Download The role of amniotic passage in the egg

Journal of General Virology (1993), 74, 2047-2051. Printedin Great Britain
2047
The role of amniotic passage in the egg-adaptation of human influenza
virus is revealed by haemagglutinin sequence analyses
J a m e s S. Robertson, 1. C a r o l y n N i c o l s o n , 1 D i a n e M a j o r , ' Edwin W . R o b e r t s o n 2
and J o h n M . W o o d '
1National Institute for Biological Standards and Control, Blanche Lane, South Mimms, Potters Bar, Hertfordshire
E N 6 3QG and 2 Medical Centre, 46-62 Bank Street, Alexandria, Dunbartonshire G83 OLS, U.K.
Obtaining an isolate of a human influenza virus in the
allantoic cavity of the embryonated hen's egg is more
efficient if the clinical sample is initially passaged in the
amniotic cavity. To investigate the extent to which the
variants present after allantoic propagation are also
selected by amniotic passage, clinical virus passaged
once in the amnion has been subjected to extensive
genetic and antigenic analyses. The data indicate that
the natural virus can replicate unrestrictedly within the
amnion. However, exposure of amniotic virus to the
allantois during the incubation period, which will occur
through the hole between the amniotic and allantoic
cavities caused by the inoculating needle, allows for the
possibility of an egg-adapted variant establishing replication within the allantois and returning to the amnion.
These observations illustrate why prior passage in the
amnion increases the probability of a variant successfully
establishing itself during a subsequent aUantoic passage.
Introduction
To address this question we have analysed an influenza
B virus passaged solely in the amniotic cavity. Typically,
for influenza B virus, egg-adaptation is accompanied by
the loss of a specific glycosylation site from the tip of the
H A molecule through substitution o f either Asn-196 or
Thr-198 (Robertson et aL, 1985, 1990). By using P C R
and M13 cloning we have been able to analyse the
sequence of the H A o f virus derived in the amniotic
cavity of single eggs and have compared it to the
sequence present in the original clinical sample and to
that of virus passaged further in the allantoic cavity.
The allantoic cavity of the embryonated hen's egg is an
efficient and commonly used substrate for the propagation of influenza viruses. However, the initial isolation
of human influenza virus in the allantoic cavity is
generally considered to be inefficient, especially for
influenza B virus, and virus does not replicate efficiently
until it h a s ' egg-adapted'. A greater efficiency of isolation
can be achieved in eggs by initially passaging the virus in
the amniotic cavity prior to cultivation :in the allantoic
cavity (Burnet, 1940), and this is the usual route for
inoculation to obtain an isolate in the egg (Hoyle, 1968).
Based on analysis of virus present in clinical material
and of virus propagated exclusively in mammalian tissue
culture, there are now considerable data to show that
egg-adapted human influenza viruses are variants which
differ from non-egg-passaged virus by single amino acid
substitutions in the haemagglutinin (HA) in the vicinity
of the receptor binding site (Robertson et aL, 1985, 1987,
1990, 1991; Katz et al., 1987, 1988, 1990). The eggadapted viruses which have been investigated have all
been derived in the allantoic cavity, either directly or
after amniotic passage, and it is unknown to what extent
selection of variants takes place during amniotic passage.
The nucleotide sequence data reported in this paper have been
submitted to the EMBL database and assigned the accession number
X73421.
0001-1654 © 1993 SGM
Methods
Amniotic isolation. An influenza B virus, B/NIB/48/90, was isolated
in the amniotic cavity of 10-day-oldembryonated hens' eggs in the
following way and as described by Hoyle (1968). A hole was drilled in
the shell at the air-sac end and a small quantity of sterile liquid paraffin
applied to the shell membrane covering the chorioallantoic membrane
(CAM) to render it transparent. The CAM was pierced with fine
forceps and the amniotic sac carefully pinched and gently drawn up
clear of the allantoic fluid. Two-hundred microlitres of undiluted
clinical material was inoculated into the amniotic sac using a fine gauge
needle with confidence that the inoculum had entered the amniotic
cavity. The amnion was gentlylowered into the allantoic cavityand the
egg sealed with Sellotape. After 3 to 4 days incubationat 33 °C, the seal
was removed and a quantity of allantoic fluid harvested and kept. The
amniotic fluid was then collected using a Pasteur pipette. These
manipulations were performed with extreme care and satisfactory
amniotic inoculations and harvests were obtained for this study.
Allantoic passage. One-hundredmicrolitres of a one tenth dilution of
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:43:20
J. S. Robertson and others
2048
T a b l e 1. Description o f virus samples and their antigenic and genetic
characterization
B/NIB/48/90
Passage
Route
Clinical specimen
MDCK
Egg 1.1
None
1st
1st
None
MDCK
Amniotic
Egg 1.2
2nd
1st
Allantoic
Amniotic
Egg 1.3
2nd
1st
Allantoic
Amniotic
2nd
Allantoic
Fluid
harvested
HA titre
Throat wash
Culture fluid
Amniotic
Allantoic
Allantoic
Amniotic
Allantoic
Allantoic
Amniotic
Allantoic
Allantoic
YDt
128
40
10
256
1280
> 1280
256
320
240
256
Sequence at
HI with HA1 residues
BM15*
196 to 198
ND
< 200
ND
No
9600
1600:~
6400
9600
ND
6400
9600
Ash-x- Thr
Asn-x -Thr
Asn-x-Thr
Asn-x-Thr
Hetero§
Heterol[
Hetero]l
Asp-x--Thr
Asn-x-Ala
Asn-x-Ala
Asn-x-Ala
* MAb BM15 was raised against B/Memphis/6/86 and was a gift from R. G. Webster.
t ~D, Not done.
:~ Partial agglutination.
§ Heterogeneous sequence consisting maialy of Asn/Asi~x-Ala/Thr.
[[ Heterogeneous sequence consisting mainly of Asn/Asp-x Thr.
virus derived in the amuion was inoculated into the allantoic cavity
using standard procedures, and incubated at 33 °C for 3 days.
Tissue culture isolation. Virus was isolated on MDCK ceils from
clinical material using standard procedures.
Serological assays. Haemagglutination and haemagglutination-inhibition (HI) assays were performed in microtitre plates using turkey
red blood cells.
Sequencing. Sequencing of the HA1 coding region was performed
either on PCR-amplified cDNA or on M13 clones of the amplified
DNA as described previously for influenza B virus (Robertson et al.,
1990). Briefly, RNA was extracted from 50 to 100 IJ1 of sample,
cDNA was synthesized using reverse transcriptase and primer
B/17/1 (TTTCTAATATCCACAAAATGAAGGC) and the HAl
coding region was amplified in a PCR with cloning primers
Eco/B/35/1 (CAAAATGAATTCAATAATTGTACTACTCAT)and
Bam/B/1092/2 (TCTATATTTGGATCCATTGGCCAGCTT) exactly as described. If insufficient DNA was generated from the first
amplification, a sample of cDNA was amplified with primers B/17/1
and B/1140/2 (ACCAGCAATAGCTCCGAAGAAACC)which flank
the above cloning primers, and a sample of this amplified DNA was
subjected to nested PCR with the cloning primers Eco/B/35/1 and
Barn/B/1092/2. Amplified DNA was either sequenced directly or
cloned into M13mp18/19 using standard techniques. Direct dideoxynucleotide sequencing of PCR DNA was performed using 5' ~2p_
labelled primers specific for the HA1 region. M13 sequencing was
performed using the M 13 universal primer or HA-specific primers with
[~-3~P]dATP present in reaction mixes. Nucleotide sequences were
analysed using the Staden (1982) and the GCG (Devereux et al., 1984)
programs.
Results
Initially, 200 ltl samples o f a t h r o a t w a s h c o n t a i n i n g a n
influenza B virus ( B / N I B / 4 8 / 9 0 ) were i n o c u l a t e d directly i n t o the a m n i o t i c c a v i t y o f five e m b r y o n a t e d h e n s '
eggs as d e s c r i b e d in M e t h o d s , a n d after i n c u b a t i o n for
4 d a y s b o t h the a l l a n t o i c a n d a m n i o t i c fluids were
i n d i v i d u a l l y h a r v e s t e d f r o m f o u r o f the eggs (one egg was
non-viable). A s a s s a y e d b y h a e m a g g l u t i n a t i o n , three
eggs were positive for virus g r o w t h a n d these a m n i o t i c
s a m p l e s were then further p a s s a g e d allantoically. I n
a d d i t i o n to these egg isolates, virus was d e r i v e d directly
f r o m the clinical specimen o n M D C K cells. This
p r o v i d e d 11 virus s a m p l e s for initial a n a l y s i s : the original
clinical material, a n M D C K cell-derived virus, three
a m n i o t i c s a m p l e s ( A m virus), three c o r r e s p o n d i n g
s a m p l e s o f a l l a n t o i c fluid h a r v e s t e d f r o m the eggs
infected a m n i o t i c a l l y (A1 virus), a n d three a l l a n t o i c
s a m p l e s f r o m eggs i n o c u l a t e d a l l a n t o i c a l l y with each o f
the a m n i o t i c viruses (AreA1 virus).
T h e h a e m a g g l u t i n a t i o n titres o f the a m n i o t i c fluids
v a r i e d between 40 a n d 1280 ( T a b l e 1) a n d in each case
the c o r r e s p o n d i n g a l l a n t o i c fluids h a d a c o m p a r a b l e
titre. S a m p l e s f o r which there was sufficient virus were
a n a l y s e d b y H I assay using a m o n o c l o n a l a n t i b o d y
( M A b ) , BM15, which we p r e v i o u s l y f o u n d c o u l d disc r i m i n a t e between M D C K cell-derived a n d e g g - a d a p t e d
v a r i a n t s o f influenza B virus. T h e a m n i o t i c virus f r o m
egg 1.2 r e a c t e d with B M 1 5 in the H I test b u t s h o w e d
p a r t i a l a g g l u t i n a t i o n w h i c h indicates t h a t the virus
s a m p l e was likely to be a mixture. T w o o f the a l l a n t o i c
fluids o b t a i n e d f r o m the eggs i n o c u l a t e d a m n i o t i c a l l y
were a s s a y e d a n d b o t h r e a c t e d to high titre with B M 15.
A l l three virus samples cultivated specifically in the
allantois (AmA1 virus) r e a c t e d to high titre with B M 1 5
w h e r e a s M D C K - g r o w n virus failed to react.
Viral R N A was e x t r a c t e d f r o m each o f the 11 s a m p l e s
a n d the c D N A c o r r e s p o n d i n g to the H A l c o d i n g r e g i o n
was P C R - a m p l i f i e d . T h e r e g i o n o f a m p l i f i e d D N A t h a t
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:43:20
Amniotic influenza B virus HA sequences
Table 2. Summary of the sequences at HA1 codons 196
and 198 for 300 clones
N u m b e r o f clones with sequence
Allantoic
Amniotic passage
passage
(lst passage)
(2nd passage)
B/NIB/48/90
Sequence at
HA1 residues Amniotic Allantoic
196 to 198
fluid
fluid
Allantoic
fluid
Clinical
specimen
Asn-x- T h r
Egg 1.1
Ash x-Thr
His-x-Thr
Asn-x-Asn
Ser-x-Thr
Asn x-Ala
Asp-x-Thr
29/30
29/30
1/30
-----
-1/ 30
3/30
11/30
15/30
Egg 1.2
Asn-x-.Thr
Lys x - T h r
Asn-x-Asn
Asp-x-Thr
10/30
7/30
. . . . .
3/30
1/30
17/30
22/30
2/30
1/30
2/30
25/30
Egg 1.3
Asn-x--Thr
Se~x-Ala
Asn-x--Ala
--30/30
--30/30
30/30*
-1/30
---
-1/30
29/30
* Unpassaged material.
codes for the glycosylation site at HA1 residues 196 to
198 was sequenced directly and the deduced amino acid
sequence for residues 196/198 is shown in Table 1. In
some instances there was obviou; heterogeneity of the
sequence for these codons. Virus in the clinical specimen,
the MDCK cell-grown virus, and virus in the amniotic
(Am) and corresponding allantoic fluids harvested from
egg 1.1 after the amniotic passage each had the
glycosylation sequence Asn--x-Thr at 196 to 198. The
sequence obtained after allantoic passage of egg 1.1
amniotic fluid was heterogeneous. All samples derived
from egg 1.2 had the sequence Asp-x-Thr to varying
degrees with obvious heterogeneity in the Am and A1
virus samples. All egg 1.3 samples had the sequence
Asn-x-Ala.
In order to assess the extent of heterogeneity in the
HA1 for each of the virus samples above, the PCRamplified DNA derived from virus present in the clinical
sample and the above nine egg-derived samples was
cloned into M t3 and a region of approximately 250
bases, which included the codons for residues 196 to 198,
was sequenced from 30 clones per virus sample. In this
way, 300 clones and approx. 75000 bases were analysed
and the deduced amino acid sequence for residues 196
and 198 for each of the 300 clones is shown in Table 2.
As previously observed in the analysis of clinical
material (Robertson et al., 1990), all 30 clones derived
from the clinical specimen had the potential glycosylation
sequence Asn-x-Thr at residues 196 to 198. For egg 1.1,
the majority of clones derived from the amniotic (Am)
2049
and corresponding allantoic (A1) fluids had the sequence
Asn-x-Thr. On passage of this amniotic virus in the
atlantoic cavity, the derived clones had various sequences
at residues 196 to 198 including Asp-x-Thr and
Asn-x-Ala, and none had the sequence Asn--x-Thr. For
egg 1.2, the clones from the amniotic and corresponding
allantoic fluid had predominantly Asp-x-Thr and Asnx-Thr with more of the former than the latter sequence
in both fluids. After allantoic passage of egg 1.2 amniotic
fluid, 25 out of 30 clones had the Asp-x-Thr sequence
and only two clones had Asn-x-Thr. In all egg 1.2 fluids
analysed, a few clones had the sequence Ash-x-Ash and
one clone in the (AmA1) allantoic fluid had Lys-x-Thr.
For egg 1.3, the clones derived from virus in both the
amniotic and the corresponding allantoic fluid, and also
in the (AmA1) allantoic fluid derived from the allantoic
passage, the sequence Asn-x-Ala predominated, and no
clones had the original Asn-x-Thr sequence.
Since the nature of the virus population between each
of the three amniotic samples was diverse, additional
amniotic samples were derived from B/NIB/48/90
clinical material. In this second experiment, 10 eggs were
inoculated amniotically with 100 gl of the throat-wash
material and after 3 days incubation both the amniotic
fluid and a sample of allantoic fluid were harvested, as
before. Five amniotic fluids and one corresponding
allantoic fluid were positive for virus growth as measured
by haemagglutination. The five amniotic samples were
then passaged in eggs, allantoically. These five amniotic
samples, the one corresponding allantoic sample, and the
five allantoic passaged (AmA1) samples were characterized antigenically using M A b BM 15 and the HA 1 region
coding for residues 196 to 198 was analysed by direct
sequence analysis of PCR-amptified cDNA corresponding to the HA1 coding region (Table 3).
The HA titre of the five amniotic and the one
corresponding allantoic samples varied between 10 and
2560. None of the amniotic viruses reacted in HI with
MAb BM 15 and direct sequence analysis of the PCRamplified cDNA clearly indicated the deduced sequence
at HA1 residues 196 to 198 to be Asn-x-Thr for all six
samples with no indication of any heterogeneity of the
sequence. Each of the five amniotic samples grew
successfully upon allantoic passage and four of them
now reacted strongly with BM15. Sequence analysis
indicated that a variant had been selected in these four
samples with obvious heterogeneity within the AmA1
virus derived from egg 2.10. The AreA1 virus from
egg 2.9 retained the sequence Asn-x-Thr with no
indication from the sequencing autoradiogram of heterogeneity.
With the exception of the codons for residues 196 and
198, the consensus sequence of the entire HA1 coding
region of virus present in the clinical sample, the MDCK
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:43:20
2050
J. S. Robertson and others
Table 3. Antigenic" and genetic characterization of virus samples (second
experiment)
Amniotic passage*
(lst passage)
B/NIB/48/90
Egg no.
2.1
2.3
2.8
2.9
2.10
2.10 (A1)
HA
titre
10
40
20
160
2560
10
HI titre
with
BM15
<
<
<
<
<
200
200
200
200
200
ND'~
Allantoic passage
(2nd passage)
Sequence at
196 to 198
HA
fitre
HI titre
with
BM15
Asn-x-Thr
Asn-x-Thr
Asn-x-Thr
Asn-x -Thr
Asn-x T h r
Asn-x-Thr
60
320
160
160
160
--
25 600
25 600
19200
< 200
9600
--
Sequence at
196 to 198
Asn-x-Ala
Asn-x Ala
Ser-x-Thr
Asn-x Thr
Asn x A l a / P r o
--
* Five amniotic samples and one corresponding allantoic sample [2.10(A1)] were analysed.
t ND, Not done.
cell-derived virus and the nine egg-grown viruses derived
in the first experiment was identical (not shown).
B/NIB/48/90 is antigenically like B/Victoria/2/87 (not
shown) and its HA nucleotide sequence is comparable to
other B/Victoria-like viruses isolated at the same time
(Rota et al., 1992).
During sequence analysis of the M13 clones many
unique single base substitutions were observed in
addition to those substitutions occurring at codons 196
and 198. The majority of these are presumed to derive
from a combination of use of reverse transcriptase and
Taq polymerase both of which are known to have an
error rate compatible with the frequency of single base
substitutions observed in this study, and in other
(Robertson et al., 1990, 1991) studies.
Discussion
Previously, we have observed that passage of non-eggadapted influenza B virus in the allantois typically results
in the selection of a virus with a substitution in the HA1
at either residue 196 or 198. In this study, after virus was
derived from clinical material by a single passage in the
amniotic cavity, the nature of the virus varied. For most
samples (six out of eight) there was sequence identity at
residues 196 and 198 with virus present in the original
clinical material. These data indicate that the original
virus present in the clinical specimen can replicate
successfully within the amniotic cavity without selection.
After allantoic passage of the amniotic samples, a
variant(s) with a substitution at either Asn-196 or Thr198 was selected for all but one of the samples. In this
one sample (egg 2.9), the (AreA1) allantoically passaged
virus retained the Asn-x-Thr sequence suggesting that
no selection had taken place. This has been observed
infrequently before (unpublished observations) and is
the subject of a separate study.
On two occasions, in the first experiment, there was
partial or total selection of a variant after a single
amniotic passage (eggs 1.2 and t. 3 respectively). From
the detailed analysis in the first experiment, the nature of
the virus population in the allantoic fluid harvested
concurrently with the amniotic fluid was very similar to
that present in the amniotic fluid, with respect to residues
196 to 198 (Table 2). This suggests that mixing between
the two compartments had occurred. Although amniotic
inoculation was performed with extreme care, inoculation into the amnion inevitably results in a hole in the
amniotic membrane between the amniotic and the
allantoic cavities. During the 4 day incubation, diffusion
and movement of the embryo are likely to cause mixing
of the fluids between the two compartments and original
virus replicating within the amnion may enter the
allantoic cavity. If a variant with the appropriate
substitution (i.e. loss of the Asn-x-Thr sequence), either
present in the inoculum or arising from intermediate
growth of the original virus in the amnion, enters the
allantoic cavity, it may successfully replicate. If this
occurs sufficiently early in infection there is time for
considerable amplification of the variant within the
allantoic cavity. Such variants will distribute between the
allantoic and amniotic cavities where they are likely to
replicate. After 4 days it may thus be possible to observe
egg-adapted variants within the virus population in both
compartments by sequence analysis, even to the extent
that they predominate in the population. For the samples
derived in the second experiment in which amniotic
incubation was for only 3 days, there was no evidence for
the presence of egg-adapted variants and virus was
detected in only one allantoic sample whose corresponding amniotic fluid had a very high haemagglutination titre.
Thus, the increased efficiency of isolating virus in the
allantois from a clinical specimen by prior passage in the
amnion appears to be due mainly to increased numbers
of virions in the amniotic sample being inoculated
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:43:20
Amniotic influenza B virus H A sequences
allantoically. The frequency of a variant within non-eggadapted virus which is capable of replication in the
allantois is appoximately 10-~ (Schild et al., 1983). Since
clinical material is likely to contain < 10~ p.f.u./ml, the
probability of the appropriate variant being present
within a clinical specimen is slight. Amplification of this
material within the amnion (to 10~ to 108 p.f.u./ml)
increases the likelihood that the allantoic inoculmn will
contain a variant capable of replication within the
allantois. In addition, there is the possibility that by
leakage of virus replicating within the amnion into the
allantois, an egg-adapted variant has the opportunity of
being selectively amplified and co-harvested with the
amniotic virus. No egg-variants were observed in six of
the amniotic samples, but it is possible that some
enrichment of variants to levels > 1 in 105 had occurred
and this would also contribute to an increased efficiency
of isolation within the allantois. Other possibilities exist
for the appearance of variants during amniotic passage,
e.g. selection within other tissues of the embryo, and for
the appearance of virus within the allantoic compartment, e.g. by swallowing and passage through the gut of
the embryo. However, since selection of variants by
direct allantoic passage has been observed previously,
selection within the allantois of virus leaking from the
amnion remains the most probable explanation.
These observations and conclusions are comparable to
and similarly explain the original observations on egg
adaptation of human influenza A (H1N1) virus made 50
years ago by Burnet & Bull (1943). These were that
clinical material passaged in the amnion had agglutinating characteristics described as 'O' (original) but
which changed to' D' (derived) upon repeated passage in
the amnion or by further passage in the allantois. Katz &
Webster (1992) recently demonstrated that influenza A
virus isolated on primary chick kidney cells was identical
to that isolated on MDCK cells whereas subsequent
passage in the allantois selected a variant. It would
appear that it is solely the cells of the allantois which
present a restriction to the growth of original human
influenza viruses.
2051
References
BURNET, F. M. (1940). Influenza virus infections of the chick embryo
lung. British Journal of Experimental Pathology 21, 142153.
BURNET, F.M. & BULL, D.R. (1943). Changes in influenza virus
associated with adaptation to passage in chick embryos. Australian
Journal of Experimental Biology and Medical Science 21, 55-69.
DEWREUX,J., HAEBERLI,P. & SMrrnxEs, O. (1984). A comprehensive set
of sequence analysis programs for the VAX. Nucleic Acids Research
12, 387-395.
HOYLE, L. (1968). The It~uenza Viruses, pp. 25-27. Wien: SpringerVerlag.
KATZ, J.M. & WEBSTER, R.G. (1988). Antigenic and structural
characterization of multiple subpopulations of H3N2 influenza virus
from an individual. Virology 165, 446-456.
KATZ, J. M. & WEBSTER,R. G. (1992). Amino acid sequence identity
between the HA1 of influenza A (H3N2) viruses grown in
mammalian and primary chick kidney cells. Journal of General
Virology 73, 1159-1165.
KATZ, J.M., N~VE, C.W. & WEBSTER, R.G. (1987). Host cellmediated variation in H3N2 influenza viruses. Virology 156, 386-395.
KATZ, J. M., WANG, M. & WEBSTER, R. G. (1990). Direct sequencing
of the HA gene of influenza (H3N2) virus in original clinical samples
reveals sequence identity with mammalian cell-grown virus. Journal
of Virology 64, 1808-1811.
ROBERTSON, J.S., NAEVE, C.W., WEBSTER, R.G., BOOTMAN,J.S.,
NEWMAN, R. & SCHILD, G.C. (1985). Alterations in the hemagglutinin associated with adaptation of influenza B virus to growth in
eggs. Virology 143, 166174.
ROBERTSON, J.S., BOOTMAN, J.S., NEWMAN, R., OXFORD, J.S.,
DANn~LS, R. S., WEBSTER,R. G. & SCHmD, G. C. (1987). Structural
changes in the hemagglutinin which accompany egg adaptation of an
influenza A (H1N1) virus. Virology 160, 31-37.
ROBERTSON,J. S., BOOTMAN,J. S., NICOLSON,C., MAJOR, D., ROBERTSON, E. W. & WOOD, J. M. (1990). The hemagglutinin of influenza B
virus present in clinical material is a single species identical to that of
mammalian cell-grown virus. Virology 179, 35-40.
ROBERTSON,J. S., NICOLSON,C., BOOTMAN,J. S., MAJOR, D., ROBERTSON, E.W. & WOOD, J.M. (1991). Sequence analysis of the
haemagglutinin (HA) of influenza A (H1N1) viruses present in
clinical material and comparison with the HA of laboratory-derived
virus. Journal of General Virology 72, 2671-2677.
ROTA, P.A., HEMPHILL, M.L., WHISTLER, T., REGNERY, H.L. &
KENDAL,A. P. (1992). Antigenic and genetic characterization of the
haemagglutinins of recent cocirculating strains of influenza B virus.
Journal of General Virology 73, 2737-2742.
SCmLD, G. C., OXFORD,J. S., DEJoNa, J. C. & WEBSTER,R. W. (1983).
Evidence for host ceil selection of influenza virus antigenic variants,
Nature, London 303, 706-709.
STADEN, R. (1982). Automation of the computer handling of gel
reading data produced by the shotgun method of DNA sequencing.
Nucleic Acids Research 10, 4731-4751.
(Received 26 February 1993; Accepted 24 May 1993)
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Sat, 17 Jun 2017 00:43:20