Download Increased Levels of Endothelin-1 in Plasma of Sickle Cell Anemia

From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2594
CORRESPONDENCE
cell disorder (ie, b-talassemia). The presented clinical cases are severe
forms. In one case b-thalassemia could account for the increased
clinical feature; in the other case no other red blood cell abnormality
was demonstrated, but the coinheritance of thrombocytopenia in a
consanguineous tree suggested the presence of two hematopoietic
defects. CDA-II diagnosis was confirmed by bone marrow observation,
electron microscopy, and laboratory data. From the biochemical point of
view the disease appears very homogeneous. All the subjects showed
the characteristic pattern of SDS-PAGE and the presence of reticulum
endotelial proteins exposed on the surface. These two new families
demonstrated for the first time that in these severe cases, although in the
presence of an identical biochemical pattern, the disease is caused by a
different gene and, thus, that genetic heterogeneity is present. Moreover,
the biochemical defect most likely could present into a different step of
the same pathway. A complementation assay could confirm this data.
ACKNOWLEDGMENT
We thank the families who collaborated in this work. This work is
supported in part by Ministero Italiano della Sanita’ (to P.G.) and by
Telethon (to A.I.) project E-645.
Achille Iolascon
Domenico De Mattia
Dipartimento di Biomedicina dell’Età Evolutiva
Università di Bari
Bari, Italy
Silverio Perrotta
Dipartimento di Pediatria
II Università Napoli
Napoli, Italy
Massimo Carella
Paolo Gasparini
Servizio di Genetica Medica
IRCCS-CSS
San Giovanni Rotondo (Fg), Italy
Giorgio Lambertenghi Deliliers
Istituto di Scienze Mediche
Università di Milano
Milano, Italy
REFERENCES
1. Iolascon A, D’Agostaro G, Perrotta S, Izzo P, Tavano R, Miraglia
del Giudice E: Congenital dyserythropoietic anemia type II: Molecular
basis and clinical aspects. Haematologica 81:543, 1996
2. Wong KY, Hug G, Lampkin BC: Congenital dyserythropoietic
anemia type II. Ultrastructural and radioautographic studies of blood
and bone marrow. Blood 39:23, 1972
3. Alloisio N, Texier P, Denoroy L, Berger C, Miraglia del Giudice
E, Perrotta S, Iolascon A, Gilsanz F, Berger G, Guichard J, Massé JM,
Debili N, Breton-Gorlus J, Delaunay J: The cisternae decorating the red
blood cell membrane in congenital dyserythropoietic anemia (type II)
originate from the endoplasmic reticulum. Blood 87:4433, 1996
4. Iolascon A, Miraglia del Giudice E, Perrotta S, Granatiero M,
Zelante L, Gasparini P: Exclusion of three candidate genes as determinants of congenital dyserithropoietic anemia type II (CDA II). Blood
90:4197, 1997
5. Gasparini P, Miraglia del Giudice E, Delaunay J, Totaro A,
Granatiero M, Melchionda S, Zelante L, Iolascon A: Localization of the
congenital dyserythropoietic anemia II locus to chromosome 20q11.2
by genomewide search. Am J Hum Genet 61:1112, 1997
6. Fukuda MN, Dell A, Scartezzini P: Primary defect congenital
dyserythropoietic anemia type II: Failure in glycosylation of erythrocyte lactosaminoglycan proteins caused by lowered N acetylglucosaminyltransferase II. J Biol Chem 262:7195, 1987
7. Fukuda MN, Masri KA, Dell A, Luzzatto L, Moremen KW:
Incomplete synthesis of N-glycans in congenital dyserythropoietic
anemia type II (HEMPAS) caused by a gene defect encoding a
mannosidase II. Proc Natl Acad Sci USA 87:7443, 1990
Increased Levels of Endothelin-1 in Plasma of Sickle Cell Anemia Patients
To the Editor:
Interactions between circulating blood cells and the vascular endothelium are tightly regulated to maintain the integrity of a functional
circulatory system. Endothelial cells, which are bipolar, provide the
vascular system with a nonthrombogenic surface on the lumenal side
and perform a number of specialized metabolic and transport functions
while in contact with the subendothelial matrix on the basal side.1 Injury
to the vascular endothelium can expose the thrombogenic subendothelium and upset the delicate balance between blood flow and hemostasis.
In sickle cell (SS) disease, injury to the vascular endothelium has been
shown to result from increased adherence of SS red blood cells (RBCs)
to endothelial cells and by vaso-occlusion of abnormally shaped SS
RBCs.2,3 Vaso-occlusion by SS RBCs can produce prolonged hypoxia
to local areas of the microvasculature resulting in endothelial cell
damage.4 In addition, vaso-occlusion can contribute to the adherence of
activated polymorphonuclear neutrophils, which can further damage
endothelial cells by release of reactive oxygen metabolites.5
One endothelial-cell–derived component extremely sensitive to cell
injury is the vasoconstrictor peptide, endothelin-1 (ET-1), which has
been found to be increased in the plasma of patients with diabetes,6
uremia,7 myocardial infarction,8 cardiogenic shock,9 and in patients
after hemodialysis.10 Damage to endothelial cells in SS disease may be
another system in which plasma ET-1 is increased. If this were the case,
the local vasoconstriction produced by ET-1 could decrease the
diameter of some blood vessels and cause slower microvasculature
transit times hypothesized to be necessary for cell sickling in vivo.11 If
ET-1 were elevated in SS disease, it would not only be a marker for
endothelial cell damage but could also be a factor in exacerbating a
vaso-occlusive event.
We measured the plasma levels of immunoreactive ET-1 in patients
with SS disease in both steady state and crisis, and in normal age- and
race-matched controls (AA) using an enzyme-linked immunosorbent
assay (ELISA) method (Amersham Pharmacia Biotech, Arlington
Heights, IL). Thirty-seven homozygous SS patients, (13 in crisis and 24
in steady state) from the Bronx Comprehensive Sickle Cell Center and
10 hematologically normal (AA) controls participated in the study.
Individuals with hypertension or renal disease were excluded from the
study. Plasma from 1 mL of heparinized blood was acidified with 0.25
mL 1 N HCl and loaded onto Sep-Pak C18 columns (Waters Associates,
Milford, MA). ET-1 was eluted from the columns with 2 mL 80%
methanol, 0.1% trifluoroacetic acid; the eluant lyophilized; and the
pellet reconstituted in 0.25 mL assay buffer. The median ET-1 plasma
level for SS patients in steady state was 18.79 pg/mL (n 5 24), which
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
CORRESPONDENCE
was significantly higher than the median ET-1 plasma level of 0.58
pg/mL (n 5 10) for AA control subjects (P , .0001). Because the
distribution of data points was not symmetrical, we used a nonparametric analysis, the Kruskal-Wallis One-Way Analysis of Variance on
Ranks. There was no significant difference in median plasma ET-1
levels in SS patients in steady state (18.79 pg/mL) and those in crisis
(26.16 pg/mL, n 5 13) (Fig 1). Asterisks indicate that the median
plasma ET-1 levels for SS steady state and crisis were significantly
different than the AA control median plasma ET-1 level at P , .0001.
Our data indicate that ET-1 is elevated in SS disease; however, the
mechanism by which this occurs has not been determined. Direct
evidence for damage to the endothelium in SS disease comes from
studies by Sowemino-Coker et al,12 who measured circulating endothelial cells in plasma from SS patients and found increased circulating
endothelial cells during crisis. An alternative mechanism to account for
increased plasma levels of ET-1 in SS disease is the upregulation of
specific endothelial cell genes by circulating plasma factors and/or
hypoxic conditions.13,14 In a recent report, Phelan et al15 found that SS
RBCs that have previously undergone sickling induce a fourfold to
eightfold increase in the transcription of the ET-1 gene as well as a
fourfold to sixfold increase in ET-1 peptide production. The induction
by sickled SS RBCs is specific for ET-1 and unsickled SS RBCs had no
effect. Now that animal models for SS disease have been developed,16,17
it should be possible to determine which mechanism is responsible for
increased plasma ET-1. Specific inhibitors of endothelin converting enzyme
(ECE) that prevent the conversion of proET-1 to ET-1 are available18;
increased synthesis of ET-1 would be blocked by these ECE inhibitors.
The physiological significance of increased ET-1 in SS disease is also
an open question. So many factors contribute to the pathophysiology of
SS disease (eg, tissue hypoxia, vaso-occlusion, increased blood flow)
that it is difficult to assess the contribution of one specific factor. A
mouse model for SS disease where one of the autocrine functions of
ET-1, such as endothelial cell proliferation, can be assessed will be an
invaluable system in which to study the role of ET-1 in SS disease.
Fig 1. Plasma ET-1 levels in SS patients in steady state and crisis
(asterisks) were significantly increased compared to control AA
subjects. There was no significant difference in plasma ET-1 levels
between SS patients in steady state and crisis.
2595
ACKNOWLEDGMENT
This research was supported by National Institutes of Health Sickle
Cell Center Grant No. HL-38655. We thank Sylvia Musto for excellent
technical assistance, Gwendolyn Swinson, RN, for procurement of
patient blood samples, Dr Robert Schwartz for statistical analysis of the
data, and Dr Ronald Nagel for helpful discussions. A preliminary report
of this work was published in Blood 78:202a, 1991 (abstr, suppl 1).
Anne C. Rybicki
Lennette J. Benjamin
Division of Hematology
Department of Medicine
Montefiore Medical Center
Bronx, NY
REFERENCES
1. Fajardo LF: The complexity of endothelial cells. Am J Clin Pathol
92:241, 1989
2. Hebbel RP, Yamada O, Moldow CF, Jacob HS, White JG, Eaton
JW: Abnormal adherence of sickle erythrocytes to cultured vascular
endothelium. J Clin Invest 65:154, 1980
3. Kaul DK, Fabry ME, Nagel RL: Vaso-occlusion by sickle cells:
Evidence for selective trapping of dense red cells. Blood 68:1162, 1986
4. Hebbel RP, Boogaerts MAB, Eaton JW, Steinberg MH: Erythrocyte adherence to endothelium in sickle cell anemia: Possible determinant of disease severity. N Engl J Med 302:992, 1980
5. Warren JS, Ward PA: Oxidant injury to the vascular endothelium.
Am J Med Sci 292:97, 1986
6. Takahashi K, Ghatei MA, Lam HC, O’Halloran DJ, Bloom SR:
Elevated plasma endothelin in patients with diabetes mellitus. Diabetologia 33:306, 1990
7. Koyama H, Tabata T, Nishzawa Y, Inoue T, Morii H, Yamaji T:
Plasma endothelin levels in patients with uraemia. Lancet 1:991, 1989
8. Salminen K, Tikkanen I, Saijonmaa O, Nieminen M, Fyhrquist F,
Frick MH: Modulation of coronary tone in acute myocardial infarction
by endothelin. Lancet 2:747, 1989
9. Cernacek P, Stewart DJ: Immunoreactive endothelin in human
plasma: Marked elevation in patients in cardiogenic shock. Biochem
Biophys Res Commun 161:562, 1989
10. Yoshizumi M, Kurihara H, Sugiyama T, Takaku F, Yanagisawa
M, Masaki T, Yazaki Y: Hemodynamic shear stress stimulates endothelin production by cultured endothelial cells. Biochem Biophys Res
Commun 161:859, 1989
11. Hofrichter J, Ross PD, Eaton WD: Kinetics and mechanism of
deoxyhemoglobin S gelation: A new approach to understanding sickle
cell disease. Proc Natl Acad Sci USA 71:4864, 1974
12. Sowemino-Coker SO, Meiselman HJ, Francis RB: Increased
circulating endothelial cells in sickle cell crisis. Am J Hematol 31:263,
1989
13. Moon DG, Horgan MA, Anderson TT, Krystek SR, Fenton JW,
Malik AB: Endothelin-like pulmonary vasoconstrictor peptide release
by alpha-thrombin. Proc Natl Acad Sci USA 86:9529, 1989
14. Kourembanas S, Marsden LP, McQuillan LP, Faller DV: Hypoxia induces endothelin gene expression and secretion in cultured
human endothelium. J Clin Invest 88:1054, 1991
15. Phelan M, Perrine SP, Brauer M, Faller DV: Sickle erythrocytes,
after sickling, regulate the expression of the endothelin-1 gene and
protein in human endothelial cells in culture. J Clin Invest 96:1145,
1995
16. Rubin EM, Witkowska HE, Spangler E, Curtin P, Mohandas N,
Lubin BH: Hypoxia-induced in vivo sickling of transgenic mouse red
cells. J Clin Invest 87:639, 1991
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
2596
17. Fabry ME, Sengupta A, Suzuka SM, Costantini F, Rubin EM,
Hofrichter J, Christoph G, Mancie E, Culberson D, Factor SM, Nagel
RL: A second generation of transgenic mouse model expressing HbS
and HbS-Antilles results in increased phenotypic severity. Blood
86:2419, 1995
CORRESPONDENCE
18. Ikegawa R, Matsumura Y, Tsukahara Y, Takaoka M, Morimoto S:
Phosphoramidon, a metalloproteinase inhibitor, suppresses the secretion of endothelin-1 from cultured endothelial cells by inhibiting a big
endothelin-1 converting enzyme. Biochem Biophys Res Commun
171:669, 1990
Activating Mutations of the Transmembrane Domain of MPL In Vitro and In Vivo: Incorrect Sequence
of MPL-K, an Alternative Spliced Form of MPL
To the Editor:
Recently, many gene alterations have been identified as causes of
leukemia, most of which are gross rearrangements of transcription
factors, receptors, and kinases derived from chromosomal translocations. In addition, mutations of tyrosine kinase receptors such as c-kit1
and FLT-32 have been reported in mastocytosis and myeloid leukemia,
respectively. In particular, it is noticeable that duplication of the juxtamembrane region of FLT-3 is observed in 20% of patient leukemic cells. However,
no cytokine receptors (type I cytokine receptor family) have been reported to
be involved in human leukemia except that truncation of the C-terminal
domain of the granulocyte colony-stimulating factor (G-CSF) receptor
caused by various point mutations is implicated in a fraction of leukemic
patients. Most of these leukemias are secondary acute myeloid leukemias
(AMLs) developed from Kostmann syndrome, and the significance of
the mutations in leukemogenesis is still controversial.3,4
MPL, thrombopoietin (TPO) receptor, is the only hemopoietin
receptor (type I cytokine receptor family) identified as an oncogene.5,6
Thus, MPL was originally identified as a truncated form v-mpl that is an
oncogene of a murine retrovirus MPLV, which causes myeloproliferative disorders in mice, and was later recognized as a receptor for TPO.
Using a combined strategy including polymerase chain reaction (PCR)driven random mutagenesis and retrovirus-mediated high-efficiency
gene transfer, we have recently identified a constitutive active form of
MPL.7 This point mutation causes a single amino acid substitution from
Ser498 to Asn498 in its transmembrane domain. Expression of the mutant
MPL in a mouse interleukin-3 (IL-3)–dependent pro-B cell line Ba/F3
resulted in constitutive activation of both the Ras-Raf-MAPK and the
Jak-STAT pathways and IL-3–independent growth. Moreover, when the
Ba/F3 transfectants expressing the mutant MPL were injected into
syngeneic mice after sublethal irradiation, they developed severe
infiltration of the Ba/F3 transfectants in liver and spleen, suggesting that
the mutant form of MPL is highly oncogenic in vivo. We were interested
in whether similar mutations can be found in patients’ leukemic cells,
and examined the sequence of the transmembrane portion of MPL in 43
patients, including 2 patients with essential thrombocytosis (ET), 6 with
AML-M1, 6 with AML-M2, 1 with AML-M3, 3 with AML-M4, 2 with
AML-M5, 9 with AML-M6, 12 with AML-M7 (megakaryoblastic
leukemia), and 2 with myelodysplastic syndromes (MDS).
To sequence the corresponding part in the patients’ sample and to
avoid the contamination of the plasmid harboring the mutant MPL, a
DNA fragment spanning the transmembrane portion of MPL (exon 9)
and a part of intron 10 of the human MPL gene8 was amplified from
high-molecular-weight DNA by PCR using a 58 transmembrane primer
(ATCTCCTTGGTGACC) and a primer in the 10th intron (AGATCTGGGGTCACACAGAG) (Fig 1). To avoid mutations during the
recovery procedure as much as possible, we used Pfu polymerase for the
reaction. PCR fragments were subcloned into the TA vector, and at least
six subclones were sequenced for each patient. However, no mutations
were found in the transmembrane portion of MPL. Our results indicate
that the mutation in the transmembrane region of MPL is not a frequent
cause of leukemogenesis.
There are two major transcripts for MPL, a full-length MPL-P and an
alternative splicing form MPL-K.6 MPL-K is supposed to be translated
from an alternative spliced mRNA harboring intron 10 after exon 9
encoding the transmembrane region (Fig 1). The function of MPL-K
product was not known.6 During the course of our screening for MPL
mutations in leukemic patients, we happened to find a sequence error in
the sequence of intron 10 that had been published as a part of the
MPL-K transcript (Fig 1). Thus, the sequence CG (1616-1617) was
GGCC (1616-1619) in all patients tested as well as in a normal control,
which will result in frame-shift and earlier termination in the MPL-K
product (Fig 2). The predicted length of the intracellular domain of
MPL-K should be 36 instead of 66 amino acids. To confirm this, it is
required to molecularly clone cDNA for MPL-K and confirm the
sequence of the corresponding part.
Toshio Kitamura
Department of Hemopoietic Factors
Institute of Medical Science
University of Tokyo
Tokyo, Japan
Mayumi Onishi
Third Department of Internal Medicine
University of Tokyo
Tokyo, Japan
Takashi Yahata
Department of Immunology
Tokai University School of Medicine
Isehara, Japan
Yuzuru Kanakura
Department of Hematology and Oncology
Osaka University
Suita, Japan
Shigetaka Asano
Department of Internal Medicine
Institute of Medical Science
University of Tokyo
Tokyo, Japan
Fig 1. PCR primers to amplify the transmembrane region of MPL
from genomic DNA. TM (shadowed box), transmembrane region;
arrows, PCR primers.
From www.bloodjournal.org by guest on June 17, 2017. For personal use only.
1998 92: 2594-2596
Increased Levels of Endothelin-1 in Plasma of Sickle Cell Anemia Patients
Anne C. Rybicki and Lennette J. Benjamin
Updated information and services can be found at:
http://www.bloodjournal.org/content/92/7/2594.full.html
Articles on similar topics can be found in the following Blood collections
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society of
Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.