Download Cells Genes in Pro-B H Frequency of Individual V with the

This information is current as
of June 16, 2017.
The Extent of Histone Acetylation Correlates
with the Differential Rearrangement
Frequency of Individual VH Genes in Pro-B
Cells
Celia R. Espinoza and Ann J. Feeney
J Immunol 2005; 175:6668-6675; ;
doi: 10.4049/jimmunol.175.10.6668
http://www.jimmunol.org/content/175/10/6668
Subscription
Permissions
Email Alerts
This article cites 47 articles, 22 of which you can access for free at:
http://www.jimmunol.org/content/175/10/6668.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2005 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
References
The Journal of Immunology
The Extent of Histone Acetylation Correlates with the
Differential Rearrangement Frequency of Individual VH Genes
in Pro-B Cells1
Celia R. Espinoza and Ann J. Feeney2
T
he vast diversity of the immune repertoire is generated
during lymphocyte development by assembly of Ag receptor gene segments in a process termed V(D)J recombination. In B cell precursors, there is a precise order of rearrangement of the gene segments, with DH to JH rearrangement occurring
before VH to DJH rearrangement, and H chain rearranging before
L chain. In addition, there is lineage specificity in V(D)J recombination. Even though the same recombination-activating gene
(RAG) enzymes perform V(D)J recombination in both lineages,
only T cells rearrange TCR gene segments, and only B cells rearrange Ig segments (1).
According to the accessibility model, specific molecular mechanisms should exist in developing lymphocytes that make the appropriate TCR or Ig regions accessible to the common recombinase activity in a lineage- and stage-specific manner (2, 3).
Although it has been demonstrated that cis-acting elements within
the TCR and the Ig loci, including enhancers and promoters, play
crucial roles in recombination by helping to establish the locus and
gene segment-specific accessibility (4 – 6), the precise molecular
nature of the DNA or chromatin epigenetic modifications that are
responsible for the change in accessibility status of Ig genes is still
not fully understood. Chromatin exists in a highly compacted
structure in the eukaryotic nucleus, and it has long been accepted
that this structure functions as a barrier to gene expression. In
general, transcriptionally inactive genes are methylated, show low
levels of sensitivity to DNase I digestion, and are associated with
hypoacetylated histones (7, 8), and this is the status of Ig and TCR
genes in nonlymphoid cells.
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037
Received for publication May 5, 2005. Accepted for publication September 9, 2005.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
Several studies have demonstrated that demethylation of the H
and L chain genes occurs during B cell development, and is associated with onset of V(D)J recombination (9 –12). In addition,
DNase I analysis has shown that initiation of V(D)J recombination
at the Ig loci is preceded by an increase in nuclease sensitivity of
V and J segments (13). More recently, other studies have demonstrated that loci active in V(D)J recombination contain nucleosomes with acetylated histone proteins (14 –17), and enhancement
of histone acetylation levels in a pro-B cell line by treatment with
inhibitors of histone deacetylase increases ␬ recombination activity (18).
It has been shown by several groups, including our own, that VH
genes rearrange at different frequencies (19). Natural variation in
the composition of the recombination signal sequence (RSS)3 is
part of the reason for this differential rearrangement, but it does not
explain all of the nonrandom rearrangement (19). For example, our
laboratory has shown that the large VH7183 family is composed of
many genes that have identical RSS, yet they rearrange at different
frequencies in vivo (20). Thus, it is clear that factors others than
RSS efficiency must play an important role in controlling recombination frequency in vivo.
Because induction of histone acetylation has been associated
with induction of accessibility to rearrangement for V genes, we
postulated that the extent of histone acetylation may be higher for
the more frequently rearranging VH genes. We therefore examined
histone acetylation and methylation by chromatin immunoprecipitation (ChIP), using freshly isolated B220⫹ pro-B cells. We found
a positive correlation between the extent of the association with
acetylated histones and relative rearrangement frequency in the
VHS107 and VH7183 families. Thus, in the present work, we give
the first in vivo demonstration that the extent of acetylation of
histone proteins is one of the mechanisms by which V(D)J rearrangement frequency of individual VH genes may be regulated.
1
This work was supported by a grant from the National Institutes of Health (Grant AI
52313).
2
Address correspondence and reprint requests to Dr. Ann J. Feeney, Department of
Immunology, The Scripps Research Institute, La Jolla, CA 92037. E-mail address:
[email protected]
Copyright © 2005 by The American Association of Immunologists, Inc.
3
Abbreviations used in this paper: RSS, recombination signal sequence; ChIP, chromatin immunoprecipitation; BM, bone marrow; Ct, cycle threshold.
0022-1767/05/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
During B lymphocyte development, Ig heavy and L chain genes are assembled by V(D)J recombination. Individual V, D, and J
genes rearrange at very different frequencies in vivo, and the natural variation in recombination signal sequence does not account
for all of these differences. Because a permissive chromatin structure is necessary for the accessibility of VH genes for VH to DJH
recombination, we hypothesized that gene rearrangement frequency might be influenced by the extent of histone modifications.
Indeed, we found in freshly isolated pro-B cells from ␮MT mice a positive correlation between the level of enrichment of VHS107
genes in the acetylated histone fractions as assayed by chromatin immunoprecipitation, and their relative rearrangement frequency in vivo. In the VH7183 family, the very frequently rearranging VH81X gene showed the highest association with acetylated
histones, especially in the newborn. Together, our data show that the extent of histone modifications in pro-B cells should be
considered as a mechanism by which accessibility and the rearrangement level of individual VH genes is regulated. The Journal
of Immunology, 2005, 175: 6668 – 6675.
The Journal of Immunology
6669
Materials and Methods
Mice
The ␮MT mice (21) were initially obtained from The Jackson Laboratory,
and subsequently bred and maintained in specific pathogenic-free animal
facilities at The Scripps Research Institute (La Jolla, CA). Experiments
were approved and performed according to the regulatory standards of the
Institutional Animal Care and Use Committee.
Cell isolation and B220⫹ cell enrichment
Bone marrow (BM) cells were isolated from 6-wk-old ␮MT mice by flushing the femur and tibia with 10% fetal serum in PBS. Newborn liver cells
were obtained from ⬍16-h-old ␮MT mice. For the majority of experiments, B220⫹ cells were purified using anti-mouse CD45R Ab-coated
magnetic microbeads (Miltenyi Biotec). Then, the B220⫹ fraction was
stained with PE-conjugated anti-B220 Ab (eBioscience). In other experiments, B220⫹ cells were pre-enriched by first staining BM or liver cells
with PE-conjugated B220 Ab, followed by purification using anti-PE microbeads (Miltenyi Biotec). In both cases, viable pro-B cells (B220⫹) were
sorted by flow cytometry. Thymocytes were obtained from 4- to 6-wk-old
␮MT mice. NIH 3T3 fibroblasts were maintained in DMEM (Invitrogen
Life Technologies) supplemented with 10% FBS.
B220⫹ cells from adult BM and newborn liver ␮MT mice were isolated as
described above, and genomic DNA was prepared using QIAamp DNA
Mini Kit (Qiagen). Primers used to determine the rearrangement frequency
of individual VHS107 and VH7183 genes have been described previously
(20, 22). PCR products were ligated into the T/A cloning vector pCR
2.1-TOPO (Invitrogen Life Technologies), and positive clones were sequenced using the ABI PRISM 3100 DNA analyzer (Applied Biosystems).
In vivo ChIP
ChIPs were performed according to Upstate Biotechnology’s protocol,
with minor modifications. Approximately 4 ⫻ 106 cells were crosslinked
by adding formaldehyde to a final concentration of 1% to the medium for
15 min at room temperature. The reaction was stopped by adding 0.125 M
glycine and incubation for 5 min at room temperature. Subsequent steps
Real-time PCR analysis
Real-time PCR was performed using the Quantitec SYBR PCR Kit (Qiagen) and the ABI Prism 7700 Sequence Detection System (Applied Biosystems). The input DNA and the immunoprecipitated (bound) DNA were
first quantified using PicoGreen dye (Invitrogen Life Technologies). The
input DNA was diluted in 1⫻ TE to match the concentration of bound
DNA. The real-time PCR was conducted using 0.2 ng of DNA at 95°C for
15 min, followed by 45 cycles at 94°C for 15 s, 60°C for 30 s, and 72°C
for 30 s. Data were collected at 72°C. A melting curve analysis step was
built at the end of the cycling program to verify quality of the PCR products. The sequences of the primers used and their location are described in
Table I. Primer sets used in ChIP assays
Primer Sequence
VHS107 family
V1
V11
V13
V1 regions
5⬘-Promoter
3⬘-Flanking
Intergenic
VH7183 family
V81X
7183 (⫺81X)
VHJ558 family
J558
Controls
Actin
␤2-microglobulinb
Neuregulin
a
b
Position (bp)a
AGACTGGAGTGGATTGCTGCAAG
ATGACGTCCTCTCACTGTGTGC
AGGCACTTGAGTGGTTGGGTTTT
TTGTGTCTAGGCTCACACTGAAGTA
CAGCCTCCAGGGAAGTCACC
TTGTGTCTAGGCTCACACTGAAGTA
⫹130
⫹304
⫹128
⫹316
⫹115
⫹318
TCCTACATGAGTACACCCTCCCC
GGATTGAAGTTGTAGAGAGTGAAG
CTTGTACAATGTGAGTCATTGTTG
GATAGAAGCCCTTACACATGTGGTGACA
TTCTGAGGAACTGCCAGACTGATTTCCAG
AACAATGCTCAGCATCCTTATTCATCAGAG
⫺640 to ⫺618
⫺385 to ⫺362
⫹849 to ⫹872
⫹1144 to ⫹1171
⫹2743 to ⫹2771
⫹2923 to ⫹2952
AATCCAATGAATACGAATTCCCTTC
CTCCGCGCCCCCTGCTGGTCCT
TGTGCAGCCTCTGGATTCACT
CTCCGCGCCCCCTGCTGGTCCT
⫹68 to ⫹92
⫹351 to ⫹372
⫹64 to ⫹84
⫹351 to ⫹372
GTGAAGATGTCCTGCAAGGCTTCT
GGATTTGTCTGCAGTCAGTGTGGCCTTG
⫹52 to ⫹75
⫹198 to ⫹225
AGGCATGGAGTCCTGTGGTATC
AGCCACAGGTCCTAAGGCCAG
GCGGTCCCAGGCTGAACGACCAG
CCAGTCTCCTAGCTGTTAATGCTGAACT
CTCTGCATGGTAATGCACTGTGAG
AGAGGCAGAGGCTTACTAGACAAG
⫹527 to ⫹548
⫹736 to ⫹756
⫺305 to ⫺283
⫺158 to ⫺131
⫺53 to ⫺30
⫹248 to ⫹271
Numbering relative to the start of the coding region (⫹1).
Primers for ␤2-microglobulin were taken from Chowdhury and Sen (16).
to
to
to
to
to
to
⫹152
⫹325
⫹150
⫹339
⫹134
⫹341
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
PCR, cloning, and sequencing
were performed at 4°C. Fixed cells were harvested by centrifugation (1,000
rpm for 10 min), washed twice in cold PBS buffer containing 1 mM PMSF
and 0.1% protease inhibitor mixture for mammalian extracts (Sigma-Aldrich), and resuspended in cell lysis buffer containing 1 mM PMSF and
0.1% protease inhibitor mixture. After 10-min incubation on ice, lysed cells
were centrifuged at 3,000 rpm for 10 min to pellet the nuclei. The nuclear
pellet was resuspended in SDS lysis buffer containing 1 mM PMSF and
0.1% protease inhibitor mixture and incubated 10 min on ice. The nuclear
suspension was sonicated, and debris was removed by centrifugation
(14,000 rpm, 10 min). The chromatin solution was diluted 10-fold in ChIP
dilution buffer containing 1 mM PMSF and 0.1% protease inhibitor mixture, and precleared with salmon sperm DNA-protein A agarose beads
(Upstate Biotechnology) for 1 h at 4°C. After centrifugation, 500 ␮l of the
supernatant was saved to be used as input DNA, and the rest of the supernatant was incubated overnight at 4°C with 5 ␮g Ab/106 cells. Upstate
Biotechnology’s Abs used included anti-acetylated H3 at lysines K9 and
K14 (catalog no. 06-599), anti-acetylated H4 at lysines K5, K8, K12, and
K16 (catalog no. 06-866), and anti-dimethylated H3 at lysine 4 (catalog no.
07-030).
Immune complexes were collected with salmon sperm DNA-protein A
agarose beads for 1 h at 4°C. Following washes and elution, Ab-bound
DNA (i.e., DNA associated with the specific histone modification under
study) and input DNA (DNA not incubated with any Ab) were reverse
crosslinked by heating at 65°C overnight. DNA was recovered after proteinase K treatment, 2 phenol/chloroform/isoamylalcohol and one chloroform extractions, and isopropanol precipitation. Finally, DNA was dissolved in 1⫻ Tris/EDTA buffer and stored at 4°C until use.
6670
HISTONE ACETYLATION AND VH REARRANGEMENT FREQUENCY
Table I. The specificity of each PCR was first confirmed by sequencing the
amplified product.
Enrichment of active genes in our ChIP preparations was assessed by
real-time PCR using primers for active genes (actin and ␤2-microglobulin),
and for an inactive gene (neuregulin).
Data is presented as relative to actin values for each amplified DNA
sequence, which was determined as follows: 2ˆ [(Ct input sample ⫺ Ct bound
sample) ⫺ (Ct input actin ⫺ Ct bound actin)], where Ct is the cycle threshold.
Data analysis
Real-time PCRs were performed two to three times per ChIP preparation.
All data used in figures are expressed as the mean values of three to six
independent ChIP preparations ⫾ SEM. The Mann-Whitney U test was
used for statistical evaluation of the results.
Results
The VHS107 genes rearrange at different frequencies
Modification of histones associated with the VHS107 genes
Next, we wanted to test our hypothesis that the extent of histone
modifications may correlate with rearrangement frequency in vivo.
ChIP assays using Abs to acetylated histone H3, acetylated histone
H4, or histone H3 dimethylated at lysine 4 (H3/K4) were performed on freshly isolated B220⫹ pro-B cells from adult BM and
newborn liver from ␮MT mice. Primers unique for individual
FIGURE 1. In vivo relative rearrangement frequency of the three
VHS107 genes. PCRs with family-specific primers were done on DNA from
newborn liver and adult BM B220⫹ pro-B cells from ␮MT mice, and the
PCR products were cloned and sequenced. Results are expressed as the
percentage of the total number of the VHS107 family rearrangements.
FIGURE 2. Analysis of histone acetylation and methylation in the
VHS107 family. ChIP assays were performed on adult BM pro-B cells from
␮MT mice using Abs to acetylated H3 (A), acetylated H4 (B), or histone
H3 dimethylated at lysine 4 (H3/K4) (C). ChIP assays were also performed
on newborn liver pro-B cells from ␮MT mice using Abs to either acetylated H3 (D) or acetylated H4 (E). Analysis was performed by real-time
PCR. Data is expressed relative to the positive control actin gene (actin ⫽ 1). Results represent the mean ⫾ SEM of 3–5 independent ChIP
preparations.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
The ␮MT mice (21) have a targeted disruption of a membrane
exon of the gene encoding the IgM constant region, resulting in a
complete block of B cell development at the pro-B cell step. Therefore, this strain of mice is an ideal model to analyze the initial
rearrangement frequency of VH genes.
The VHS107 family has three functional members, V1, V11, and
V13. We previously described that in newborn liver B220⫹ pro-B
cells from ␮MT mice, V1 rearranges five times more often than
V11, and V11 rearranges 7.7-fold more often than V13 (22). In this
study, we performed a similar analysis in adult BM B220⫹ pro-B
cells from ␮MT mice to determine whether the rearrangement frequency of individual members changes from newborn to adult
B220⫹ cells. We isolated newborn liver and adult BM B220⫹
pro-B cells from ␮MT mice and amplified the VHS107 genes as
described previously (22). The sequencing of additional 15 clones
from newborn B220⫹ pro-B cells did not change the differential
rearrangement frequency previously observed within the members
of the VH S107 family (Fig. 1). In addition, sequencing of 45
clones from adult BM B220⫹ pro-B cells showed approximately
the same rearrangement frequency pattern as observed in newborn
liver pro-B cells (V1⬎V11⬎V13) (Fig. 1). Thus, this unequal rearrangement pattern is stable throughout ontogeny.
members of the VHS107 family were used in real-time PCR. The
forward primers were located in the coding region, and the reverse
primers were situated 3⬘ of their RSS. Thus, only unrearranged
genes were assayed.
In adult BM B220⫹ pro-B cells, we found a positive correlation
between the rearrangement frequency of the VHS107 family members, and their level of enrichment in the DNA immunoprecipitated
with Abs against acetylated histones H3 and H4, and dimethylated
H3/K4 (Fig. 2, A–C). V1 has 3- and 2.4-fold higher levels of histone H3 and H4 acetylation, respectively, compared with V11
( p ⬍ 0.10 and p ⬍ 0.05, respectively; Fig. 2, A and B). Furthermore, V11 has 2.5- and 2.9-fold higher levels of histone H3 and H4
acetylation, respectively, compared with V13 ( p ⬍ 0.05 and p ⬍
0.02, respectively). For dimethylated H3/K4, V1 was 6.2-fold more
enriched in the immunoprecipitated fraction than V11, and V11
was 2.7-fold more enriched than V13 ( p ⬍ 0.10; Fig. 2C). In
newborn B220⫹ cells, the rearrangement frequency also correlated
with association with acetylated histone H3 (Fig. 2D). V1 has 1.8and 2.2-fold higher levels of histone H3 acetylation associated
with its RSS region than that of V11 and V13, respectively. Although we could not find a significant difference between V1 and
V11 in our anti-acetylated H4-ChIP preparations (Fig. 2E), V11
was ⬃2-fold more enriched in the immunoprecipitated fraction
than V13 ( p ⬍ 0.10).
We conclude that in adult pro-B cells, there is a correlation
between the extent of histone H3 and H4 acetylation and H3/K4
dimethylation, and relative rearrangement frequency for the three
VH genes in the VHS107 family, and this is also the case for acetylated H3 in newborn pro-B cells.
The Journal of Immunology
Histone modification is localized to the rearranging VH gene
We wanted to assess whether histone proteins H3 and H4 associated with V1-flanking regions were acetylated or dimethylated to
the same degree as the histones surrounding the RSS and coding
regions. For this analysis, three different regions (5⬘-promoter,
142– 421 bp upstream of leader; 3⬘-flanking region, 504 – 822 bp
downstream of the RSS; and intergenic region, 2.4 –2.6 kb downstream of the RSS) flanking the V1 gene were analyzed in adult
BM B220⫹ pro-B cells. Histone H3 and H4 acetylation, as well as
H3/K4 dimethylation reached their highest value around the coding region and RSS, decreasing dramatically within 1 kb 5⬘ and
550 bp 3⬘ of the RSS (Fig. 3, A–C). This data shows that the extent
of histone modifications associated with accessible chromatin is
localized to the rearranging gene.
Higher rearrangement of VH81X gene in newborn than in adult
B220⫹ cells
FIGURE 3. Acetylation and methylation patterns of histones H3 and H4
associated with flanking regions of the V1 gene in pro-B cells from adult
␮MT mice. ChIP assays were performed using Abs to acetylated H3 (A),
acetylated H4 (B), or dimethylated H3/K4 (C). Real-time PCR was performed using primers designed to amplify four different V1 regions (5⬘promoter, coding and RSS, 3⬘-flanking and intergenic). Data is expressed
relative to the positive control actin gene (actin ⫽ 1). Results represent the
mean ⫾ SEM of five independent ChIP preparations.
shown). Although these data indicated that VH81X rearranges more
often than any other VH7183 gene in both newborn and adult
B220⫹ cells, the relative rearrangement frequency of the VH81X
gene was much higher in neonatal than in adult B220⫹ pro-B cells.
Higher association of acetylated histones with VH81X
To test our hypothesis that the level of enrichment of acetylated
histones surrounding VH81X will be higher than that of the rest of
the VH7183 family members, ChIP assays were performed and
analyzed by real-time PCR using primers that specifically amplified the VH81X gene and primers that amplified the rest of the
VH7183 family members, excluding the VH81X gene. The forward
primers were located in the coding region, and the common reverse
primer was located 37 bp downstream of the nonamer.
In adult pro-B cells from ␮MT mice, VH81X has 2.4- and 2-fold
higher level of histone H3 and H4 acetylation, respectively, compared with the rest of family members ( p ⬍ 0.02 and p ⬍ 0.05,
respectively; Fig. 4, A and B). Interestingly, in newborn pro-B cells
from ␮MT mice, there was even more preferential association of
the VH81X gene with acetylated histone H3, 4.2-fold higher than
that of the rest of family members ( p ⬍ 0.10; Fig. 4C). However,
we could not detect a significant difference between VH81X and the
rest of VH7183 family members in the acetylated H4-immunoprecipitated fraction in newborn liver pro-B cells (Fig. 4D). Thus,
VH81X has a higher level of histone H3 acetylation associated with
its RSS region than that of the rest of the VH7183 genes, and this
differential association is much greater in the newborn, correlating
with its very high rearrangement frequency.
Acetylation and methylation status of histones associated with
the VHJ558 family
The large VHJ558 family, which is the most distal family in the VH
locus, was included in our global analysis of the histone acetylation and methylation status in adult and newborn B220⫹ pro-B
cells. VHJ558 genes undergo rearrangement much less frequently
FIGURE 4. Analysis of histone acetylation in the VH7183 family. ChIP
assays were performed on adult BM pro-B cells from ␮MT mice using Abs
to either acetylated H3 (A), or acetylated H4 (B). ChIP assays were also
performed on newborn liver pro-B cells from ␮MT mice using Abs to
either acetylated H3 (C) or acetylated H4 (D). Analysis was performed by
real-time PCR. Data is expressed relative to the positive control actin gene
(actin ⫽ 1). Results represent the mean ⫾ SEM of 4 – 6 independent ChIP
preparations.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
It has been well documented that VH81X, a member of VH7183
family, is the most frequently rearranging VH segment in fetal life
(23–26). We have previously shown that in newborn B220⫹ pro
B-cells from ␮MT mice, VH81X clearly dominates the VH7183
repertoire, comprising 59% of the rearrangements (20). In this
study, we performed a similar analysis in B220⫹ adult BM cells to
determine the rearrangement frequency of VH81X with respect to
the rest of VH7183 family members.
Rearranged VH7183 genes from adult BM B220⫹ pro B-cells
from ␮MT mice were amplified, cloned, and sequenced. Of 31
clones derived from adult BM B220⫹ pro-B cells, VH81X accounted for 35% of the rearrangements in the VH7183 family (data
not shown). The remainder of the VH7183 genes showed similar
relative rearrangement frequency as in the newborn (data not
6671
6672
HISTONE ACETYLATION AND VH REARRANGEMENT FREQUENCY
in fetal and neonatal pro-B cells than in adults (27). Because the
status of histone proteins associated with the VHJ558 family has
not been analyzed in freshly isolated neonatal pro-B cells, we examined this VH family by ChIP assay using newborn liver and also
adult BM pro-B cells from ␮MT mice. For our real-time-PCR
analysis, we designed a pair of primers that would amplify most of
the VHJ558 family members, with primers located in FR1
and FR3.
The distal VHJ558 family showed higher association with acetylated histone H3 in adult than in newborn pro-B cells ( p ⬍ 0.10;
Fig. 5A), which correlates with the high rearrangement frequency
of VHJ558 genes in adult pro-B cells. However, when comparing
the extent of H3 and H4 acetylation surrounding different VH
genes in newborn liver pro-B cells, the VHJ558 family was more
associated with acetylated H3 than any of the proximal VH genes
other than VH81X, which showed the highest association with
acetylated histone H3 (Fig. 5A). Furthermore, there was a higher
association of acetylated H4 with distal than with proximal VH
genes in both adult BM and newborn liver pro-B cells (Fig. 5B). In
addition, in adult pro-B cells, the VHJ558 family had a much
higher association with dimethylated H3/K4 than the other VH
genes analyzed (Fig. 5C).
We conclude that the extent of histone H3 acetylation among
VH genes is more comparable in newborn than in adult pro-B cells.
Unlike in the newborn, in the adult the most notable difference is
the very high level of H3 acetylation and H3/K4 dimethylation of
the distal VHJ558 family, and, to a much lesser extent, V1. Thus,
in general, the extent of histone modifications correlates with the
relative rearrangement frequency in vivo.
Increased level of histone acetylation is specific for pro-B cells
Discussion
To elucidate the epigenetic mechanisms regulating accessibility of
individual VH genes to V(D)J recombination, we investigated the
modification status of histone proteins associated with specific VH
genes in pro-B cells. We had already shown that the three functional members of the VHS107 family have very different rearrangement frequencies in vivo, with V1 rearranging five times
FIGURE 5. Analysis of the acetylation and methylation patterns of histones H3 and H4 associated with many VH genes. ChIP assays were performed on newborn liver and adult BM pro-B cells from ␮MT mice using
Abs to acetylated H3 (A) or acetylated H4 (B). C, Dimethylated H3/K4
ChIP assays were performed on adult BM pro-B cells from ␮MT. Analysis
was performed by real-time PCR. Data is expressed relative to the positive
control actin gene (actin ⫽ 1). Results represent the mean ⫾ SEM of 3– 6
independent ChIP preparations. Data on VHS107 and VH7183 genes are
from Figs. 2 and 4. Genes are displayed in their 5⬘ to 3⬘ orientation into the
IgH locus.
FIGURE 6. Analysis of histone H3 acetylation associated with many
VH genes in three cell types. ChIP assays were performed on adult BM
pro-B cells, total thymocytes, and 3T3 fibroblast. VHS107 (A) and VH7183
(B) family members were assayed for their enrichment in the antiacetylated H3-immunoprecipitated fraction. Analysis was performed by
real-time PCR. Data is expressed relative to the positive control actin gene
(actin ⫽ 1). Results represent the mean ⫾ SEM of 2– 6 independent ChIP
preparations.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
To demonstrate the lineage specificity of the acetylation of histones associated with VH genes, we performed ChIP on freshly
isolated ␮MT thymocytes and on cultured NIH 3T3 fibroblasts.
We found that 3T3 cells displayed little acetylation of histones
associated with any of the VH genes analyzed (Fig. 6, A and B).
Furthermore, although thymocytes showed a slightly increased
level of H3 acetylation as compared with NIH 3T3 cells, they were
still hypoacetylated compared with pro-B cells. Thus, induction of
hyperacetylation is specific to the B lineage. In addition, this
comparative study demonstrated that it is only in pro-B cells
where the level of association of individual VH members with
acetylated histones correlates with their rearrangement frequency (Fig. 6, A and B).
The Journal of Immunology
on any of the VH7183 family members. Our data therefore indicates that the extent of histone acetylation could be a factor in
promoting accessibility of VH81X for rearrangement.
In our global analysis of the modification status of histone proteins associated with other VH genes, we found that in adult pro-B
cells, the acetylation of H3 and H4 is much higher in the distal
VHJ558 genes than in any of the proximal VH genes tested. It has
been previously described that the DH-proximal and DH-distal VH
gene segments reside in distinct regulatory environments (30 –35).
Our data showing high levels of H3 acetylation associated with the
distal VHJ558 family in adult pro-B cells agree with two previous
reports in which adult BM cells from RAG-deficient mice were
used (16, 17). However, both groups cultured BM cells with IL-7,
a cytokine which up-regulates acetylation of histones associated
with the VHJ558 family, but has no effect on proximal VH genes.
Furthermore, in RAG-deficient mice, no VH genes were associated
with acetylated histones in the absence of IL-7 (16). Thus, direct
analysis of freshly isolated pro-B cells from mice, which express
functional RAG proteins as we did in this study, is preferable to
determine the in vivo acetylation status of histone proteins surrounding VH genes. Chowdhury and Sen (16) also analyzed adult
pro-B cells isolated from BALB/c mice and showed lower relative
levels of histone acetylation associated with VHJ558 genes than we
did in this study. The difference may be due to the fact that we used
␮MT mice, in which B cell development is blocked at the pro-B cell
stage, possibly resulting in increased distal VH gene rearrangement.
We report in this study the first analysis of the histone acetylation status in freshly isolated newborn pro-B cells. In agreement
with the lower use of the distal VHJ558 genes early in ontogeny,
we found much lower association of acetylated H3 and H4 with
VHJ558 genes in newborn as compared with adult pro-B cells. The
only other study performed on neonatal cells was done with
RAG⫺/⫺ fetal liver pro-B cells after culture with IL-7, but the
status of VH genes in the absence of IL-7 culture was not determined (17).
Using a novel system in which V(D)J recombination was induced in the nonlymphoid cell line BOSC after transient transfection with E2A or EBF, we have previously shown that Ig loci are
not opened globally but recombination is localized to individual
genes, with neighboring genes remaining inaccessible (36). We
hypothesized that this was due to localized induction of histone
post-translational modifications. Thus, we wanted to investigate
whether the high association of modified histone proteins with the
V1 gene was extended over flanking DNA or localized to the gene
itself. We found a much higher association of acetylated histones
and dimethylated H3/K4 surrounding the coding region and RSS
of the V1 gene than the 5⬘- or 3⬘-flanking DNA or intergenic regions. This result agrees with a previous observation in which
histone H4 acetylation was higher in VH gene segments and usually did not extend into intergenic regions (17). Thus, this observation gives a molecular basis for our previously observed localized induction of recombination.
Some studies (31, 37–39) have shown that acetylation of histones is not sufficient for induction of accessibility leading to rearrangement, suggesting that other epigenetic modifications could
also be important for fully inducing accessibility resulting in
V(D)J recombination. For example, H4 phosphorylation at serine
1 has been shown to be associated with the VH81X gene in pro-B
cell lines (40), and thus this modification may also contribute to the
high rearrangement frequency of VH81X. In addition to the welldocumented role of DNA methylation and histone modifications in
promoting V(D)J recombination, antisense intergenic transcription, as well as nucleosome positioning at RSS have been proposed
as additional mechanisms (41– 44). Furthermore, new reports have
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
more than V11, and V13 rearranging 40 times less frequently than
V1 (22). Although their RSS share the same heptamer and nonamer
(28), we have previously determined that the difference in recombination frequency between V1 and V11 could partially be due to
differences in the spacer sequence (29). However, other factors in
addition to RSS efficiency must affect rearrangement frequency
because the closely related V11 and V13 genes rearrange at very
different frequencies, and their RSS are identical, including the
spacer (22, 29). In addition, we previously showed that the promoters of V11 and V13 are similar in strength, as measured by
luciferase assays in the presence and absence of the intronic H
chain enhancer (22). Furthermore, we showed that the steady-state
level of germline transcripts was infrequent for all three VHS107
genes in vivo, precluding precise quantitation of the relative frequency of transcripts from the individual genes (22).
Another VH gene family in which RSS differences do not account for rearrangement frequency is the large VH7183 gene family. Although sequencing of the RSS of all 20 VH7183 family
members indicated that several have identical RSS (20), genes
with identical RSS rearranged at very different frequencies in vivo.
The VH7183 gene family contains VH81X, a gene that rearranges at
an extraordinarily high frequency, especially in fetal life. VH81X is
the most 3⬘ functional VH gene, and shares the same consensus
heptamer with other family members, although it has a unique
spacer sequence. However, we previously demonstrated that the
very high rearrangement frequency of VH81X is not due to its RSS
(20). Therefore, it is clear that factors other than RSS efficiency
must play a role in controlling VH gene recombination frequencies.
Increasing evidence that acetylation of histone proteins H3 and
H4 and dimethylation of histone H3 at lysine 4 are associated with
active chromatin led us to hypothesize that genes that rearrange
more frequently within a VH family may be more enriched in
histones that have active posttranslational modifications. Consistent with this idea, we show in freshly isolated pro-B cells a positive correlation between rearrangement frequency among the
VHS107 and VH7183 family members and their level of enrichment
in acetylated histone fractions. For the VHS107 family, we found
that in adult BM pro-B cells the extent of association with acetylated histones H3 and H4, as well as dimethylated H3/K4, was
higher with the highly rearranging V1 gene than with V11 gene.
This result indicates that in addition to the contribution of the RSS
spacer sequence in the higher rearrangement frequency of V1 over
V11, association with acetylated H3 and H4, as well as dimethylated H3/K4, may also play a role in the unequal rearrangement
frequency of these two VHS107 genes. Our data also suggest that
the difference in recombination frequency between V11 and V13 in
adult pro-B cells could be influenced by a preferential association
of V11 with acetylated H3 and H4, and dimethylated H3/K4 histones. Our data in this study uncover the first difference between
V11 and V13 genes in adult pro-B cells.
In the newborn, however, the extent of histone H3 and H4 acetylation was not significantly different between V1 and V11, and the
high rearrangement frequency of V11 over V13 correlated only
with the association of V11 with acetylated histone H4. Thus, additional factors may be responsible for the differential rearrangement frequency within VHS107 family members in newborn pro-B
cells.
In the present work, we also showed that the high rearrangement
frequency of VH81X with respect to the rest of VH7183 family
members could be influenced by its very high association with
acetylated histone H3. That association was even more pronounced
in newborn than in adult pro-B cells, which concurs with the extremely high rearrangement frequency of VH81X early in ontogeny. However, we did not observe much dimethylation of H3/K4
6673
6674
HISTONE ACETYLATION AND VH REARRANGEMENT FREQUENCY
12.
13.
14.
15.
16.
17.
18.
19.
20.
21.
22.
23.
24.
25.
Acknowledgments
We thank L. Watson, N. Morris, and P. Lao for technical assistance, and
K. Mowen, D. Nemazee, and J. Kaye for critical reading of the manuscript.
26.
27.
Disclosures
The authors have no financial conflict of interest.
References
1. Bassing, C. H., W. Swat, and F. W. Alt. 2002. The mechanism and regulation of
chromosomal V(D)J recombination. Cell 109: S45–S55.
2. Yancopoulos, G. D., and F. W. Alt. 1985. Developmentally controlled and tissuespecific expression of unrearranged VH gene segments. Cell 40: 271–281.
3. Stanhope-Baker, P., K. M. Hudson, A. L. Shaffer, A. Constantinescu, and
M. S. Schlissel. 1996. Cell type-specific chromatin structure determines the targeting of V(D)J recombinase activity in vitro. Cell 85: 887– 897.
4. Hempel, W. M., I. Leduc, N. Mathieu, R. K. Tripathi, and P. Ferrier. 1998.
Accessibility control of V(D)J recombination: lessons from gene targeting. Adv.
Immunol. 69: 309 –352.
5. Sleckman, B. P., J. R. Gorman, and F. W. Alt. 1996. Accessibility control of
antigen-receptor variable-region gene assembly: role of cis-acting elements.
Annu. Rev. Immunol. 14: 459 – 481.
6. Schlissel, M. S., and P. Stanhope-Baker. 1997. Accessibility and the developmental regulation of V(D)J recombination. Semin. Immunol. 9: 161–170.
7. Travers, A. 1999. Chromatin modification by DNA tracking. Proc. Natl. Acad.
Sci. USA 96: 13634 –13637.
8. Jaenisch, R., and A. Bird. 2003. Epigenetic regulation of gene expression: how
the genome integrates intrinsic and environmental signals. Nat. Genet. 33:
245–254.
9. Mather, E. L., and R. P. Perry. 1983. Methylation status and DNase I sensitivity
of immunoglobulin genes: changes associated with rearrangement. Proc. Natl.
Acad. Sci. USA 80: 4689 – 4693.
10. Storb, U., and B. Arp. 1983. Methylation patterns of immunoglobulin genes in
lymphoid cells: correlation of expression and differentiation with undermethylation. Proc. Natl. Acad. Sci. USA 80: 6642– 6646.
11. Goodhardt, M., P. Cavelier, N. Doyen, S. Kallenbach, C. Babinet, and
28.
29.
30.
31.
32.
33.
34.
35.
36.
37.
F. Rougeon. 1993. Methylation status of immunoglobulin ␬ gene segments correlates with their recombination potential. Eur. J. Immunol. 23: 1789 –1795.
Mostoslavsky, R., N. Singh, A. Kirillov, R. Pelanda, H. Cedar, A. Chess, and
Y. Bergman. 1998. ␬ chain monoallelic demethylation and the establishment of
allelic exclusion. Genes Dev. 12: 1801–1811.
Maës, J., L. P. O’Neill, P. Cavelier, B. M. Turner, F. Rougeon, and
M. Goodhardt. 2001. Chromatin remodeling at the Ig loci prior to V(D)J recombination. J. Immunol. 167: 866 – 874.
McBlane, F., and J. Boyes. 2000. Stimulation of V(D)J recombination by histone
acetylation. Curr. Biol. 10: 483– 486.
McMurry, M. T., and M. S. Krangel. 2000. A role for histone acetylation in the
developmental regulation of VDJ recombination. Science 287: 495– 498.
Chowdhury, D., and R. Sen. 2001. Stepwise activation of the immunoglobulin ␮
heavy chain gene locus. EMBO J. 20: 6394 – 6403.
Johnson, K., C. Angelin-Duclos, S. Park, and K. L. Calame. 2003. Changes in
histone acetylation are associated with differences in accessibility of VH gene
segments to V-DJ recombination during B-cell ontogeny and development. Mol.
Cell. Biol. 23: 2438 –2450.
Krangel, M. S. 2003. Gene segment selection in V(D)J recombination: accessibility and beyond. Nat. Immunol. 4: 624 – 630.
Feeney, A. J., P. Goebel, and C. R. Espinoza. 2004. Many levels of control of V
gene rearrangement frequency. Immunol. Rev. 200: 44 –56.
Williams, G. S., A. Martinez, A. Montalbano, A. Tang, A. Mauhar,
K. M. Ogwaro, D. Merz, C. Chevillard, R. Riblet, and A. J. Feeney. 2001. Unequal VH gene rearrangement frequency within the large VH7183 gene family is
not due to recombination signal sequence variation, and mapping of the genes
shows a bias of rearrangement based on chromosomal location. J. Immunol. 167:
257–263.
Kitamura, D., J. Roes, R. Kuhn, and K. Rajewsky. 1991. A B cell-deficient mouse
by targeted disruption of the membrane exon of the immunoglobulin ␮ chain
gene. Nature 350: 423– 426.
Love, V. A., G. Lugo, D. Merz, and A. J. Feeney. 2000. Individual VH promoters
vary in strength, but the frequency of rearrangement of those VH genes does not
correlate with promoter strength nor enhancer-independence. Mol. Immunol. 37:
29 –39.
Malynn, B. A., G. D. Yancopoulos, J. E. Barth, C. A. Bona, and F. W. Alt. 1990.
Biased expression of JH-proximal VH genes occurs in the newly generated repertoire of neonatal and adult mice. J. Exp. Med. 171: 843– 859.
Perlmutter, R. M., J. F. Kearney, S. P. Chang, and L. E. Hood. 1985. Developmentally controlled expression of immunoglobulin VH genes. Science 227:
1597–1601.
Yancopoulos, G. D., S. V. Desiderio, M. Paskind, J. F. Kearney, D. Baltimore,
and F. W. Alt. 1984. Preferential utilization of the most JH-proximal VH gene
segments in pre-B-cell lines. Nature 311: 727–733.
Marshall, A. J., G. E. Wu, and G. J. Paige. 1996. Frequency of VH81X usage
during B cell development: initial decline in usage is independent of Ig heavy
chain cell surface expression. J. Immunol. 156: 2077–2084.
Jeong, H. D., and J. M. Teale. 1989. VH gene family repertoire of resting B cells:
preferential use of D-proximal families early in development may be due to
distinct B cell subsets. J. Immunol. 143: 2752–2760.
Siu, G., E. A. Springer, H. V. Huang, L. E. Hood, and S. T. Crews. 1987.
Structure of the T15 VH gene subfamily: identification of immunoglobulin gene
promotor homologies. J. Immunol. 138: 4466 – 4471.
Montalbano, A., K. M. Ogwaro, A. Tang, A. G. Matthews, M. Larijani,
M. A. Oettinger, and A. J. Feeney. 2003. V(D)J recombination frequencies can be
profoundly affected by changes in the spacer sequence. J. Immunol. 171: 5296 –
5304.
Haines, B. B., and P. H. Brodeur. 1998. Accessibility changes across the mouse
Igh-V locus during B cell development. Eur. J. Immunol. 28: 4228 – 4235.
Hesslein, D. G., D. L. Pflugh, D. Chowdhury, A. L. Bothwell, R. Sen, and
D. G. Schatz. 2003. Pax5 is required for recombination of transcribed, acetylated,
5⬘ IgH V gene segments. Genes Dev. 17: 37– 42.
Su, I. H., A. Basavaraj, A. N. Krutchinsky, O. Hobert, A. Ullrich, B. T. Chait, and
A. Tarakhovsky. 2003. Ezh2 controls B cell development through histone H3
methylation and Igh rearrangement. Nat. Immunol. 4: 124 –131.
Corcoran, A. E., A. Riddell, D. Krooshoop, and A. R. Venkitaraman. 1998. Impaired immunoglobulin gene rearrangement in mice lacking the IL-7 receptor.
Nature 391: 904 –907.
Chowdhury, D., and R. Sen. 2003. Transient IL-7/IL-7R signaling provides a
mechanism for feedback inhibition of immunoglobulin heavy chain gene rearrangements. Immunity 18: 229 –241.
Roldan, E., M. Fuxa, W. Chong, D. Martinez, M. Novatchkova, M. Busslinger,
and J. A. Skok. 2005. Locus ‘decontraction’ and centromeric recruitment contribute to allelic exclusion of the immunoglobulin heavy-chain gene. Nat. Immunol. 6: 31– 41.
Goebel, P., N. Janney, J. R. Valenzuela, W. J. Romanow, C. Murre, and
A. J. Feeney. 2001. Localized gene-specific induction of accessibility to V(D)J
recombination induced by E2A and EBF in non-lymphoid cells. J. Exp. Med. 194:
645– 656.
Sikes, M. L., A. Meade, R. Tripathi, M. S. Krangel, and E. M. Oltz. 2002.
Regulation of V(D)J recombination: a dominant role for promoter positioning in
gene segment accessibility. Proc. Natl. Acad. Sci. USA 99: 12309 –12314.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017
provided evidence for at least two roles of the transcription factor
Pax5: facilitating rearrangement of distal VH genes by inducing
IgH locus contraction (45), and also in removing H3 methylation
at lysine 9, a marker of repressed chromatin, in the VH locus,
making VH genes accessible for VH to DJH recombination (46).
Thus, it is likely that accessibility to V(D)J recombination during
early B cell development is controlled by several factors.
There are at least two explanations for the observations presented in this study. The accessibility of individual VH genes could
be determined by the relative number of acetylated lysines on
histones associated with individual VH genes, and/or by the proportion of pro-B cells carrying a particular VH gene in an active
chromatin environment. The later proposal has been reinforced by
the observation that the activation of germline ␬ transcription occurs only in a small fraction of otherwise apparently homogeneous
pre-B cells (47). Furthermore, preliminary ChIP data in our laboratory indicate that only a small fraction of V␬I genes are acetylated in BOSC cells after transfection with E2A, yet the frequency
of induced recombination of those genes was high, suggesting that
the V␬I genes associated with acetylated histones are the ones
accessible for rearrangement (P. Goebel, M. Cherrier, and A. J.
Feeney, unpublished data). Thus, we propose that it is most likely
that an increased proportion of pro-B cells have acetylated histone
proteins surrounding frequently (e.g., V1 and 81X) vs infrequently
rearranging genes.
Taken together, our data show that the extent of acetylation of
histone proteins is one of the mechanisms by which V(D)J rearrangement frequency of individual VH genes may be regulated in
vivo, opening the field for further investigations of epigenetic
modifications governing the preferential accessibility of individual
VH genes within a family for V(D)J recombination during normal
B cell development.
The Journal of Immunology
38. Guo, J., A. Hawwari, H. Li, Z. Sun, S. K. Mahanta, D. R. Littman, M. S. Krangel,
and Y. W. He. 2002. Regulation of the TCR␣ repertoire by the survival window
of CD4⫹CD8⫹ thymocytes. Nat. Immunol. 3: 469 – 476.
39. Jackson, A., H. D. Kondilis, B. Khor, B. P. Sleckman, and M. S. Krangel. 2005.
Regulation of T cell receptor ␤ allelic exclusion at a level beyond accessibility.
Nat. Immunol. 2: 189 –197.
40. Morshead, K. B., D. N. Ciccone, S. D. Taverna, C. D. Allis, and M. A. Oettinger.
2003. Antigen receptor loci poised for V(D)J rearrangement are broadly associated with BRG1 and flanked by peaks of histone H3 dimethylated at lysine 4.
Proc. Natl. Acad. Sci. USA 100: 11577–11582.
41. Bolland, D. J., A. L. Wood, C. M. Johnston, S. F. Bunting, G. Morgan,
L. Chakalova, P. J. Fraser, and A. E. Corcoran. 2004. Antisense intergenic transcription in V(D)J recombination. Nat. Immunol. 5: 630 – 637.
42. Baumann, M., A. Mamais, F. McBlane, H. Xiao, and J. Boyes. 2003. Regulation
of V(D)J recombination by nucleosome positioning at recombination signal sequences. EMBO J. 22: 5197–5207.
6675
43. Golding, A., S. Chandler, E. Ballestar, A. P. Wolffe, and M. S. Schlissel. 1999.
Nucleosome structure completely inhibits in vitro cleavage by the V(D)J recombinase. EMBO J. 18: 3712–3723.
44. Kwon, J., K. B. Morshead, J. R. Guyon, R. E. Kingston, and M. A. Oettinger.
2000. Histone acetylation and hSWI/SNF remodeling act in concert to stimulate
V(D)J cleavage of nucleosomal DNA. Mol. Cell 6: 1037–1048.
45. Fuxa, M., J. Skok, A. Souabni, G. Salvagiotto, E. Roldan, and M. Busslinger.
2004. Pax5 induces V-to-DJ rearrangements and locus contraction of the immunoglobulin heavy-chain gene. Genes Dev. 18: 411– 422.
46. Johnson, K., D. L. Pflugh, D. Yu, D. G. Hesslein, K. I. Lin, A. L. Bothwell,
A. Thomas-Tikhonenko, D. G. Schatz, and K. Calame. 2004. B cell-specific loss
of histone 3 lysine 9 methylation in the VH locus depends on Pax5. Nat. Immunol.
5: 853– 861.
47. Liang, H. E., L. Y. Hsu, D. Cado, and M. S. Schlissel. 2004. Variegated transcriptional activation of the immunoglobulin ␬ locus in pre-B cells contributes to
the allelic exclusion of light-chain expression. Cell 118: 19 –29.
Downloaded from http://www.jimmunol.org/ by guest on June 16, 2017