathways
•  Artemisinin drug
precursor synthesis
in yeast
•  The synthesized
artemisinic acid is
transported out and
retained on the
outside of the
engineered yeast
Illustration from Ro et al., Nature April 2006
International Genetically
Engineered Machine (iGEM)
•  A worldwide Synthetic Biology competition
aimed at undergraduate university students.
•  Student teams are given a kit of biological
parts at the beginning of the summer from
the Registry of Standard Biological Parts.
•  They use these parts and new
parts of their own design to
build biological systems and
operate them in living cells.
Examples of iGEM projects
•  Cambridge 2010 – “E glowli”
–  Moved genes from fireflies and bioluminescent
bacteria into E coli
–  Codon optimization and single amino acid
mutagenesis allowed them to generate bright light
output in a range of different colors
Images from iGEM team Cambridge 2010
Examples of iGEM projects
•  University of Washington 2011 – Diesel
–  Constructed a strain of Escherichia coli that
produces a variety of alkanes, the main
constituents of diesel fuel, by introducing a
pair of genes shown to convert fatty acid
synthesis intermediates into alkanes.
•  Imperial College London 2011 – Auxin
–  E coli that accelerate plant root development
–  Engineered bacteria swim towards plant roots
–  Inside the roots the bacteria release auxin
iGEM 2011 – Uppsala University
•  The idea – show color with color!
•  The system was designed to regulate the
expression of three different genes
independently from each other using
three different wavelengths of light
iGEM 2011 – Uppsala University
•  The design of the system
Illustration from iGEM team Uppsala-Sweden 2011
iGEM 2011 – Uppsala University
•  The result – too complex system!
•  Problems with fitness costs and crosstalk
•  New color output parts sent to registry
•  The team went on to the world final at MIT
Images from iGEM team Uppsala-Sweden 2011
The future of Synthetic Biology
•  Sequencing - parts from all life in nature
•  Advances in protein engineering will give
new synthetic parts
•  Can have a wide range of applications
–  New biomaterials and drugs
–  Energy production and storage
–  Medical applications and biosensors
•  The minimal cell – first synthetic life
The future of Synthetic biology
•  Orthogonal “unnatural” systems
–  Stop codon replacement
–  Alternative genetic code
–  Barrier to horizontal gene transfer – safety
•  Unnatural amino acids
–  New physiochemical properties in proteins
•  Unnatural nucleotides
–  New base pairs?
Thank you for listening!
"What I cannot create,
I do not understand."
Richard Feynman