Download Retina-Specific Expression of 5A11/Basigin-2, a

Retina-Specific Expression of 5A11/Basigin-2, a Member
of the Immunoglobulin Gene Superfamily
Judith D. Ochrietor,1 Tatiana P. Moroz,1 Leslie van Ekeris,1 Michael F. Clamp,1
Stephanie C. Jefferson,1 Ana C. deCarvalho,2 James M. Fadool,2 Graeme Wistow,3
Takashi Muramatsu,4 and Paul J. Linser1
PURPOSE. 5A11/Basigin has recently been identified as a critical
glycoprotein for full maturity and function of the mouse retina.
However, the biological function of 5A11/Basigin has yet to be
determined. Previous reports indicate the presence of multiple
5A11/Basigin polypeptides within the retina. Therefore, in an
effort to determine the function of 5A11/Basigin, the molecular
diversity of its expression was evaluated.
METHODS. Northern blot and immunoblot techniques were
used to evaluate the number of forms of 5A11/Basigin in
the mouse retina. cDNA cloning, using a mouse retina library or RT-PCR from rat, chicken, zebrafish, and human
retina, was performed to determine the sequence of 5A11/
Basigin transcripts. A peptide was generated, based on the
deduced amino acid sequence, for subsequent antibody production. Localization of 5A11/Basigin expression was evaluated by immunoblot, immunohistochemistry, and real-time
RT-PCR.
RESULTS. Two 5A11/Basigin transcripts of ⬃1.5 kb and ⬃1.8 kb,
which correspond to glycosylated proteins of ⬃45 and ⬃55
kDa, respectively, were identified in mouse retina. The shorter
form was previously cloned. However, the longer form, a
splice variant of mouse 5A11/Basigin, is a member of the
immunoglobulin gene superfamily and has been named 5A11/
Basigin-2. Homologous transcripts were also cloned from rat,
chicken, zebrafish, and human retina. 5A11/Basigin-2 expression was limited to the retina, specifically to photoreceptor
cells, where it appeared to be most concentrated in the inner
segments.
CONCLUSIONS. The specific and limited expression of 5A11/
Basigin-2 explicitly within photoreceptor cells implies that this
glycoprotein plays a fundamental role within the retina. However, its role remains to be determined. (Invest Ophthalmol
Vis Sci. 2003;44:4086 – 4096) DOI:10.1167/iovs.02-0995
R
From 1The Whitney Laboratory of the University of Florida, St.
Augustine, Florida; the 2Department of Biological Science, Florida State
University, Tallahassee, Florida; the 3Section on Molecular Structure
and Function, National Eye Institute, National Institutes of Health,
Bethesda, Maryland; and the 4Department of Biochemistry, Nagoya
University School of Medicine, Nagoya, Japan.
Supported NSF IBN-0113697 (PJL); National Eye Institute
F32EY13918 (JDO); and EY13020 (JMF).
Submitted for publication September 27, 2002; revised December
17, 2002; accepted January 27, 2003.
Disclosure: J.D. Ochrietor, None; T.P. Moroz, None; L. van
Ekeris, None; M.F. Clamp, None; S.C. Jefferson, None; A.C. deCarvalho, None; J.M. Fadool, None; G. Wistow, None; T. Muramatsu,
None; P.J. Linser, None
The publication costs of this article were defrayed in part by page
charge payment. This article must therefore be marked “advertisement” in accordance with 18 U.S.C. §1734 solely to indicate this fact.
Corresponding author: Judith D. Ochrietor, Whitney Laboratory of
the University of Florida, 9505 Ocean Shore Boulevard, St. Augustine,
FL 32080; [email protected].
ecently, 5A11/Basigin, a member of the immunoglobulin
gene superfamily, has emerged as an important glycoprotein in the mouse retina. Mice in which the gene for 5A11/
Basigin has been inactivated are visually impaired from the
time of eye opening (2 weeks of age) through maturity, as
indicated by ERG analyses.1,2 The architecture of the retina
appears normal at eye opening, despite the electrophysiological deficiency.1 However, by 3 weeks of age (visual maturity in
the mouse), the photoreceptor outer segments in the 5A11/
Basigin-null mouse retina appear less dense and shorter than
those of control littermates.3 Degeneration of the retina is first
observed at 8 weeks of age and by 1 year, the entire photoreceptor cell layer is missing.1–3 The biological mechanism underlying the visual dysfunction and failed retinal maturity in
5A11/Basigin-null mice remains to be determined. Therefore,
current efforts are directed at studying the biological relevance
of this membrane glycoprotein.
The first description of 5A11 appeared in 1986 in a report
by Linser et al.,4 who used antibodies produced against embryonic day-7 chick tissues to identify a novel Müller-cell (MC)–
specific protein.4 Subsequent work by Fadool and Linser5 identified the 5A11 antigen as a cell membrane glycoprotein found
on MCs and mature retinal pigmented epithelia (RPE) of
chicken retina. Characterization of the 5A11 antigen showed
that it is identical with the HT7 antigen, an inducible marker on
endothelial cells of the blood– brain barrier.6 Other homologous proteins in this family include M6/EMMPRIN in the human, which has been implicated in tumor metastasis and matrix metalloproteinase induction7,8; OX-47 or CD-147, a
lymphocyte activation marker in the rat9; CE-9 or PE-2 in rat
retina10,11; RPE7 in bovine retina12; and Basigin in the
mouse.13,14 A molecular function for 5A11/Basigin has yet to
be defined; however, it is thought that this glycoprotein participates in cell– cell interactions through binding to an unknown ligand. Several recent publications have demonstrated
the importance of 5A11/Basigin (CD147) in oocyte maturation,15 thymic development,16 and HIV-1 infection.17 The gene
for mouse 5A11/Basigin, located on chromosome 10, centimorgan (cM) position 42.2 (the short arm of human chromosome
19, region 13.3) has been cloned and characterized as having
seven exons (Ref. 14, http://www.ncbi.nlm.nih.gov/genome/
guide/mouse/ provided in the public domain by the National
Center for Biotechnology Information, Bethesda, MD). A single
5A11/Basigin transcript of 1.2 kb has also been cloned from a
mouse carcinoma cell line.13 The resultant nascent 5A11/Basigin polypeptide is 30 kDa.13,14,18 After glycosylation, the molecular mass increases to ⬃50 kDa.13,18 5A11/Basigin and its
homologues belong to the immunoglobulin gene superfamily
(IGSF) and possess two extracellular immunoglobulin (Ig) C2
domains, a hydrophobic transmembrane domain, and a short
cytoplasmic tail.5-13 All the known members of this family
share extensive amino acid sequence identity in the transmembrane and cytoplasmic regions, with less, but significant, similarity in the extracellular domains.19
Previous work in this laboratory demonstrated the presence
of an additional form of 5A11/Basigin in the chick neural
4086
Investigative Ophthalmology & Visual Science, September 2003, Vol. 44, No. 9
Copyright © Association for Research in Vision and Ophthalmology
IOVS, September 2003, Vol. 44, No. 9
retina.5,18 It was shown that the second form is not attributable
to differential glycosylation of the 5A11/Basigin polypeptide, as
two forms were observed after deglycosylation.18 Presently,
we report that a splice variation of 5A11/Basigin, found only in
the retina, is encoded within the mouse gene. This second
form, which we have named 5A11/Basigin-2 (GenBank accession number AY089967; http://www.ncbi.nlm.nih.gov/Genbank; provided in the public domain by the National Center for
Biotechnology Information, Bethesda, MD), is a transcript of
⬃1.8 kb and is the result of additional sequence from the
intron 1 region spliced into the 5⬘ end of the previously cloned
5A11/Basigin transcript. Prediction software indicates that the
5A11/Basigin-2 polypeptide is similar in structure to that of
5A11/Basigin, with an additional C2 Ig domain in the extracellular portion of the molecule. Expression of 5A11/Basigin-2 is
specific to the retina, particularly to photoreceptor cells, as
determined by immunoblot and real-time PCR analyses.
Analysis of the amino acid sequence of mouse 5A11/Basigin
through a BLAST20 alignment indicates that this sequence has
significant identity to rat neuroplastin gp65, a synaptic membrane glycoprotein.21 Therefore, 5A11/Basigin-2 was cloned
from rat retina RNA (GenBank accession number AY120888) to
ensure that they were indeed distinct transcripts, rather than
species-specific homologues. 5A11/Basigin-2 was also cloned
from chicken and zebrafish retina cDNA. In addition, the human version of this transcript was identified and subsequently
cloned using expressed sequence tags (ESTs) generated from
human retina at the National Eye Institute.22 Significant sequence identity exists within the amino-terminal Ig loops of
5A11/Basigin-2 from these species. Analyses of the amino acid
sequences of the 5A11/Basigin and neuroplastin family members suggest that they are indeed closely related yet distinct
membrane glycoproteins that should be grouped within the
same subset of the IGSF.
MATERIALS
AND
METHODS
Animals
Tissue samples were obtained from wild-type (⫹/⫹ for 5A11/Basigin)
C57/129 hybrid (the background of the 5A11/Basigin knockout)
mice.23 Rat eyecups from albino and pigmented animals were a generous gift of Dietmar Kultz and Devulapalli Chakravarty of the Whitney
Laboratory. Fertilized chicken eggs were obtained from Charles River
Laboratories (North Franklin, CT) and incubated in a forced-draft incubator at 37°C and with saturated humidity at the Whitney Laboratory. Rabbits were obtained from Myrtle’s Rabbitry, Inc. (Thompson
Station, TN) and maintained at the Whitney Laboratory for the purpose
of antibody production. Zebrafish (Ekkwill strain) were reared at the
Florida State University Animal Care Facility.
Care and handling of these animals was in accordance with the
guidelines established by the University of Florida, Florida State University, and the Institutional Animal Care and Use Committee (IACUC).
These experiments adhered to the ARVO Statement for the Use of
Animals in Ophthalmic and Vision Research.
Reagents
The 5A11/Basigin-specific polyclonal antiserum was generated by this
laboratory with a 5A11/Basigin-GST fusion protein supplied by one of
the authors (TM) and has been described previously.24 The neuroplastin polyclonal antiserum was a generous gift from Philip Beesley (Royal
Holloway University of London, UK).21
A 5A11/Basigin-2–specific antiserum was also generated by this
laboratory. A potentially immunogenic region of the novel immunoglobulin loop was synthesized as a peptide (CRASSDPDRNHLTRPPRVKW) by the University of Florida ICBR Protein Chemistry and
Biomarkers Facility (Gainesville, FL), which was subsequently conjugated to keyhole limpet hemocyanin (KLH) by using a kit (EZ Anti-
Molecular Diversity of 5A11/Basigin in the Retina
4087
body Production and Purification; Pierce, Rockford, IL). The immunization protocol followed that specified by Pierce for this conjugation
protocol.
All bleeds were allowed to clot overnight at 4°C, and the serum was
isolated by centrifugation at 3000 rpm for 15 minutes (Damon IEC
PR-6000 centrifuge; GMI, Albertville, MN). Antibodies specific for the
5A11/Basigin-2 peptide were affinity purified using the peptide listed
earlier conjugated to a gel column (SulfoLink; Pierce) according to the
protocol of the manufacturer. Antibody specificity for 5A11/Basigin-2
within mouse retina was evaluated by immunoblot analyses. Serial
dilutions of the purified antibody were used to determine the proper
working dilution. Preabsorption of peptide with antibody before probing the membrane was also performed to verify antibody specificity for
mouse 5A11/Basigin-2.
RNA and Protein Isolation
Wild-type (⫹/⫹ for 5A11/Basigin) mice, rats, or hatchling chicks were
killed according to accepted protocols, the eyes were enucleated
immediately, and the neural retinas were isolated. Other mouse tissues,
including brain, liver, lung, heart, skeletal muscle, spleen, testes, and
uterus, were also isolated. The tissues were homogenized in extraction
reagent (TRI; MRC, Cincinnati, OH), and total RNA was extracted.
Proteins were then isolated from the organic phase and solubilized in
1% SDS. Both procedures were performed according to the protocol of
the manufacturer.
Northern Blot Analysis
The sequence corresponding to exon 7 of the mouse 5A11/Basigin
gene was amplified by PCR using primers Bsgex7F (5⬘-AGGGCAGTGGAACTCACATGAATGAC) and BsgendRV (5⬘-GGTGGGGTAGGTCTTTATTTGGGG), Taq polymerase (EX Taq; Panvera/Takara, Madison,
WI), and the following cycling parameters: 96°C for 5 minutes, followed by 30 cycles of 96°C for 1 minute, 55°C for 1 minute, and 72°C
for 3 minutes. The resultant product was then radiolabeled with
32
P-dCTP and the Klenow fragment (Oligolabeling kit; Amersham Biosciences, Piscataway, NJ).
Total RNA from normal and null mice was separated on a glyoxyl/
dimethyl sulfoxide (DMSO) agarose gel and transferred to a nytran
membrane using a commercial system (TurboBlotter; Schleicher &
Schuell, Keene, NH). The blot was incubated in prehybridization buffer
(50% formamide, 5⫻ SSPE, 0.5% SDS, 5⫻ Denhardt’s solution, 100
mg/mL herring sperm DNA) for 1 hour at 42°C, followed by an
overnight incubation in hybridization buffer (prehybridization buffer
containing 100 ng/␮L of 32P-labeled exon 7 probe) at 42°C. The blot
was subjected to several rounds of washes in 1⫻ SSPE and 0.1% SDS;
followed by 0.1⫻ SSPE, 0.1% SDS at 60°C. The blot was placed in a
phosphor screen cassette (Amersham Biosciences, Sunnyvale, CA) for
visualization using a phosphorescence imager (Phosphorimager SI;
Amersham Biosciences) and accompanying software (Image Quant;
Amersham Biosciences). Figure 1 was assembled on computer
(CorelDraw 9.0; Corel Corp., Ottawa, Ontario, Canada).
Immunoblot Analysis
Immunoblot analysis was performed as previously described.3 Briefly,
retina protein lysates (6 ␮g total protein) or mouse tissue proteins
were separated by SDS-PAGE using 4% to 12% gradient gels in 2-(Nmorpholino)ethane sulfonic acid (MES) buffer (Novex, San Diego, CA)
and transferred to nitrocellulose membranes (NitroPure; MSI, Westborough, MA). Blots were stained with 0.1% fast green in methanol, acetic
acid, and H2O (5:1:5), destained, documented, and blocked with a 2%
solution of nonfat dry milk in TTBS (TBS containing 0.1% Tween-20)
for 1 hour at room temperature. After incubation in blocking buffer,
the blots were incubated in anti-5A11/Basigin antiserum (1:100 dilution), affinity-purified anti-5A11/Basigin-2 antibody (1:10 dilution), affinity-purified anti-5A11/Basigin-2 antibody (1:10 dilution) with 100
␮g/mL 5A11/Basigin-2 peptide, or anti-rat neuroplastin polyclonal antiserum (1:500) for 1 hour at 37°C. Blots were washed and incubated
4088
Ochrietor et al.
in the appropriate alkaline phosphatase (AP)-conjugated secondary
antibody (Jackson ImmunoResearch Laboratories, West Grove, PA) at a
dilution of 1:500 for 1 hour at 37°C. The blots were then incubated in
AP substrate (Bio-Rad, Hercules, CA). Protein expression was documented using a scanner (ScanJet 6100C; Hewlitt Packard, Palo Alto,
CA), and the figures were assembled on computer (CorelDraw 9.0).
cDNA Cloning of Mouse, Rat, and
Chicken 5A11/Basigin-2
A mouse retina cDNA library prepared by Stratagene (lamda Zap II;
Stratagene, La Jolla, CA) was provided as a generous gift from Robert
Nickells (presently at the University of Wisconsin) and Donald Zack
(Johns Hopkins Medical School). PCR amplification was performed
using Taq polymerase (EXTaq; Panvera/Takara) in conditions suggested by the manufacturer and 50 picomoles each of a universal T3
primer and a gene-specific primer, Bsgex2RV (5⬘-GCAGGTAAACTGTGTTTTGGAGTTGAC), that anneals within exon 2 of the Basigin gene
in the antisense direction. PCR conditions were as follows: 96°C for 5
minutes, followed by 30 cycles of 96°C for 1 minute, 55°C for 1
minute, and 72°C for 3 minutes. All specific products obtained were
subcloned into a commercial vector (pCR-4-TOPO; Invitrogen, Carlsbad, CA) for sequencing using a commercial system (Big Dye terminator reaction and model 310 automated sequencer; Applied Biosystems,
Inc., Foster City, CA). A PCR colony screen using M13Rev and M13F
universal primers, a PCR master mix (Promega, Madison, WI), and the
cycling parameters listed earlier, found a clone containing a 500-bp
insert that aligned within the exon 1 region, as well as the intron 1
region of the mouse Basigin gene after a BLAST search.20 A primer
B6799 (5⬘-CTGGTTTCCTCAAGGCACCATGTC), which aligns within
intron 1 starting at base 6799 of the mouse gene, and a universal T7
primer were used for rapid amplification of cDNA ends (3⬘-RACE). The
PCR conditions were the same as those just indicated.
The contiguous 5A11/Basigin-2 transcript was generated from
mouse retina total RNA using 50 picomoles each of Bsgex1 (5⬘CAGCTCCTGGACGAGGCGACATG) and BsgendRV (5⬘-GGTGGGGTAGGTCTTTATTTGGGG) primers through RT-PCR using lyophilized
beads (Ready-To-Go RT-PCR beads; Amersham Biosciences), according
to the protocol of the manufacturer. The same PCR cycling protocol
was used as described earlier; however, 60 cycles were necessary to
observe a product at ⬃1800 bp. A diffuse product was observed and
excised for use in a second round of PCR, using the same primer set.
This procedure was repeated a second time, with the same primers,
before the desired product was visualized. The 1769-bp contig was
then subcloned into the pCR-4-TOPO vector (Invitrogen), and colonies
containing appropriately sized inserts, as determined by the PCR colony screening method described herein, were sequenced as described
earlier and compared with the published mouse 5A11/Basigin gene
sequence.
For cDNA cloning from rat retina RNA, RT-PCR was performed
using the beads (Ready-To-Go RT-PCR; Amersham Bioosciences), according to the protocol of the manufacturer. PCR conditions were as
described earlier. PCR primers (50 picomoles each) Bsgex1 and
Bsgex2RV were used to obtain an initial product of ⬃400 bp. A primer
was subsequently generated to anneal within this sequence in the
sense direction. RT-PCR using the B6799 and BsgendRV primers was
performed as described to obtain the 3⬘ end of the transcript. The
contiguous rat 5A11/Basigin-2 transcript was generated with 50 picomoles each of Bsgex1 and BsgendRV by RT-PCR, using the lyophilized
beads according to the protocol of the manufacturer and the cycling
protocol that was used to obtain the full-length mouse cDNA.
For cDNA cloning from chicken retina, an alignment of the mouse
and chicken 5A11/Basigin (short form) amino acid sequences provided
information for designing oligonucleotide primers. RT-PCR was
performed using the beads (Amersham Biosciences), according the
protocol of the manufacturer, and the cycling parameters described
earlier. PCR primers (50 picomoles each) avBsg2 (5⬘-GAGCGGGCGGAGATGGCGGCGG) and avBsg3RV (5⬘-GCTGCTGTACTGCCCTGT-
IOVS, September 2003, Vol. 44, No. 9
GATCAC) were used to obtain a partial sequence of the transcript.
Various primers were designed, based on the chicken 5A11/Basigin
sequence (accession number A31001) to obtain the remainder of the
sequence using a chicken retina cDNA library (Stratagene) received as
a generous gift from Susan Semple-Rowland of the University of Florida. The contiguous chicken 5A11/Basigin-2 transcript was generated
using 50 picomoles each of avBsg2 and avBsg4RV (5⬘-GGAAAAAAAGAGAGGAATCATCTTTAT) by RT-PCR using beads according to the protocol of the manufacturer and the cycling protocol that was used to
obtain the full-length mouse and rat cDNAs.
cDNA Cloning of 5A11/Basigin-2 from Zebrafish
Partial nucleotide sequences in the zebrafish EST database (GenBank
accession numbers BI428137, BI429447, and AI416363) provided information for designing oligonucleotide primers 5⬘-CAAGCCGAAGCTATGACAGG-3⬘ (Ig) and 5⬘-TCTGCTTGCAGCACAGTATG (3⬘ untranslated region [UTR]) for cloning the partial z5A11 cDNA.
Total RNA from adult zebrafish retina was obtained using extraction reagent (TRIzol; Invitrogen-Gibco, Rockville, MD). Retinal cDNA,
obtained by reverse transcription using oligo dT primer (Advantage
RT-for-PCR Kit; Clontech, Palo Alto, CA), served as template for PCR,
using the Ig and 3⬘UTR primers. Sequence information from the resultant PCR product was used to design gene-specific oligonucleotide
primers for RACE: 5⬘-CGGATTGTTCACCTCGGGACT and 5⬘-GGGTCAAGTCATGATGGTTGC. The 5⬘ cDNA sequence was obtained by
5⬘RACE (GeneRacer Kit; Invitrogen). The full length cDNA was amplified from retinal cDNA using oligos 5⬘UTR (5⬘-AGTGAGCTCCGAGTCCGAAC) and 3⬘UTR and a commercial system (Expand High Fidelity
PCR System; Roche Diagnostics, Indianapolis, IN).
cDNA Cloning of Human 5A11/Basigin-2
As part of the NEIBank project,25 several thousand human retina–
expressed transcripts have been identified by EST analysis (Ref. 22 and
unpublished; http://neibank.nei.nih.gov/ provided in the public domain by the National Institutes of Health, Bethesda, MD). Details of
library construction and sequencing are described elsewhere.25,26
Briefly, mRNA from human retina was used to create a cDNA library in
a commercial vector (pSport1; Invitrogen), and this library was subjected to sequencing at the NIH Intramural Sequencing Center, using
automated fluorescence sequencers (model 3700; Applied Biosystems).
Immunohistochemistry
Primary fixation of mouse retinas was by perfusion with 4% paraformaldehyde in 0.1 M cacodylate (pH 7.4) followed by enucleation and
immersion in the same solution for 1 hour at 4°C. The tissue was
transferred to a 30% sucrose solution and incubated overnight at 4°C.
The tissue was then transferred to optimal cutting temperature (OCT)
compound (Sakura Finetek USA., Inc., Torrance, CA) and frozen. Tissues were sectioned 12 ␮m thick, mounted on gelatin-coated slides,
and transferred to Tris-buffered saline (TBS: 0.01 M Tris, 0.15 M NaCl,
1.3 mM CaCl2; pH 7.4). The tissues were labeled for indirect immunofluorescent localization of both forms of 5A11/Basigin or of 5A11/
Basigin-2 specifically. Briefly, the tissues were incubated in TTBS (TBS
containing 0.1% Tween 20), containing 2% normal goat serum in a
humid environment for 1 hour at 37°C. The tissues were then incubated in TTBS containing 2% normal goat serum with rabbit anti-5A11/
Basigin (1:100), affinity-purified rabbit anti-5A11/Basigin-2 (1:10), or
affinity-purified rabbit anti-5A11/Basigin-2 (1:10) with 100 ␮g/mL
5A11/Basigin-2 peptide for 1 hour at 37°C, followed by an overnight
incubation at 4°C. The sections were washed in TBS, followed by
incubation for 1 hour in TTBS containing 2% normal goat serum with
FITC-conjugated goat anti-rabbit secondary antibody (1:50, Jackson
ImmunoResearch Laboratories). Coverslips were mounted with TBS/
glycerol (1:1) containing p-phenylenediamine (Sigma-Aldrich, St. Louis,
MO) and viewed with a confocal microscope (model SP2; Leica, Deerfield, IL). Images were gathered digitally with the confocal software
IOVS, September 2003, Vol. 44, No. 9
Molecular Diversity of 5A11/Basigin in the Retina
4089
and assembled for publication on computer (CorelDraw 9.0; Corel
Corp.).
Single Cell-Type Isolation and cDNA Synthesis
A wild-type mouse was killed according to accepted protocols, and the
eyes were removed immediately. The neural retina was separated from
the RPE and dissociated with papain, as previously described.3 Briefly,
the neural retinas were incubated in calcium- and magnesium-free salt
solution containing 500 ␮g/mL cysteine and 500 ␮g/mL papain for 1
hour at 37°C. Digestion was stopped by the addition of soybean trypsin
inhibitor and 10% fetal bovine serum. The tissue was disrupted by
trituration with a glass Pasteur pipette. The cells were diluted 1:1000
in Medium 199 (Sigma-Aldrich) containing 10% FBS, placed on a depression slide, and viewed with a phase-contrast microscope (Nikon,
Melville, NY). MCs and photoreceptor cells (PCs), 100 of each, were
selected separately based on the appearance of dissociated retina cells
from a previous publication from this laboratory,3 using a glass micropipette mounted on a microinjector apparatus (Nanoject; Drummond Scientific Co., Broomall, PA) and immediately placed in 100%
ethanol. Reverse transcription without RNA isolation was performed
with a kit (Cells-to-cDNA; Ambion, Austin, TX), according to the
instructions of the manufacturer. The cDNA was then used as a template for relative quantitation of gene expression using real-time PCR.
Relative Quantitation of Gene Expression Using
Real-Time PCR
Relative amounts of 5A11/Basigin and 5A11/Basigin-2 were determined
with green nucleic acid gel stain on a sequence-detection system
(SYBR Green and Prism 7000; Applied Biosystems, Inc.). Primers specific for 5A11/Basigin, 5A11/Basigin-2, and mouse 18S ribosomal
RNA were designed on computer (Primer Express; Applied Biosystems, Inc.). Primer sets were as follows: ABIBASF 5⬘-CTGCGCGGCGGCGGGCACCAT; ABIBASR 5⬘-GCTGTTCAAAGAGCAGGTAAGCT;
ABIBAS2F 5⬘-TGGACCGTGTTCACATCCAT; ABIBAS2R 5⬘-CCCATCAACAGAGAGCGAACT; 18sRNAF 5⬘-AGTCCCTGCCCTTTGTACACA;
18sRNAR 5⬘-CCGAGGGCCTCACTAAACC. The 5A11/Basigin sense
primer spans the exon 1– exon 2 boundary so that this transcript
would be specifically recognized. All runs were performed in triplicate
according to the default PCR protocol (50°C for 2 minutes, 95°C for 10
minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1 minute)
or the default one-step RT-PCR protocol (42°C for 30 minutes, 95°C for
10 minutes, and 40 cycles of 95°C for 15 seconds and 60°C for 1
minute). Relative standard curves were generated for each primer set
so that the input amount from unknown samples could be calculated.
Expression of 5A11/Basigin and 5A11/Basigin-2 was normalized with
18S ribosomal RNA expression within the corresponding tissue or cell
type. Expression within each tissue or cell type, relative to that found
in the retina (or MCs), was compared and expressed in graph format
(Excel; Microsoft, Redmond, WA).
RESULTS
5A11/Basigin-2 cDNA Cloning
Previous studies by this laboratory indicated that two forms of
5A11/Basigin exist within the avian retina, but not in any other
avian tissue examined.5,18 Fadool and Linser18 demonstrated
that these are two distinct polypeptides and not simply the
products of differential glycosylation events. This unique expression pattern of 5A11/Basigin in the retina was observed in
the mouse as well. Figure 1 shows analyses of 5A11/Basigin
mRNA and protein in the mouse neural retina. Total RNA from
normal and 5A11/Basigin null mouse retinas were probed with
a radiolabeled oligonucleotide corresponding to the 3⬘ end of
5A11/Basigin. Two transcripts of ⬃1.5 and ⬃1.8 kb were
observed in the RNA from the normal mouse, but no signal was
found in the null mouse retina. Similarly, two polypeptides of
FIGURE 1. Immunoblot and Northern blot analyses of normal and
5A11/Basigin null mouse retinas. (A) Northern blot of normal (⫹/⫹)
and null (⫺/⫺) mouse neural retina total RNA probed with a radiolabeled oligonucleotide corresponding to the exon 7 region of the
mouse 5A11/Basigin gene. Two transcripts of ⬃1.5 kb and ⬃1.8 kb are
observed in normal mouse retina, but no signal is observed in the null
mouse. (B) Immunoblot of normal (⫹/⫹) versus null (⫺/⫺) mouse
neural retina proteins probed with a polyclonal antiserum specific for
mouse 5A11/Basigin. Two polypeptides of ⬃45 and ⬃55 kDa were
observed in normal retina, but no signal was detected in the 5A11/
Basigin null mouse.
⬃45 and ⬃55 kDa were observed on immunoblots of normal
mouse retina proteins probed with a polyclonal antibody specific for 5A11/Basigin,24 but again no signal was detected in
null mouse retina. Because both forms of 5A11/Basigin are
missing in the null mouse, which was generated by insertional
deletion,23 it suggests that they are splice variants of a single
gene.
The mouse gene (11.8 kb) was cloned from a mouse liver
genomic library and was characterized as containing seven
exons.14 The intron 1 region between exons 1 and 2 is large
(⬃5 kb) and therefore served as the starting point for the
investigation of 5A11/Basigin splice variations. Our hypothesis
was that the two forms differed only in the number of C2 Ig
loops in the extracellular domain. Precedence for this type of
splice variation in the IGSF was recently demonstrated for
neuroplastins gp55 and gp65.21 These two polypeptides differ
only in the extracellular domain, so that gp55 possesses two
Ig-like loops and gp65 has three Ig-like loops.21
A diagram of the cloning strategy is shown in Figure 2. A
primer was designed to anneal within exon 2 of the mouse
5A11/Basigin gene in the antisense direction (ex2RV). A mouse
retina cDNA library served as the template for PCR amplification using the ex2RV primer and a universal T3 primer, which
anneals to the 5⬘ end of the cDNA library. One clone contained
a sequence that aligned within intron 1 of the mouse 5A11/
Basigin gene. Additional primers were designed to extend the
cDNA using the initial sequence obtained and 5⬘/3⬘ RACE was
performed to get the full sequence of 5A11/Basigin-2. The
complete cDNA sequence and the deduced amino acid se-
4090
Ochrietor et al.
IOVS, September 2003, Vol. 44, No. 9
FIGURE 2. Cloning strategy used to
isolate mouse 5A11/Basigin-2. Previously identified exons within the
mouse 5A11/Basigin gene are shown
as filled boxes. The newly identified
exon is shown as an open box. The
general locations of pertinent primers are indicated. Arrows: orientation of the primers. A universal T3 primer and the ex2RV primer were used to obtain the initial fragment within
exon 1A from a mouse retina cDNA library through PCR. The B6799 primer was then designed to elongate the sequence in the 3⬘ direction with
the use of a universal T7 primer. Bsgex1 and BsgendRV primers were used to obtain the contiguous 5A11/Basigin-2 cDNA from mouse retina RNA
by RT-PCR.
quence for 5A11/Basigin-2 are shown in Figure 3. RT-PCR,
using primers at the extreme 5⬘ and 3⬘ ends of the transcript
(Bsgex1 and BsegendRV, respectively), was also performed on
C57/129 hybrid mouse retina RNA to ensure that the cloned
cDNA was biologically relevant. The newly identified exon,
between bases 6799 and 7146 of the mouse gene, has been
named 1A to avoid confusion in the literature.
Structure prediction software analyses of the 5A11/Basigin-2 sequence using the Pfam database27 suggest that the
spliced sequence forms a third extracellular C2 Ig loop in the
predicted protein. Figure 4 shows the predicted structure of
5A11/Basigin and 5A11/Basigin-2. It has been determined that
5A11/Basigin is present in the cell membrane as a dimer28;
however, the stoichiometry of 5A11/Basigin-2 has not yet been
determined. 5A11/Basigin possesses three N-linked glycosylations, as well as two O-linked glycosylations per polypeptide.18,29,30 Prediction software analyses of the 5A11/Basigin-2
amino acid sequence using the Technical University of Denmark Center for Biological Sequence Analysis website indicate
that several N-linked and O-linked glycosylations are present in
this form as well (Gupta R, et al. manuscript in preparation).31
Our future studies will be aimed at identifying the carbohydrate moieties associated with 5A11/Basigin-2.
A BLAST20 search, using the cDNA sequence encoding the
novel Ig loop within mouse 5A11/Basigin-2, indicated that this
sequence is 68% identical with rat neuroplastin gp65. It was
then necessary to determine whether these are species-specific
homologues of the same proteins or distinct membrane glyco-
FIGURE 3. Nucleotide and deduced amino acid sequence of 5A11/Basigin and 5A11/Basigin-2. The insertion of the 5A11/Basigin-2–specific
sequence is in phase with the reading frame of 5A11/Basigin. The region of the cDNA specific to 5A11/Basigin-2 is underscored. In the deduced
amino acid sequence, the leader sequence and transmembrane domain are in boxes. Conserved cysteines of the Ig domains are in parentheses.
IOVS, September 2003, Vol. 44, No. 9
Molecular Diversity of 5A11/Basigin in the Retina
4091
tamate residue present within the hydrophobic transmembrane domain of all 5A11/Basigin family sequences.21
Generation of 5A11/Basigin-2–Specific Antiserum
FIGURE 4. 5A11/Basigin-2 is a member of the IGSF, based on structure
prediction analyses. The tertiary structures of 5A11/Basigin and 5A11/
Basigin-2 are shown as simple schematics. The Ig domains within each
peptide are represented by circles. The two peptides differ in structure
only by the presence of a third Ig loop in the extracellular domain of
5A11/Basigin-2. 5A11/Basigin forms a homodimer within the cell membrane; however, the stoichiometry of 5A11/Basigin-2 association is not
yet known. N-linked glycosylations are represented by the shaded
icons and O-linked glycosylations are represented by open icons. Glycosylation sites on the 5A11/Basigin molecule are known,18,29,30
whereas those shown for 5A11/Basigin-2 are predicted.31,32
proteins. Therefore, 5A11/Basigin-2 was cloned from rat retina
RNA, using a strategy similar to that used for the mouse homologue. A BLAST20 comparison of these two rat cDNA sequences
indicates that they are indeed two distinct transcripts. The
cDNA sequence for 5A11/Basigin-2 was similarly obtained from
hatchling chicken retina (in this laboratory) and from the
zebrafish (Ekkwill strain) retina, by the James Fadool laboratory
at Florida State University (GenBank Accession number
AY155495).
5A11/Basigin-2 was also identified through the NEIBank
project.25 Twelve cDNA clones for 5A11/Basigin were identified in the human retina collection (22 and unpublished;
http://neibank.nei.nih.gov). Seven clones were essentially full
length, and of these, five contained the inserted exon sequence. A 1730-bp sequence was assembled by independent
readings from 20 cDNA clones derived from different human
eye tissues (GenBank accession number AF548371). The sequence was unambiguous, with two possible polymorphic
sites, at position 735 (C/T) and at 1249 (A/G). Both these
variants are silent with respect to predicted amino acid sequence.
Figure 5 shows an alignment of the 5A11/Basigin-2 amino
acid sequences from mouse, rat, human, chicken, and zebrafish, as well as rat neuroplastin gp65. The 5A11/Basigin-2
amino acid sequences shown share ⬃69% identity. Within the
amino-terminal Ig loop, these same sequences share 79.5%
identity. These sequences and the rat neuroplastin gp65 amino
acid sequence are 74.5% identical and 67% homologous in their
amino-terminal Ig loops, based on BLAST database searches.20
It was also striking to note the high sequence conservation
within the transmembrane domains of these proteins. The
transmembrane sequences of 5A11/Basigin family members
and the neuroplastins are 67% identical. The neuroplastin gp65
sequence also contains the characteristic and yet peculiar glu-
The deduced amino acid sequence and predicted tertiary structure of mouse 5A11/Basigin-2 was used to identify a potentially
immunogenic region specific to that form. A peptide was
generated and conjugated to a carrier protein for antibody
production in rabbits. Figure 6A shows immunoblots of total
mouse retina proteins probed with the anti-5A11/Basigin-2
affinity-purified polyclonal antibody (lane 1) or the general
5A11/Basigin antiserum (lane 3). A single polypeptide of 55
kDa was observed using the 5A11/Basigin-2–specific antibody,
whereas the general antiserum recognized both the 55- and
45-kDa forms. The amino acid sequence chosen is identical
with the rat sequence, which suggests that the antibody would
recognize 5A11/Basigin-2 within rat retina lysates. Indeed, the
5A11/Basigin-2–specific antibody recognizes a single polypeptide of 50 kDa, which is a slightly smaller molecular mass than
the mouse homologue (Fig. 6A, lane 2). The rat 5A11/Basigin-2
polypeptide is one amino acid shorter than the mouse polypeptide. Perhaps different sugar moieties are associated with
5A11/Basigin-2 in mouse and rat retina, which would contribute to the difference in size between the two species. Both
forms are recognized by using the general 5A11/Basigin antiserum (50 and 40 kDa in rat, Fig. 6A, lane 4). This antibody did
not, however, detect 5A11/Basigin-2 within retina lysates prepared from chicken or human retinas (data not shown), most
likely because of the few amino acid differences between these
species and mouse within the peptide used to generate the
antibody. The presence of neuroplastins within rat retina lysates is also demonstrated (Fig. 6B, lane 2) and is consistent
with the results obtained by Kreutz et al.32 No neuroplastin
signal was detected using mouse retina lysates (data not
shown).
Localization of 5A11/Basigin-2 Expression within
the Mouse Retina
The distribution of the two forms of 5A11/Basigin in the mouse
eye was evaluated by immunohistochemical and quantitative realtime PCR analyses. Immunohistochemistry, in which cryosections
of a mature mouse eyecups were incubated with the antiserum
that recognizes both forms of 5A11/Basigin, produced a signal on
the apical and basal surfaces of the RPE, the surface of MCs, PC
bodies and the inner segments, and blood vessels (Refs. 2,3, Fig.
7A). Incubation of the cryosections with the 5A11/Basigin-2–
specific affinity-purified antibody indicates that 5A11/Basigin-2 is
present on the surface of photoreceptor cells and the inner
segments (Fig. 7B). The 5A11/Basigin-2–specific antibody also
faintly labeled the outer plexiform layer; however, no signal was
detected on the RPE or blood vessels (Fig. 7B). This signal is
considered specific for 5A11/Basigin-2, because incubation of
peptide with the antibody before immunostaining blocked the
signal completely (data not shown). Also, incubation of mouse
eyecup cryosections with the secondary antibody alone produced
no significant signal (data not shown).
The results of the immunohistochemistry, using the newly
generated antibody indicates that 5A11/Basigin-2 expression is
restricted to the PCs. The general 5A11/Basigin antiserum also
labels the PCs; however, it is not known whether both forms
contribute to the PC immunoreactivity, or just the long form.
Because the entire sequence of the short form of 5A11/Basigin
is contained within the long form, the ability to generate an
antibody specific for the short form is greatly hindered. Therefore, analyses of the expression of 5A11/Basigin and 5A11/
Basigin-2 were performed by quantitative real-time PCR with
cDNA isolated from MCs and PCs of dissociated mouse retinas
4092
Ochrietor et al.
IOVS, September 2003, Vol. 44, No. 9
FIGURE 5. Amino acid sequence alignment of the 5A11/Basigin-2 homologues and rat neuroplastin gp65. The amino acid sequences for mouse, rat,
human, chicken, and zebrafish 5A11/Basigin-2 homologues, as well as that for rat neuroplastin gp65, were aligned on computer (DNAMan version 5.0
software; Lynnon Biosoft, Montreal, Quebec, Canada). Note the significant sequence homology within the amino-terminal Ig loops (asterisks: sequence
from the new exon). Also notice the significant sequence homology in the transmembrane domains of these proteins (amino acids 326-349 in mouse).
and green nucleic acid staining technology (SYBR Green; Applied Biosystems, Inc.). MCs and PCs were isolated based on
their appearances after dissociation, using a protocol previously published by this laboratory.3 Primer sets were designed
to specifically amplify 5A11/Basigin (spanning the exon 1 to 2
junction) or 5A11/Basigin-2 (within exon 1A). Figure 8A indicates that the shorter form is predominantly expressed by MCs,
although this difference in expression was not statistically
significant in a Student’s t-test. 5A11/Basigin-2 expression was
observed in MC cDNA as well; however, it is predominantly
expressed by PCs (Fig. 8B). The difference in 5A11/Basigin-2
expression between MCs and PCs is statistically significant by
Student’s t-test (P ⬍ 0.01).
The ratio of 5A11/Basigin to 5A11/Basigin-2 expression
within the mouse neural retina was also evaluated by real-time
RT-PCR. RNA isolated from the neural retina of a 3-week-old
mouse was analyzed, using the same primer sets described
earlier. The results of such analyses are presented as a graph in
Figure 8C. At this age, 5A11/Basigin-2 expression is approximately twice that of the short form (Fig. 8C).
Expression of 5A11/Basigin-2 in Other
Mouse Tissues
The expression of 5A11/Basigin and 5A11/Basigin-2 in other
mouse tissues was evaluated by immunoblot and quantitative
IOVS, September 2003, Vol. 44, No. 9
Molecular Diversity of 5A11/Basigin in the Retina
4093
FIGURE 6. Antibody specificity for 5A11/Basigin-2. (A) The specificity
of the 5A11/Basigin-2 peptide antiserum was evaluated by immunoblot
analyses. Total protein (5 ␮g) from mouse retina (lanes 1 and 3) or rat
retina (lanes 2 and 4) were probed with the affinity-purified polyclonal
antibody (lanes 1 and 2) or the general 5A11/Basigin antiserum (lanes
3 and 4). A single polypeptide of ⬃55 kDa was observed in mouse
retina using the 5A11/Basigin-2 antibody, whereas the general antiserum recognizes both forms (45 and 55 kDa in mouse). (B) Total
protein (5 ␮g) from rat retina was probed with the general 5A11/
Basigin antiserum (lane 1), or the anti-rat neuroplastin polyclonal
antiserum (lane 2). Two 5A11/Basigin polypeptides are present within
rat retina (40 and 50 kDa), as well as two distinct neuroplastin polypeptides (55 and 65 kDa).
real-time RT-PCR analyses. Figure 9A shows an immunoblot of
proteins isolated from mouse retina, brain, lung, liver, kidney,
heart, spleen, uterus, and skeletal muscle. The amount of
protein loaded in each lane varies to show 5A11/Basigin expression within each tissue. Therefore, this analysis does not
represent a true quantitation of 5A11/Basigin expression.
5A11/Basigin was observed in all tissues examined; however,
5A11/Basigin-2 was observed only in the proteins isolated from
mouse retina, not in the other tissues examined. Note that
5A11/Basigin appears to have different molecular masses in
different tissues. This difference can be attributed to differential glycosylation, which was also previously shown in the
mouse and chick.18,29,30 To further illustrate the point that
5A11/Basigin-2 is present only within the retina but not the
other tissues examined, a duplicate blot was probed with the
affinity-purified antibody specific for 5A11/Basigin-2. Figure 9B
FIGURE 8. Real-time PCR analyses of 5A11/Basigin family members.
Real-time PCR was performed on cDNA isolated from MCs and PCs.
Primers were designed such that 5A11/Basigin (A) and 5A11/Basigin-2
(B) could be individually identified. (C) Real-time RT-PCR was performed on total retina from a 3-week-old mouse. The runs were
performed in triplicate and expression was normalized to that of the
mouse 18S ribosomal RNA. Expression values plotted were calculated
relative to expression within the MC cDNA (A, B) or for the short form
in total retina (C). Standard deviations are represented by error bars.
*P ⬍ 0.01 by Student’s t-test.
FIGURE 7. Localization of 5A11/Basigin-2 within the mouse retina.
Cryosections of mouse retina were analyzed by indirect immunofluorescence. Tissues were labeled using the general 5A11/Basigin antiserum (A) or the affinity-purified polyclonal antibody specific for 5A11/
Basigin-2 (B). The general 5A11/Basigin antiserum labels MCs, PCs
(inner segments), RPE, and blood vessels (arrowhead). 5A11/Basigin-2
was found on the surface PCs and the inner segments. RPE, retinal
pigmented epithelium; OS, outer segments; IS, inner segments; PC,
photoreceptor cell layer; OPL, outer plexiform layer; INL, inner nuclear layer; IPL, inner plexiform layer; GC, ganglion cell layer. Magnification bar, 40 ␮m.
shows this immunoblot, on which the 5A11/Basigin-2 signal
was observed only in the retina.
The relative levels of transcription for 5A11/Basigin and
5A11/Basigin-2 in mouse tissues were evaluated by quantitative
real-time RT-PCR. The results of these analyses are presented as
a graph in Figure 9C. The same tissues analyzed by immunoblot
were subjected to quantitative real-time RT-PCR using a nucleic
acid staining technique (SYBR Green; Applied Biosystems,
Inc.) with the primer sets described earlier. Expression of
5A11/Basigin was detected within all tissues examined (Fig.
9C). The greatest expression was observed in the retina and
testes (eight times greater than that within retina; Fig. 9C). By
4094
Ochrietor et al.
FIGURE 9. Expression of 5A11/Basigin-2 in mouse tissues. The presence of 5A11/Basigin and 5A11/Basigin-2 in mouse retina (R), brain (B),
lung (Lu), liver (Li), kidney (K), heart (H), spleen (S), uterus (U), testes
(T), and skeletal muscle (SM), was investigated by immunoblot (A, B)
and real-time RT-PCR (C) analyses. (A) Proteins isolated from the
various mouse tissues were probed with the polyclonal antiserum
against 5A11/Basigin. The amount of protein in each lane varied, to
help show 5A11/Basigin expression within each tissue. The results
showed the mouse retina proteins to contain two 5A11/Basigin
polypeptides, whereas the other tissues examined had only one. (B) A
duplicate blot was probed with the affinity-purified antibody specific
for 5A11/Basigin-2. A signal is only observed in the retina protein
extracts. (C) Real-time RT-PCR analyses of the various mouse tissues
were performed. All runs were performed in triplicate and expression
was normalized to that of the mouse 18S ribosomal RNA. The value
obtained for 5A11/Basigin in the retina was set at one, and the expression in other tissues, as well as the values obtained for 5A11/Basigin-2,
were determined relative to that value. (䡺) 5A11/Basigin; ( ) 5A11/
Basigin-2.
contrast, 5A11/Basigin-2 expression was limited to the retina
(Fig. 9C).
DISCUSSION
5A11/Basigin is an important glycoprotein found within the
mouse retina. Mice without 5A11/Basigin are blind from the
time of eye opening, although the architecture appears normal
until the time of normal visual maturity, when photoreceptor
outer segments do not appear to have matured properly.1,3
Later, retinal degeneration destroys the entire photoreceptor
cell layer.2 The exact biological function of 5A11/Basigin is not
known; however, this laboratory proposes that it is critical for
proper development of the retina.
In an effort to understand the function of 5A11/Basigin, we
sought to determine the molecular diversity of this glycoprotein within the mouse retina. It has been shown by this laboratory that several forms of 5A11/Basigin are present within the
avian retina.5,18 The mouse retina also contains two 5A11/
Basigin polypeptides of ⬃45 and ⬃55 kDa, which are not
present in the 5A11/Basigin null mouse retina. cDNA cloning,
IOVS, September 2003, Vol. 44, No. 9
using a mouse retina library, allowed the sequencing of the
longer transcript. Characterization of the sequence of the 1.8
kb transcript indicates that it is a splice variant produced from
the mouse 5A11/Basigin gene. The resultant polypeptide is
Ig-like in structure and can therefore be included as a new
member of the IGSF. Structure prediction software suggests
that 5A11/Basigin-2 possesses three extracellular Ig-like loops,
a single hydrophobic transmembrane domain, and a short
cytoplasmic tail.
Immunocytochemical analyses have indicated that 5A11/
Basigin family members are expressed on the surface of MCs,
PCs (inner segments), and blood vessels of the mouse retina, as
well as on the RPE. The studies presented herein suggest that
5A11/Basigin (short form) is present on the surface of MCs,
blood vessels, and the RPE, whereas 5A11/Basigin-2 is predominantly found on the PCs and inner segments. No labeling of
the RPE was observed using the 5A11/Basigin-2–specific antibody. Similarly, no 5A11/Basigin-2 transcript was detected in
cDNA isolated from the RPE (data not shown). This is consistent with observations from the NEIBank human EST project,
in which the long form was found in ESTs generated from
neural retina, but not the RPE (http://neibank.nei.nih.gov/)
and suggests that 5A11/Basigin-2 expression is limited to the
neural retina. Because 5A11/Basigin-2 expression was not observed in any of the other mouse tissues examined, and no
full-length sequences of the amino terminal C2 Ig loop were
found within nonretina human EST data bases (data not
shown), it can be argued that 5A11/Basigin-2 has a very specialized, yet unknown, role within the neural retina.
Although previously detected as a rare transcript by immunoblot and Northern blot techniques, the real-time RT-PCR
analyses presented herein indicate that 5A11/Basigin-2 is actually more abundant than the short form at the age examined.
This present result is consistent with observations from the
NEIBank human retina EST project. It was determined that
5A11/Basigin is one of the more abundant cDNAs in a human
retina library, with 5A11/Basigin-2 as the predominant form.22
However, these results differ from those obtained by Northern
blot techniques (Fig. 1A). Unpublished observations in this
laboratory indicate that the ratio of short-form to long-form
transcripts is not constant during mouse retina development.
Because the RNA used for real-time RT-PCR studies was from a
single time point or age, rather than a pool of ages, we consider
this to be the more accurate assessment of 5A11/Basigin to
5A11/Basigin-2 expression in the mouse retina. Studies designed to increase understanding of the regulation of 5A11/
Basigin family member transcript expression are currently being pursued to resolve this issue.
Now that a second 5A11/Basigin transcript has been identified, it is necessary to reevaluate the mouse 5A11/Basigin
gene. Initially, this gene was characterized as containing seven
exons.14 However, the data presented herein show that the
gene actually possesses eight exons. We propose that this new
exon be named exon 1A to minimize inconsistencies in the
literature. Similar to the other exons present within the mouse
5A11/Basigin gene, exon 1A possesses conventional intron/
exon boundaries (the exon is flanked by bases AG at the 5⬘ end
and GT at the 3⬘ end). Splicing of exon 1A into the ubiquitously
expressed transcript appears to occur only in the retina. However, the molecular mechanism driving the usage of exon 1A
remains to be determined.
The concept of splice variation is not novel to the IGSF. The
synaptic membrane proteins neuroplastins gp55 and gp65,
which are also members of the IGSF, are splice variants from a
single gene, as well.21 Like 5A11/Basigin and 5A11/Basigin-2,
these two glycoproteins have different patterns of expression.
Neuroplastin gp55 is ubiquitously expressed, whereas gp65
expression is primarily limited to the brain and retina.32,33 In
IOVS, September 2003, Vol. 44, No. 9
situ hybridization using sections of rat retina indicates that
gp55 is expressed in the inner nuclear layer (amacrine cells,
bipolar cells, and horizontal cells) and the ganglion cell layer,
whereas gp65 is expressed in the outer nuclear layer, inner
nuclear layer, and ganglion cell layer.33 Immunostaining analyses indicated that neuroplastin gp65 is primarily localized to
the plexiform layers, where it is thought to mediate cell adhesion during retina synapse formation.33
A comparison of the amino acid sequences of the recently
cloned 5A11/Basigin-2 homologues with the rat neuroplastin
gp65 indicates high identity, especially within the amino-terminal Ig loops and the transmembrane domains of these
polypeptides. Typically, 5A11/Basigin homologues are only
40% to 50% identical in the extracellular domains19; however,
the 5A11/Basigin-2 homologues possess 79.5% sequence identity in the amino terminal Ig loop. In addition, when compared
with the amino-terminal Ig loop of neuroplastin gp65, there is
74.5% sequence identity. This suggests the potential for protein–protein interactions through these domains and a role in
neuronal cell adhesion within the retina. The transmembrane
domains of 5A11/Basigin homologues are highly identical
across species and possess a putative leucine zipper motif and
a glutamic acid residue within the hydrophobic domain.19
Neuroplastin gp65 shares this transmembrane motif, specific
to 5A11/Basigin family members (Fig. 5). It can therefore be
argued that these two glycoprotein families should be grouped
within the same subset of the IGSF.
5A11/Basigin is an important molecule in the retina and
other tissues. A biological role for 5A11/Basigin has yet to be
assigned; however, several recent publications have implicated
5A11/Basigin in HIV-1 infection,17 thymocyte development,16
and erythrocyte trapping in the spleen.34 It is clear that 5A11/
Basigin is a cell recognition molecule that interacts with other
cell surface molecules, presumably through the carbohydrate
moieties. 5A11/Basigin is glycosylated differentially, depending
on the tissue in which it is expressed.18,29,30 It has been
demonstrated that a single residue or sugar-associated group
can serve as a distinctive marker for lectin binding.35 It is,
therefore, reasonable to expect 5A11/Basigin to have numerous binding partners, depending on the tissue or cell type in
which it is expressed. However, the high amino acid sequence
identity of the amino-terminal Ig loop across the species from
which 5A11/Basigin-2 was cloned suggests that the polypeptide itself interacts with a binding partner, rather than through
associated carbohydrates.
At this time, the relationship between the two forms of
5A11/Basigin within the mouse retina is unknown. In a recent
paper from this laboratory, it was demonstrated that cell membrane expression of the lactose transporters MCT-1 and -4 is
dependent on 5A11/Basigin expression.36 MCT-1 is expressed
on the surface of MCs, PC bodies, and inner segments and on
the apical membrane of the RPE.36 The results of the localization of 5A11/Basigin family members presented herein suggest
that both forms of 5A11/Basigin interact with MCT-1. 5A11/
Basigin and MCT-1 interact on MCs and the RPE, whereas
5A11/Basigin-2 and MCT-1 interact on PCs. It has been shown
that 5A11/Basigin and MCT-1 interact in cis in the plasma
membrane.37,38 Perhaps the 5A11/Basigin-MCT-1 complex on
MCs interacts in trans with the 5A11/Basigin-2-MCT-1 complex
on PCs to establish the glial/neuronal lactose transport system
within the retina. As we hypothesized in the publication by
Philp et al.,36 failure of this complex to form could be responsible for the depressed ERGs observed in 5A11/Basigin-null
mice. It is reasonable to postulate, however, that 5A11/Basigin-2 interacts with other protein(s) within the developing
retina, and that such interactions are necessary for proper
neuronal development and maturation. Perhaps it is necessary
to generate another null mouse, in which the 5A11/Basigin-2
Molecular Diversity of 5A11/Basigin in the Retina
4095
transcript is specifically inactivated, to gain full understanding
of its role in the neural retina.
Acknowledgments
The authors thank Robert Greenberg, Andrea Kohn, and Jessica Roberts-Misterly for helpful suggestions and discussions pertaining to
cDNA cloning.
References
1. Ochrietor JD, Moroz TP, Clamp MF, Timmers AM, Muramatsu T,
Linser PJ. Inactivation of the basigin gene impairs normal retinal
development and maturation. Vision Res. 2002;42:447– 453.
2. Hori K, Katayanma N, Kachi S, et al. Retinal dysfunction in Basigin
deficiency. Invest Ophthalmol Vis Sci. 2000;41:3128 –3133.
3. Ochrietor JD, Moroz TM, Kadamatsu K, Muramatsu T, Linser PJ.
Retinal degeneration following failed photoreceptor maturation in
5A11/Basigin null mice. Exp Eye Res. 2001;72:467– 477.
4. Linser PJ, Andreae M, Perkins MS. Developmental analysis of an
antigen localized predominantly in the Muller glial cell plasma
membrane in the avian neural retina (Abstract). J Cell Biol. 1986;
103:477.
5. Fadool JM, Linser PJ. 5A11 antigen is a cell recognition molecule
which is involved in neuronal-glial interactions in avian neural
retina. Dev Dyn. 1993;196:252–262.
6. Seulberger H, Lottspeich F, Risau W. The inducible blood-brain
barrier specific molecule HT7 is a novel immunoglobulin-like cell
surface glycoprotein. EMBO J. 1990;9:2151–2158.
7. Biswas C, Zhang Y, DeCastro R, et al. The human tumor cellderived collagenase stimulatory factor (renamed EMMPRIN) is a
member of the immunoglobulin superfamily. Cancer Res. 1995;
55:434 – 439.
8. Kasinrerk W, Fiebiger E, Stefanova I, Baumruker T, Knapp W,
Stockinger H. Human leukocyte activation antigen M6, a member
of the Ig superfamily, is the species homologue of rat OX-47,
mouse basigin, and chicken HT7 molecule. J Immunol. 1992;149:
847– 854.
9. Fossum S, Mallett S, Barclay AN. The MRC OX-47 antigen is a
member of the immunoglobulin superfamily with an unusual transmembrane sequence. Eur J Immunol. 1991;21:671– 679.
10. Finnemann SC, Marmorstein AD, Neill JM, Rodriguez-Boulan E.
Identification of the retinal pigment epithelium protein RET-PE2 as
CE-9/OX-47, a member of the immunoglobulin superfamily. Invest
Ophthalmol Vis Sci. 1997;38:2366 –2374.
11. Neill JM, Barnstable CJ. Expression of the cell surface antigens
RET-PE2 and N-CAM by rat retinal pigment epithelial cells during
development and in tissue culture. Exp Eye Res. 1990;51:573–583.
12. Yoshimoto M, Sagara H, Masuda K, Hirosawa K. A novel member
of the Ig superfamily, RPE7, expressed on the retinal pigment
epithelial cell and Müller cell of the bovine retina. Exp Eye Res.
1998;67:331–340.
13. Miyauchi T, Kanekura T, Yamaoka A, Ozawa M, Miyazawa S,
Muramatsu T. Basigin, a new, broadly distributed member of the
immunoglobulin superfamily, has strong homology with both the
immunoglobulin V domain and the ␤-chain of major histocompatibility complex class II antigen. J Biochem. 1990;107:316 –323.
14. Miyauchi T, Jimma F, Igakura T, Yu S, Ozawa M, Maramatsu T.
Structure of the mouse basigin gene, a unique member of the
immunoglobulin superfamily. J Biochem. 1995;118:717–724.
15. Ding NZ, He CQ, Yang ZM. Quantification of basigin mRNA in
mouse oocytes and preimplantation embryos by competitive RTPCR. Zygote. 2002;10:239 –243.
16. Renno T, Wilson A, Dunkel C, et. al. A role for CD147 in thymic
development. J Immunol. 2002;168:4946 – 4950.
17. Pushkarsky T, Zybarth G, Dubrovsky L, et. al. CD147 facilitates
HIV-1 infection by interacting with virus-associated cyclophilin A.
Proc Natl Acad Sci USA. 2001;98:6360 – 6365.
18. Fadool JM, Linser PJ. Differential glycosylation of the 5A11/HT7
antigen by neural retina and epithelial tissues in the chicken.
J Neurochem. 1993;60:1354 –1364.
19. Miyauchi T, Masuzawa Y, Muramatsu T. The basigin group of the
immunoglobulin gene superfamily: complete conservation of a
4096
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
Ochrietor et al.
segment in and around the transmembrane domains of human and
mouse basigin and chicken HT7 antigen. J Biochem. 1991;110:
770 –774.
Altschul SF, Madden TL, Schaffer AA, et al. Gapped BLAST and
PSI-BLAST: a new generation of protein database search programs.
Nucl Acid Res. 1997;25:3389 –3402.
Langnaese K, Beesley PW, Gundelfinger ED. Synaptic membrane
glycoproteins gp65 and gp55 are new members of the immunoglobulin gene superfamily. J Biol Chem. 1997;272:821– 827.
Wistow G, Berstein SL, Wyatt MK, et. al. Expressed sequence tag
analysis of human retina for the NEIBank Project: retbindin, an
abundant, novel retinal cDNA and alternative splicing of other
retina-preferred gene transcripts. Mol Vis. 2002;8:196 –204.
Igakura T, Kadomatsu K, Kaname T, et al. A null mutation in
basigin, an immunoglobulin superfamily member, indicates its
important role in peri-implantation development and spermatogenesis. Dev Biol. 1998;194:152–165.
Fan QW, Yuasa S, Kuno N, et al. Expression of basigin, a member
of the immunoglobulin superfamily, in the mouse central nervous
system. Neurosci Res. 1998;30:53– 63.
Wistow G. A project for ocular bioinformatics: NEIBank. Mol Vis.
2002;8:161–163.
Wistow G, Berstein SL, Wyatt MK, et. al. Expressed sequence tag
analysis of adult human lens for the NEIBank Project: over 2000
non-redundant transcripts, novel genes and splice variants. Mol
Vis. 2002;8:171–184.
Bateman A, Birney E, Durbin R, Eddy SR, Finn RD, Sonnhammer
EL. Pfam 3.1: 1313 multiple alignments match the majority of
proteins. Nucl Acid Res. 1999;27:260 –262.
Fadool JM, Linser PJ. Evidence for the formation of multimeric
forms of the 5A11/HT7 antigen. Biochem Biophys Res Comm.
1996;229:280 –286.
Kanekura T, Miyauchi T, Tashiro M, Muramatsu T. Basigin, a new
member of the immunoglobulin superfamily: genes in different
mammalian species, glycosylation changes in the molecule from
IOVS, September 2003, Vol. 44, No. 9
30.
31.
32.
33.
34.
35.
36.
37.
38.
adult organs and possible variation in the N-terminal sequences.
Cell Struct Funct. 1991;16:23–30.
Fan Q-W, Kadmatsu K, Uchimura K, Muramatsu T. Embigin/basigin
subgroup of the immunoglobulin superfamily: different modes of
expression during mouse embryogenesis and correlated expression with carbohydrate antigenic markers. Dev Growth Diff. 1998;
40:277–286.
Hansen JE, Lund O, Tolstrup N, Gooley AA, Williams KL, Brunak S.
NetOglyc: Prediction of mucin type O-glycosylation sites based on
sequence context and surface accessibility. Glycoconjugate J.
1998;15:115–130.
Kreutz MR, Langnaese, K, Dieterich DC, et. al. Distribution of
transcript and protein isoforms of the synaptic glycoprotein neuroplastin in rat retina. Invest Ophthalmol Vis Sci. 2001;42:1907–
1914.
Langnaese K, Mummery R, Gundelfinger ED, Beesley PW. Immunoglobulin superfamily members gp65 and gp55: tissue distribution of glycoforms. FEBS Letts. 1998;429:284 –288.
Coste I, Gauchat J-F, Wilson A, et. al. Unavailability of CD147 leads
to selective erythrocyte trapping in the spleen. Blood. 2001;97:
3984 –3988.
Helenius A, Aebi M. Intracellular functions of N-linked glycans.
Science. 2001;291:2364 –2369.
Philp NJ, Ochrietor JD, Rudoy C, Muramatsu T, Linser PJ. Loss of
MCT1, MCT3, and MCT4 expression in the retinal pigmented
epithelium and neural retina of the 5A11/Basigin null mouse.
Invest Ophthalmol Vis Sci. 2003;44:1305–1311.
Kirk P, Wilson MC, Heddle C, Brown MH, Barclay AN, Halestrap
AP. CD147 is tightly associated with lactate transporters MCT1 and
MCT4 and facilitates their cell surface expression. EMBO J. 2000;
19:3896 –3904.
Wilson MC, Meredith D, Halestrap AP. Fluorescence resonance
energy transfer studies on the interaction between the lactate
transporter MCT1 and CD147 provide information on the topology
and stoichiometry of the complex in situ. J Biol Chem. 2002;277:
3666 –3672.