Download Expression of the Ly-6E.1 - Development

537
Development 124, 537-547 (1997)
Printed in Great Britain © The Company of Biologists Limited 1997
DEV3520
Expression of the Ly-6E.1 (Sca-1) transgene in adult hematopoietic stem cells
and the developing mouse embryo
Colin Miles†,§, Maria-Jose Sanchez‡,§, Angus Sinclair‡ and Elaine Dzierzak*
Laboratory of Gene Structure and Expression, National Institute for Medical Research, The Ridgeway, Mill Hill, London, NW7 1AA,
UK
*Author for correspondence at present address: Erasmus University, Faculty of Medicine, Dept. of Cell Biology and Genetics, P.O. BOX 1738, 3000 DR Rotterdam, The
Netherlands (e-mail: [email protected])
†Present address: MRC Human Genetics Unit, Western General Hospital, Crewe Road, Edinburgh, EH4 2XU, UK
‡Present address: Cambridge University, Department of Hematology, MRC, Hills Road, Cambridge, CB2 2QH, UK
§Both authors contributed equally to this work
SUMMARY
The mouse hematopoietic marker Sca-1, encoded by the Ly6E.1 and Ly-6A.2 genes, has been instrumental in the
enrichment and characterization of the stem cell for the
adult blood system. In the studies reported here, we use Ly6E.1 genomic fragments to direct expression of a lacZ
marker transgene in vivo to study Ly-6E.1 specific regulatory elements in the hematopoietic stem cell and to localize
these cells in the developing mouse embryo. We demonstrate that a region approximately 9 kb downstream from
the transcriptional start site is required for the distinct,
restricted expression pattern of the Ly-6E.1-lacZ transgene
within adult hematopoietic stem cells and embryos. We also
demonstrate that viable and functional lacZ-expressing
hematopoietic stem cells can be enriched by FDG staining
and flow cytometric sorting. The Ly-6E.1-lacZ-mediated
enrichment of hematopoietic stem cells from adult transgenic bone marrow in combination with the temporal
expression pattern of the transgene in the pro/mesonephros
suggest an intraembryonic site of development for these
cells in the mouse.
INTRODUCTION
cells from Drosophila (Krasnow et al., 1991) and mammalian
hematopoietic cell lines retrovirally transduced with an SV40lacZ gene (Nolan et al., 1988). To date, no enrichment procedures for functional hematopoietic stem cells or other cells
in the mouse have relied upon in vivo expression of a lacZ
transgene marker.
Numerous candidate genes and gene regulatory elements for
HSC-directed transgene marking studies are suggested from
antibody enrichment and cell sorting experiments. HSCs of the
adult mouse bone marrow and fetal liver express Sca-1, Thy1, CD34 and c-kit (Spangrude et al., 1988b; Ikuta et al., 1990;
Müller-Sieburg et al., 1986; Krause et al., 1994; Ikuta and
Weissman, 1992), although none of these is exclusively a
marker of the HSC. Previously, the Thy-1 gene has been used
in transgenic experiments, but even a 12 kb genomic fragment
appears to be unable to direct transgene expression in HSCs
(Dzierzak et al., 1993 and unpublished results). The c-kit gene
is spread over 70 kb of genomic DNA with 21 exons (Gokkel
et al., 1992), thus making it difficult to manipulate for transgenic experiments. Furthermore, mouse CD34 gene expression
has only recently been characterized in vitro (May and Enver,
1995). However, extensive analysis of Sca-1 protein expression
patterns in vivo and gene regulatory elements in vitro suggest
that it is a most suitable candidate for transgenic marking, gene
regulation studies and HSC manipulations.
The Sca-1 hematopoietic stem cell marker is encoded by the
In mammals, hematopoietic stem cells (HSC) are responsible
for the daily production of millions of mature cells of all blood
lineages throughout adult life. Our current knowledge of
mammalian HSCs in vivo is derived primarily from experiments utilizing mouse radiation chimeras (Michlem et al.,
1966). Transplantation studies in which marked cells from one
animal are transferred into lethally irradiated syngeneic recipients indicate that HSCs are a rare population of self-renewing
pluripotent cells in adult bone marrow (Abramson et al., 1977),
fetal liver (Capel et al., 1989), aorta-gonad-mesonephros
(AGM) region (Müller et al., 1994) and the yolk sac (Moore
and Metcalf, 1970). The enrichment and further characterization of HSCs has relied on flow cytometry using antibodies
detecting specific cell-surface markers (Spangrude et al.,
1988b; Jordan et al., 1990), staining for mitochondrial activity
(Ploemacher and Brons, 1989) and density gradient fractionation (Visser et al., 1984). Another approach for enrichment,
additionally advantageous for the characterization of HSCspecific gene regulatory elements and the localization of the
first HSCs within the developing embryo, would be to utilize
a HSC-specific lacZ transgenic marker and flow cytometric
sorting of cells staining positive with the fluorescein di-β-Dgalactopyranside (FDG) substrate. The FDG sorting procedure
has previously been successful for enrichment of functional
Key words: mouse, hematopoietic cell, stem cell, Sca-1, Ly-6E.1,
transgene
538
C. Miles and others
allelic Ly-6E.1 and Ly-6A.2 genes (van de Rijn et al., 1989),
which are members of the Ly-6 family consisting of at least 18
highly related genes (Kamiura et al., 1992). The Ly-6E.1 and
Ly-6A.2 genes contain four exons that encode 876 and 830 base
transcripts, respectively, and a 10-12 kDa GPI-linked cell
surface glycoprotein (LeClair et al., 1986; McGrew and Rock,
1991; Palfree and Hammerling, 1986; Rock et al., 1986; Su and
Bothwell 1989). The proteins are identical in sequence except
for two amino acid differences resulting from three nucleotide
differences (LeClair et al., 1986; Reiser et al., 1988). Within the
hematopoietic system their expression patterns are complex
(HSCs, progenitors and some subsets of T lymphocytes), interferon-inducible and allele-specific in inbred strains of mice
(Kimura et al., 1984; Codias et al., 1989; Dumont and Boltz,
1987; Spangrude et al., 1988a,b), particularly in HSCs
(Spangrude and Brooks, 1993). For example, Ly-6A.2 strains of
mice express Sca-1 on 99% of stem cells with hematopoietic
repopulating activity, while Ly-6E.1 strains express Sca-1 on
only 25% of these cells. In addition, expression is found on
epithelial cells, the kidney and the brain (Reiser et al., 1988; van
de Rijn et al., 1989; Cray et al., 1990). While much is known
about the protein expression patterns of Ly-6E.1 and Ly-6A.2 in
the adult, little is known about Ly-6E.1/A.2 expression during
mouse embryonic development. Only recently have yolk sac
cells from embryos 11 days post coitum (dpc) been shown to be
negative for Sca-1 expression, as measured by flow cytometry
(Huang and Auerbach, 1993). RT-PCR analysis of RNA from
10 dpc embryos has confirmed the yolk sac as negative, and
additionally, the intra-embryonic AGM region has been demonstrated to express Ly-6A.2/E.1 (Dzierzak et al., 1995).
Putative regulatory elements necessary for basal, interferoninducible and allele-specific expression patterns of the Ly6E.1/A.2 genes have been identified by deletion analysis (Khan
et al., 1990; Sinclair and Dzierzak, 1993) and DNAse I hypersensitive site (HSS) mapping (Sinclair and Dzierzak, 1993).
Deletion analysis of HSS containing 5′ and 3′ flanking regions
of these genes in transfected cells have revealed cis-regulatory
elements at −1.2 and −0.11 kb upstream and +8.7 and +8.9 kb
downstream of the transcriptional start site. The 3′ sequences
are required in vitro for high level, γ-IFN induced expression of
the Ly-6E.1 gene in hematopoietic cells (Sinclair et al., 1996).
In order to direct high levels of lacZ expression to HSCs for
flow cytometric sorting and enrichment, for characterizing
gene regulatory elements of the Ly-6E.1 gene and for identifying sites of Ly-6E.1 expression in the mouse embryo, we
have generated transgenic mouse lines that contain either a 14
kb or 9.4 kb Ly-6E.1-lacZ construct. We demonstrate the
enrichment of functional HSCs by FDG sorting of Ly-6E.1lacZ-expressing bone marrow cells and show that the 3′-most
region of the Ly-6E.1 gene is necessary for tissue-specific
expression in adults and embryos. Our developmental studies
demonstrate highly restricted transgene expression in the
pro/mesonephros, hindgut, endoderm and mesoderm of the tail
in early to mid-gestation embryos and suggest possible sites
for the development of the first adult HSCs.
MATERIALS AND METHODS
Constructs and transgenic mice
The 14 kb Ly-6E.1 cassette, pL6Cla, was constructed by cloning the
3.6 kb SphI-EcoRI fragment from pLR1Cla (upstream region and the
first untranslated exon of Ly-6E.1 containing an inserted ClaI site) into
a 12.3 kb SphI-EcoRI partial fragment isolated from pAB14 (Sinclair
and Dzierzak, 1993; Sinclair et al., 1996). This fragment contains the
remaining 3′ part of the Ly-6E.1 gene and the pPolyIII vector. The
lacZ gene in p610ZA (gift of D. Meijer) was modified, converting a
3′ SmaI site to an NarI site using oligonucleotide adaptors. The 3.6
kb lacZ NarI fragment was cloned into pL6Cla to generate pL6LZ.
Fertilized (CBA×C57Bl/10) F1 oocytes were microinjected with
Ly-6E.1-lacZ fragments (Fig. 1) (Grosveld et al., 1987). A 17.6 NotI
fragment containing the 14 kb Ly-6E.1 genomic sequence with the
inserted lacZ gene was obtained from pL6LZ and designated BL (for
BamH1-lacZ). The truncated Ly-6E.1-lacZ fragment was obtained by
XbaI and NotI digestion of pL6LZ and designated XN (for XbaI/NotI).
Both fragments were gel-purified for removal of all vector sequences.
Positive founder animals were bred with (CBA×C57Bl/10)F1 mice
and lines were maintained as heterozygotes. Southern blot analysis of
tail DNA was used to identify transgenic mice within a litter, to
determine copy number and to assess the integration patterns of transgenes.
DNA and RNA analysis
Genomic DNA (5-10 µg) for Southern blot analysis (Sambrook et al.,
1989) was digested with BamHI and electrophoresed through 1%
agarose/TAE gels prior to transfer to Nytran nylon membranes.
Transgene copy number controls were generated by the addition of
appropriate amounts of pL6LZ to non-transgenic genomic DNA.
Total cellular RNA for northern blot analysis was prepared using
the lithium chloride/urea method and 5-15 µg was fractionated on 1%
agarose/formaldehyde gels prior to transfer to Hybond-N membranes
(Fraser et al., 1990). For determination of percentage transgene
expression compared to endogenous Ly-6E.1/A.2 gene expression,
northern blots were probed with a GAPDH probe for quantitation of
RNA in each lane. After normalization the intensity of lacZ hybridizing signal was compared with that of Ly-6E.1 on a phosphorimager
and expressed as a percentage of endogenous Ly-6E.1 expression. The
specific activities of the lacZ and Ly-6E.1 probes were equivalent. The
Ly-6.1-2R probe (see below) used to detect Ly-6E.1 RNA crosshybridizes to transcripts from closely homologous Ly-6 genes and
therefore the percentage lacZ expression is an underestimate.
Genomic DNA (200 ng) from the peripheral blood of transplanted
mice was analyzed by PCR using the following oligonucleotide
primers: for myogenin-specific sequences TTACGTCCATCGTGGACAGC (Myo1) and TGGGCTGGGTGTTAGTCTTA (Myo2); and
for lacZ-specific sequences GCGACTTCCAGTTCAACATC (lacZ1)
and GATGAGTTTGGACAAACCAC (lacZ2). DNA was subjected to
an initial 5 minute denaturation at 94°C followed by 30 cycles of
denaturation (5 seconds at 94°C), annealing (30 seconds at 60°C) and
elongation (30 seconds at 72°C). Serial dilutions of blood DNA from
a transgenic animal were used as a PCR control to evaluate the levels
of donor cell reconstitution in transplanted mice.
Probes used for hybridization to Southern or northern filters were
labeled by an oligonucleotide priming procedure incorporating [α32P]ATP. The fragments used are as follows: a 1.1 kb BamHI-EcoRV
lacZ fragment from p610ZA; a 1.2 kb XbaI-NruI Thy-1 fragment from
pD7 (Spanopoulou et al., 1988); a 761 bp EcoRI Ly-6E.1 cDNA
fragment from pLy6.1-2R (LeClair et al., 1986); and a 670 bp
GAPDH fragment (see PCR section). After hybridization, filters were
washed to a stringency of 0.2×SSC/0.1% SDS and exposed to either
X-ray film (Kodak AR5) at −70°C or to a phosphorimager screen
(Molecular Dynamics) for quantitation using Imagequant software.
For RT-PCR of sorted cell populations, RNA was prepared using
the lithium chloride/urea method (Fraser et al., 1990). RNA from
4.5×105 FDG, Sca-1 double-positive, 8×105 FDG single-positive and
1×106 unsorted bone marrow cells was primed with oligo dT and
reverse-transcribed using AMV reverse transcriptase (HT Biotechnology, Cambridge UK) under the manufacturers’ recommended con-
Ly-6E.1 (Sca-1) transgene in mouse hematopoietic stem cells
ditions. PCR was performed on 5-10% of each RT product with the
same cycling parameters as described above, using the following
primer pairs: lacZ1 and lacZ2 (described above); GAPDH primers
gapdh-s, CTTCACCACCATGGAGAAGG and gapdh-a, CCACCCTGTTGCTGTAGCC (cDNA product = 670 bp); for Ly-6E.1
primers PE5, ACTGTGCCTGCAACCTTGTCTGAGA and Ex4.2,
GTCCAGGTGCTGCCTCCATT (cDNA product = 425 bp).
Lymphocyte activation
The medium used in all primary cultures of thymus, spleen or lymph
node cells consisted of αMEM supplemented with 10% FCS, 10
µg/ml penicillin, 10 µg/ml streptomycin, 2 mM L-glutamine and 50
µM β-mercaptoethanol. Cells were seeded at 2×105/ml and activated
for 2-3 days in the presence of either 5 ng/ml ConA (Sigma) or 5
ng/ml PMA (Sigma) and 500 ng/ml ionomycin (Sigma).
β-galactosidase assays and antibody staining
For analysis of β-galactosidase activity in viable transgenic bone
marrow, thymus, spleen or lymph node cells, 106 single cells were
resuspended in 20 µl of PBS with 5% FCS prior to loading with 20
µl of 2 mM fluorescein di-(β-D-galactopyranoside), FDG (Sigma) in
dH2O and followed by incubation at 37°C for 75 seconds. The uptake
was stopped by the addition of 500 µl of ice-cold PBS with 5% FCS
and the reaction was allowed to proceed for 1-3 hours on ice in the
dark. Before flow cytometric analysis and sorting, propidium iodide
(Sigma) was added to a final concentration of 1 µg/ml to allow the
exclusion of dead cells. The fluorescence generated by β-galactosidase was detected on the FACScan or FACStar (Becton-Dickinson)
on a FITC analysis channel.
Sca-1 surface protein was detected using a PE-conjugated
(Pharmingen, San Diego) or biotin-conjugated (gift of I. Weissman)
clone E13-161.7 antibody, initially described by Aihara et al. (1986).
Thy 1.2, CD4, CD8, B220, Mac-1 and Gr-1 antibodies were direct
PE-conjugates obtained from Pharmingen. Briefly, 106 cells were
stained with antibody, incubated on ice for 30 minutes and washed 3
times in cold PBS with 5% FCS. An appropriate isotype control was
used in each experiment. Dead cells were excluded by staining with
propidium iodide. Double or triple labeling of cells was performed by
incubating 106 cells with PE- and biotin-conjugated antibodies
followed by streptavidin-RED670 (Gibco). After washing, the FDG
reaction was performed.
Whole embryos were isolated into ice-cold PBS and fixed in 1 ml
of X-gal fix (1% formaldehyde, 0.2% gluteraldehyde) at 4°C for 3090 minutes, depending upon size. Embryos were stained overnight at
room temperature in 1 mg/ml X-gal (Sigma). Generally X-gal staining
was visualized within 1 hour. Prior to sectioning the stained embryos
were dehydrated through increasing concentrations of ethanol in icecold PBS, cleared with Histoclear (National Diagnostics, Atlanta,
Georgia) and mounted in paraffin wax. 6-10 µm sections were cut
using a Reichert-Jung microtome onto APES (3-aminopropyltriethoxysilane, Sigma)-coated microscope slides and dried overnight at
room temperature. Dried slides were dewaxed in Histoclear and rehydrated through decreasing concentrations of ethanol before counterstaining in 0.25% eosin. Counterstained slides were dehydrated and
mounted with DPX (BDH, Poole, UK).
X-gal staining of single cell suspensions was performed using a
modified embryo-staining protocol. Cells were fixed in 0.5×X-gal fix,
stained overnight in 1 mg/ml X-gal, washed once in PBS and centrifuged onto slides using a Cytospin (Shanon, Runcorn, UK).
Methanol-fixed preparations were counterstained with eosin and
mounted in DPX.
Bone marrow transplantation/radiation chimeras
Donor transgenic bone marrow cells for the generation of radiation
chimeras were FDG- and propidium iodide-stained ex vivo in L-15
medium with 5% FCS. FACS-sorted cells were counted, cell-number
titrated and suspended in a final volume of 500 µl PBS for intravenous
539
injection into the tail vein of 4-6 month old female
(CBA×C57Bl/10)F1 mice. Transplantation and analysis was as
described in Müller et al. (1994). On the day of the transfer, the recipients were exposed to a split dose of 1000 RADS from a 60Co source.
All animals were housed in positive pressure cabinets and received
1.6 gm/l neomycin in their drinking water for 4 weeks. Peripheral
blood (100 µl) was taken at 1 and 4 months post-transplantation for
PCR analysis of donor-specific markers. Percentage contribution was
determined by quantitative comparison of donor marker signal to
signal from serial dilutions of transgenic blood DNA controls. Multilineage repopulation was determined by PCR analysis of DNA from
numerous hematopoietic tissues of engrafted recipient mice at greater
than 4 months post-transplantation.
RESULTS
The 3′ flanking sequences of the Ly-6E.1 gene are
required for tissue-specific expression in adult
transgenic mice
Previously, in transfected γ-IFN-induced murine erythroleukemia (MEL) cells, a 14 kb genomic Ly-6E.1 DNA has
been shown to express surface protein to the same levels as the
endogenous MEL cell Ly-6A.2 gene (Sinclair and Dzierzak,
1993). Deletional analysis of Ly-6E.1 constructs in transfected
MEL cells has demonstrated that a region approximately 9 kb
downstream from the transcriptional start site is required for
high-level γ-IFN-induced expression (Sinclair et al., 1996). In
this region, which contains two DNase I hypersensitive sites at
+8.7 and +8.9, an IFN-stimulated response element (ISRE) and
numerous other transcription factor consensus sites were
found. Based on this in vitro information, we set out to test
whether this region would direct high-level and/or tissuespecific expression in vivo.
We inserted a lacZ reporter gene in the first exon of the Ly6E.1 14 kb genomic fragment (Fig. 1A). Four transgenic lines
were produced with this construct: BL1a, BL1b, BL7 and
BL19. Fig. 1B shows a Southern blot used for determination
of transgene copy number in each of these transgenic lines. All
contain 4-15 copies of the intact sequences, as indicated. To
test whether the 3′ region containing the +8.7 and +8.9 DNase
I HS sites was required for Ly-6E.1-lacZ expression, we
deleted 4.6 kb of Ly-6E.1 downstream genomic sequences.
With this XN construct (Fig. 1A), six transgenic lines XN23,
XN37, XN224, XN225, XN229 and XN231 and one founder
animal XN25 (>90% chimeric for the transgene) were
produced. Southern blot analysis (Fig. 1B) of tail DNA demonstrated that between one and 25 copies of the transgene were
present in these animals. The non-transgenic XN28 mouse was
used as a control.
Transgene expression analysis was performed by northern
blotting of kidney RNA from BL and XN mice, since it is
known that kidney expresses high levels of endogenous Ly6E.1/A.2. When transgenic kidney RNA was examined (Fig.
1C), lacZ-specific signal was found in all four BL lines.
However, only one out of eight XN transgenics showed kidney
expression of lacZ. The percent level of lacZ expression per
transgene copy, as compared to endogenous Ly-6E.1/A.2 gene
expression, was found to range from 2.0% to 4.7% for the BL
transgenics. Only one XN transgenic line, XN23, expressed
lacZ to a level of 1.4% per copy. The tissue-specific expression
patterns of the Ly-6E.1-lacZ transgenes were examined in liver,
540
C. Miles and others
Fig. 1. Ly-6E.1-lacZ transgenic constructs and molecular characterization of transgenic mouse lines. (A) The lacZ marker gene was cloned into
a ClaI site inserted in the first exon of the 14 kb Ly-6E.1 gene cassette. The BL construct consists of the full 14 kb BamHI-Ly-6E.1 fragment
and the 3′ deleted XN construct a 9.4 kb BamHI-XbaI Ly-6E.1 fragment. The positions of previously mapped DNase 1 hypersensitive sites are
marked by arrows and the distance from the transcriptional start site indicated. Restriction sites shown are B=BamHI and X=XbaI (B)
Transgene copy number in BL and XN mice was determined by Southern blot analysis. Genomic DNA was cut with BamHI and blotted DNA
was hybridized with Thy1- and lacZ-specific probes. Controls are non-transgenic DNA mixed with varying amounts of Ly-6E.1-lacZ plasmid
DNA. Transgene copy numbers are indicated at the bottom of each lane and DNA size markers at the right. (C) Northern blot analysis of kidney
RNA from each of the transgenic lines hybridized with lacZ, Ly-6E.1 and GAPDH probes. Percentage lacZ expression per copy of the
transgene, as compared to endogenous Ly-6E.1/A.2 expression, is indicated at the bottom of each lane. (D) Northern blot analysis of numerous
hematopoietic and non-hematopoietic tissue RNAs from BL19 and XN229 transgenic mice. Hybridization with lacZ and Ly-6E.1 probes shows
transgene and endogenous gene expression. Ethidium bromide-stained gel shows 18S ribosomal RNA as a quantitation control. K, kidney; L,
liver; M, muscle; B, bone marrow; S, spleen; LN, lymph node; T, thymus.
muscle, bone marrow, spleen, lymph node and thymus RNA
(Fig. 1D) in high copy number BL19 (15 copies) and XN229
(25 copies) mice. lacZ transgene expression was found in all
BL19 tissues positive for endogenous Ly-6E.1/A.2 expression.
The XN229 transgenic showed low level lacZ signal only in
the lymph node RNA. Tissue-specific expression of lacZ was
found in all BL transgenic mice (data not shown), while no XN
transgenics were found to express lacZ in a tissue-specific
manner. In a few XN lines, spurious lacZ expression was found
in some tissues (see legend to Table 2), possibly indicating integration site-dependent expression. These data strongly suggest
that the 3′ flanking region of the Ly-6E.1 gene containing the
+8.7 and +8.9 DNase I hypersensitive sites is required for in
vivo tissue-specific expression.
Specific Ly-6E.1 lacZ expression in
hemato/lymphoid cells can be detected only in BL
transgenic mice
Ly-6E.1 is known to be expressed on a high percentage of
activated T lymphoid cells of the adult mouse (Kimura et al.,
1984). As a first test for β-galactosidase activity in the
hematopoietic cells of Ly-6E.1-lacZ transgenic mice, polyclonally (ConA) activated T cells from control non-transgenic
and BL19 transgenic thymus and lymph nodes were stained
with the substrate X-gal. Fig. 2 shows that β-galactosidasepositive cells are easily observed and represent 34% and 57%
of the activated BL19 thymus and lymph node cells, respectively. Consistent with this, β-galactosidase-positive cells were
found in ConA-activated T cells from all BL transgenic lines.
However, no XN transgenic lines (with the exception of XN37,
see legend to Table 2) showed any T lymphoid-specific
staining.
Since it had been previously demonstrated that staining of
lacZ-transduced cell lines with the β-galactosidase substrate
FDG can be more sensitive than X-gal staining (Nolan et al.,
1988), we sought to determine whether FDG staining could
detect low-level expression in XN transgenic mice. Flow cytometric analysis of FDG-stained thymus, spleen, lymph node
Ly-6E.1 (Sca-1) transgene in mouse hematopoietic stem cells
541
Table 1. Percentage of lymphoid and myeloid cells with the
FDG+ population
Cell Markers
Tissue
Bone marrow
Spleen
Thymus
Thy 1.2
CD4
CD8
B220
Mac-1
Gr-1
24%
72%
93%
7%
34%
65%
12%
22%
30%
22%
23%
ND
29%
3%
ND
20%
1%
ND
Single cell suspensions of bone marrow, spleen and thymus cells werestained with the FDG substrate and antibodies against the above cell markers.
104 cells were examined on a Becton-Dickinson FACStar for percentage
myeloid and lymphoid lineage cells within the β-galactosidase-positive
population. ND = not done.
Fig. 2. Specific expression of the Ly-6E.1-lacZ transgene in BL19
thymus and lymph node cells. Control non-transgenic and BL19
transgenic cells were activated with Concanavalin A and stained with
the β-galactosidase substrate X-gal. Cytospins of activated T cells
show blue-staining cells only in BL19 transgenic thymus and lymph
node.
lymphoid and myeloid lineages. Double staining of bone
marrow cells with FDG and the Sca-1 antibody (Fig. 4A)
shows 1.7% of these cells co-express the transgene and Sca-1.
However, all Sca-1-positive cells (4.2% of total bone marrow)
are not FDG-positive and a small fraction of the total bone
marrow cells are single-positive for FDG (5.2%). To determine
whether both the endogenous gene and the transgene were transcriptionally active in the same cells, we performed RT-PCR
analysis on sorted FDG, Sca-1 double-positive and FDG
single-positive bone marrow cells (Fig. 4B). Ly-6E.1-lacZ
transgene and Ly-6E.1/A.2 endogenous gene transcripts are
found in both populations, strongly suggesting that translational or post-translational differences account for the singlepositive population.
To determine what lineages of cells are represented in the
Sca-1, FDG double-positive bone marrow population, we
performed triple staining with antibodies against the lymphoid-
and bone marrow cells from control non-transgenic and high
copy number BL19 and XN229 transgenic mice was
performed. As shown in Fig. 3, a distinct population of FDGpositive cells is found in all four hematopoietic tissues of the
BL19 mouse, but no positive cells are found in the XN229
tissues. These data were confirmed by staining other BL and
XN transgenic lines (not shown). Also, the direct comparison
of X-gal and FDG staining
of BL19 transgenic cells
showed complete correspondence, with 9.9, 39.3,
45.8 and 10.3% X-galpositive cells in thymus,
spleen, lymph node and
bone marrow, respectively.
In combination these data
demonstrate that, within the
sensitivity of both substrates, only the 14 kb BL
transgene expresses in the
hemato/lymphoid lineages
in vivo.
Examination of the
BL transgene expression
pattern within various
hematopoietic lineages was
performed
by
double
staining of bone marrow,
spleen and thymus cells
with FDG and Thy.1, CD4,
CD8, B220, Mac-1 and Gr1 specific antibodies (Table
1). As expected, predomiFig. 3. Expression analysis of the Ly-6E.1-lacZ transgene in the hematopoietic tissues of BL19 and XN229
nant transgene expression
mice with the FDG substrate. Thymus, spleen, lymph node and bone marrow cells from control nonwas found in the T
transgenic and BL and XN trangenic mice were stained with the FDG substrate and analyzed by flow
lymphoid lineage, with
cytometry. Histograms show levels of fluorescence intensity on a logarithmic scale (abscissa) and number
some expression in the B
of cells (ordinate). Percentages of FDG-positive cells are indicated.
542
C. Miles and others
specific markers Thy-1 and B220. Within the gated doublepositive population, 26% of the cells are Thy-1+ and 44% are
B220+ (Fig. 4C). Thus, approximately 70% of the doublepositive cells are lymphocytes. Interestingly, 33% of the
double-positive cells (<1% of total bone marrow) are Thy1lo,
a phenotype characteristic of HSCs and progenitors.
positive cells was determined to be multilineage by Southern
blot analysis of hematopoietic tissues and lineages (not
shown). These results demonstrate, in two independent transgenic mouse lines, Ly-6E.1-lacZ expression in HCSs and the
ability to enrich for functional HSC activity by FDG sorting of
transgenic bone marrow.
Functional hematopoietic stem cells can be
A distinct and restricted urogenital expression
enriched by FDG sorting of Ly-6E.1-lacZ transgenic
pattern of Ly-6E.1-lacZ in the developing embryo
bone marrow cells
The fidelity of tissue-specific expression, particularly in HSCs,
As Ly-6E.1 gene product has been used for the enrichment of
of the BL transgene in adult mice led us to examine the specific
HSCs from the bone marrow and we have detected Ly-6E.1expression pattern of Ly-6E.1-lacZ during development.
directed lacZ expression in BL transgenic bone marrow, it was
Embryonic localization of β-galactosidase staining could
of great interest to determine whether the FDG-positive popuindicate specific sites of HSC development within the AGM
lation was enriched in HSC activity. Thus, we tested the ability
region, which was previously shown to express Ly-6A.2/E.1 by
of FDG-positive BL transgenic bone marrow cells to
contribute to long-term,
multilineage hematopoiesis
by transplantation of sorted
cells into lethally irradiated
adult recipients. In two
separate experiments, bone
marrow cells were obtained
from male homozygous
BL1a (eight copies) or heterozygous
BL19
(15
copies)
transgenics.
Limiting numbers of sorted
transgenic
FDG-positive
and FDG-negative cells
were injected into lethally
irradiated female mice
along with 2.5×105 nontransgenic female splenocytes to provide for short
term
hematopoiesis.
Peripheral blood DNA was
examined for evidence of
engraftment by a lacZ
transgene-specific
PCR
assay at 4 months posttransplantation. As shown
in Fig. 5, as few as 103
FDG-positive donor bone
marrow cells resulted in
100% engraftment of one
out of three recipients,
while 1000-fold more (106)
FDG-negative cells were
required for high-level Fig. 4. Sca-1 and FDG double-stained subsets of BL transgenic bone marrow. (A) FACS dot plots of Sca-1
engraftment of five out of antibody (PE), isotype control antibody (PE) and FDG (FITC) substrate double staining are shown for bone
six recipients. Considering marrow cells from control non-transgenic and BL19 transgenic mice. Percentages of cells in each quadrant
4
that transplantation of total are indicated. Analysis was performed on 10 cells. (B) RT-PCR analysis of sorted Ly-6E.1-lacZ bone
marrow
subsets
from
a
BL19
transgenic
mouse.
Specific RNA transcripts for transgene lacZ, endogenous
bone marrow requires at
Ly-6E.1 and normalization control GAPDH were examined. Lane 1, no cells; lane 2, FDG single-positive
5
least 10 cells for high-level sorted BL19 bone marrow; lane 3, FDG and Sca-1 double-positive sorted BL19 bone marrow; lane 4, BL19
engraftment, FDG-positive transgenic unsorted bone marrow; lane 5, non-transgenic unsorted bone marrow. RT-PCR products were run
bone marrow cells are on a 1.2% agarose gel and stained with ethium bromide. (C) Analysis of Sca-1/FDG double-positive bone
approximately
100-fold marrow cells from BL19 transgenic bone marrow with Thy 1.2- and B220-specific antibodies. Percentages
enriched for HSC activity. of Thy 1.2 and B220-positive cells within the Sca-1/FDG double-positive population are indicated. Note that
Engraftment with FDG- Thy 1.2 expression levels vary from bright to dim.
Ly-6E.1 (Sca-1) transgene in mouse hematopoietic stem cells
Table 2. Embryonic expression patterns of the Ly-6E.1lacZ transgenes
Line
BL1a
BL1b
BL7
BL19
XN23
XN37
XN224
XN225
XN229
XN231
Copy no.
Mesonephros
Tail
Ectopic
4
4
6
15
2
2
1
17
25
6
+++
+++
+++
+++
+++
+/−
−
−
−
−
+++
+++
+++
+++
−
+/−
+/−
−
+
+/−
−
−
++
+
+++
+++
++
+
+
+
Expression patterns were examined in numerous embryos of each line,
giving cells of +++, ++, + and +/− intensity of X-gal staining. Staining was
consistent within each line of mice. Ectopic expression was seen in embryos
at the following sites: BL7, diencephalon and liver; BL19, otic vesicle;
XN23, mesenchyme of limb buds, midline of telenchephalon, region of the
first branchial arch and otic vesicle; XN37, hindbrain, telencephalon and
liver; XN224, dorsal root ganglia; XN225, otic vesicle; XN229, otic vesicle;
XN231, otic vesicle. The following ectopic expression patterns were
observed in adults of the following lines: XN37, activated lymphocytes;
XN229, lymph node stroma.
RT-PCR analysis (Dzierzak et al., 1995). When whole transgenic embryos are incubated with X-gal, the most striking
feature is the highly restricted, caudal-staining pattern. βgalactosidase expression begins at 7.5 dpc and as shown in Fig.
6A-C, intense blue staining is visible in the tail of 8.5, 9.5 and
11.5 dpc embryos, respectively. The staining recedes towards
the posterior end of the tail at 13-14 dpc (not shown). This
expression pattern is consistent between all four BL transgenic
lines and correlates with endogenous Ly-6A.2/E.1 gene
expression, as determined by RT-PCR analysis (not shown). In
the 11.5 dpc embryo (Fig. 6C), another site of intense staining
was found by removing a portion of the body wall in the region
of the aorta, mesonephros and gonads (AGM). To localize the
expression within the AGM region, embryos were dissected
after X-gal staining. Only the anterior portion of the
pro/mesonephros is positive for β-galactosidase activity (Fig.
6D). The AGM region is known to harbor HSC activity,
beginning late 10 dpc, and at some low frequency we have been
able to find staining in the pro/mesonephros of transgenic 10.5
dpc embryos (not shown). In addition, hematopoietic cell-containing yolk sacs from various stages were stained and
examined. As shown in Fig. 6E, no blue-staining cells are
found in 11 dpc yolk sac. This is consistent with the lack of
Sca-1 antibody staining of 11 dpc yolk sac (Huang and
Auerbach, 1993) and lack of Ly-6E/A-specific RNA at 10 dpc
(Dzierzak et al., 1995).
Cross sectioning of 11 and 11.5 dpc embryos in the midand caudal regions yielded further localization of β-galactosidase-positive cells. Within the pro/mesonephros, intense X-gal
staining is restricted to the epithelial-like cells of the tubules
(Fig. 7A,B). Some lower level staining is seen in the surrounding mesenchymal cells. This low-level staining is
probably not due to diffusion since the hindgut exhibited strong
staining only in the gut wall, with no positive surrounding cells
(Fig. 7C). In the tail region, endodermal cells of the hindgut
are strongly positive for X-gal staining and surrounding mesodermal cells show various levels of staining (Fig. 7D). At day
8 pc, the diverticulum of the hindgut is well defined and
543
extends almost to the posterior end of the tail. Ly-6E.1-lacZ
expression is seen from the tail to the anterior end of the
hindgut in 8.5 dpc embryos onwards. At later stages after
fusion of the hind and foreguts, staining stops abruptly at this
border (not shown).
Late in gestation at 13.5 dpc, staining of tubules is widespread in the degenerating mesenophros and surrounding cells
(Fig. 8A,B). Faint staining is observed in some cells of the
Mullarian duct in females (Fig. 8B). In males at 15.5 dpc,
intense staining is found in the epididymus (Fig. 8C), which is
thought to be derived from the mesonephric tubules (Kaufman,
1992). Finally, expression in the developing kidney
(metanephros) appears to be restricted to the cortical tubules at
18 dpc (Fig. 8D) and is consistent with the adult kidney
expression pattern of the Ly-6E.1/A.2 (van de Rijn et al., 1989).
The 3′ flanking sequences of the Ly-6E.1 gene
appear to be responsible for tissue-specific
transgene expression during embryonic
development
The spatial expression patterns of the 14 kb and 9.4 kb Ly6E.1-lacZ transgenes in embryos of the BL and XN lines were
examined to determine if the 3′ sequences of the Ly-6E.1 gene
are necessary for tissue-specific embryonic expression. Data
for 11 dpc embryos is summarized in Table 2. Mesonephros
and tail expression was consistently high in all four BL transgenic lines. However, only one XN line, XN23, expressed the
transgene highly in the mesonephros, but it did not express the
transgene in the tail region. The XN229 line expressed the
transgene reliably in the tail but at a lower level as compared
to the tail expression in the BL lines. Furthermore, while
ectopic expression of the BL transgene occurred rarely, ectopic
Fig. 5. Limiting dilution hematopoietic reconstitution with FDGsorted Ly-6E.1-lacZ transgenic bone marrow. Percentages of donorderived peripheral blood cells in lethally irradiated female recipient
mice receiving limiting numbers of FDG-positive or FDG-negative
BL1a or BL19 male transgenic bone marrow cells are indicated by
vertical bars for each transplanted animal. Percentage repopulation
was determined at 4 months post-transplantation by PCR analysis for
the Ly-6E.1-lacZ transgene marker.
544
C. Miles and others
Fig. 6. Whole and specific organ X-gal staining of BL
embryos. Whole embryos at (A) 8.5 dpc, (B) 10.5 dpc and
(C) 11.5 dpc were stained with X-gal for visualization of Ly6E.1-lacZ expression. Embryos were of the BL1b transgenic
line. Arrow indicates intra-embryonic staining. (D) Dissected
AGM region from 11.5-12 dpc BL1a transgenic embryo. The
pro/mesonephros is the most lateral vertically oriented tissue,
with the genital ridge positioned slightly over the
pro/mesonephros. The dorsal aorta runs vertically along the
midline between these tissues. As indicated by the arrow, Xgal-positive cells are located at the anterior tips of the
mesonephroi. (E) Yolk sac from an 11 dpc BL1b transgenic
embryo. Blood vessels of the yolk sac appear yellow and
connecting yolk sac tissue appears blue because of the
background. No X-gal-positive cells can be observed in the
circulating blood, blood vessel walls or other cells of the
yolk sac.
expression was found very frequently in the XN lines in
regions such as the limb buds, liver, brain, etc. Thus, the high
level tissue-specific embryonic expression pattern of the Ly6E.1-lacZ transgene appears to require the presence of the 3′most gene flanking sequences.
the known in vivo expression pattern of endogenous Ly6E.1/A.2. We found only rare ectopic expression in the BL
lines as compared to embryos and adults of all the XN lines.
While the BL transgenics show a reproducible expression
DISCUSSION
The results of our transgenic mouse studies with the genetic
elements encoding the HSC marker Sca-1 have demonstrated
that a 14 kb Ly-6E.1 genomic fragment can direct high level,
tissue-specific expression of the lacZ marker gene in adult
mice. We have shown here through the use of the XN deletion
transgene construct the importance of distal 3′ sequences for
in vivo expression. While previous data have indicated that 5′
Ly-6E.1 sequences were insufficient to direct reporter gene
expression in transgenic mice (Dr A. Bothwell, personal communication), we have been able to reproducibly detect lacZ
RNA- and β-galactosidase-positive cells in all BLtransgenic
mice carrying 11 kb of 3′ Ly-6E.1 sequence. Transgene
expression levels are high and average at 3.2% per Ly-6E.1
lacZ copy, as compared to endogenous gene transcription.
However, this value is most likely an underestimate, since the
probe used to detect endogenous Ly-6E.1/A.2 expression crosshybridizes with transcripts from other Ly-6 family members.
This is further supported by the high levels of β-galactosidase
activity found in the BL transgenic mice (efficient X-gal and
FDG staining are seen within 1 hour). Also, the levels of lacZ
RNA in the four BL transgenic lines appear to closely correspond to transgene copy number. While we have not produced
enough Ly-6E.1 lacZ transgenic lines to draw a strong conclusion, preliminary data from additional transgenic lines with the
14 kb Ly-6E.1 expression cassette containing other gene inserts
(unpublished observations) support copy number dependency.
The Ly-6E.1 lacZ expression pattern observed in the kidney,
thymus, spleen, lymph nodes, bone marrow and certain
hematopoietic lineages of BL transgenic mice corresponds to
Fig. 7. X-gal-stained transverse-sections from 11.5 dpc BL
transgenic embryos. Sections through the caudal region of BL1b
embryos stained with X-gal and counterstained with eosin.
(A) Transverse section through the region containing the aorta,
mesonephros and genital ridge. (B) Higher magnification of the
mesonephros. (C) Transverse section through the hindgut region.
(D) Transverse section through the posterior hindgut and tail region.
da, dorsal aorta; hg, hindgut; l, liver; m, mesonephros; mt,
mesonephric tubule; tm, tail mesoderm.
Ly-6E.1 (Sca-1) transgene in mouse hematopoietic stem cells
545
Fig. 8. X-gal-stained late gestation BL embryo whole tissues
and sections. (A) Sagittal section through 13.5 dpc BL1b
embryo stained with X-gal and counterstained with eosin.
(B) Transverse section through a 13.5 dpc BL1b embryo
stained with X-gal and counterstained with eosin, showing
the degenerating mesonephros and Mullerian duct. (C) Whole
urogenital system of a 15.5 dpc BL1b male transgenic
embryo stained with X-gal. Staining can be seen in the
epididymus and faintly in the kidney. (D) Transverse section
of the kidney from a 18 dpc BL1b transgenic embryo stained
with X-gal. Staining of the cortical tubules can be seen. ct,
cortical tubules; e, epididymus; g, gonad; k, kidney; m,
mesonephros; md, Mullerian duct; mt, mesonephric tubule; s,
stomach; t, testis.
pattern, all the regulatory elements directing tissue specificity
may not be located in the downstream fragment, since some of
the XN transgenic lines express the transgene with partial
specificity. For example, the XN37, XN23 and the XN229 lines
express the transgene in T lymphocytes, the mesonephros and
the tail, respectively. Thus, the 3′ Ly-6E.1 genomic sequences
clearly play an important role in directing high-level expression
and may confer integration site independence. In combination,
the integration site-independent expression and the copy
number-dependent expression suggest that the region 9 kb
downstream of the Ly-6E.1 gene may contain a locus control
region (LCR, Dillon and Grosveld, 1993).
This downstream region of the Ly-6E.1 gene has previously
been shown to contain several transcription factor binding
consensus sequences (Sinclair et al., 1996). Of potential importance is an ISRE consensus sequence (AGAACAGAAACC),
which is located within the strong DNase I hypersensitive site
at +8.7. The 1 kb region surrounding this consensus sequence
is highly homologous (80%) to an upstream region (−2.3 to
−1.6) of Ly-6E.1, which contains an incomplete IRSE (Khan
et al., 1990). The 3′ ISRE, along with other transcription factor
motifs, may function to increase expression in vivo, although
all other ISREs previously described are upstream of gene
sequences (Porter et al., 1988; Reid et al., 1989). The identification of the precise Ly-6E.1 gene regulatory elements that
specify copy number-dependent and integration site-independent expression in the different tissues and during different
developmental stages awaits more detailed deletion and
mutation analysis.
Of greater interest to our studies is the demonstration that
the 14 kb Ly-6E.1 genomic sequence can direct heterologous
gene expression in HSCs of the adult bone marrow. At present,
the only method to clearly demonstrate transgene expression
in HSCs is by FACS sorting and transplantation into lethally
irradiated recipient mice for long-term, multilineage
hematopoietic repopulation. For these purposes, the use of the
lacZ gene has been problematic, as others have reported high
levels of endogenous β-galactosidase activity in hematopoietic
cells with the widely used substrates (Hendriks et al., 1994).
However, in the context of the 14 kb Ly-6E.1 expression
cassette, X-gal and FDG substrates provide the necessary sensitivity in hematopoietic cells, well above background staining,
for the enrichment of functional lacZ-expressing HSCs from
the bone marrow. The enrichment is approximately 100-fold
and is the expected degree of enrichment, as found with the
Sca-1 antibody. Thus, we have shown, for the first time, the
expression of the lacZ gene in HSCs of transgenic mice, and
that FDG-FACS can be performed on primary cells without
compromising their in vivo function.
As revealed by FACS analysis, β-galactosidase is expressed
in lymphoid, myeloid and hematopoietic progenitor/stem cells.
Each of these lineages, particularly the T lympoid lineage, is
known to contain Sca-1-positive cells. However, double
staining experiments reveal that there is an incomplete overlap
in Sca-1 and FDG staining. This could be expected since the
allele-specific pattern of the Ly-6A.2 allele is more widespread
than Ly-6E.1, and we have used an Ly-6E.1 gene (from the
Balb/c strain) in (CBA×C57Bl/6)F1 mice, which carry both
alleles. These allelic differences are even more complex in F1
hybrid mice, where the expression has been found to be distinct
from either parent (Codias et al., 1989; Spangrude and Brooks,
1993). Preliminary double staining experiments using allelespecific antibodies and the FDG substrate suggest that the Ly6E.1 lacZ transgene expression pattern is complex. In addition,
we have found a small percentage of Sca-1-negative cells with
β-galactosidase activity. While β-galactosidase is a very stable
cytoplasmic protein, Sca-1 is a GPI-linked cell-surface glycoprotein requiring complex post-translation modifications,
transport and surface turnover. In Drosophila larva, such differences between β-galactosidase and endogenous protein
expression have been exploited in the study of segmentation
(Lawrence et al., 1987). In Ly-6E.1 lacZ mice, such differences
may be useful for studies of hematopoietic cell differentiation
and migration.
The reproducible, high-level caudal region expression
pattern in the hindgut, tail and pro/mesonephros of BL
embryos as compared to XN embryos strongly supports a role
for the 3′ sequences of the Ly-6E.1 gene in development. The
pro/mesonephric localization of the Ly-6E.1-lacZ expression is
most interesting with respect to the developmental origins of
546
C. Miles and others
the mammalian hematopoietic system (reviewed in Dzierzak
and Medvinsky, 1995). In non-mammalian vertebrates it has
been found that during development the pronephros serves as
an intra-embryonic site of hematopoiesis. By embryo grafting
experiments, the amphibian dorsal lateral plate, which gives
rise to the pronephros, is the dominant source of the adult
hematopoietic system rather than the ventral blood islands,
which are analogous to the mammalian yolk sac (Turpen et al.,
1981). Our previous findings of adult HSC activity in the AGM
region beginning at day 10.5 pc (Medvinsky et al., 1993;
Müller et al., 1994) and the X-gal staining of Ly-6E.1-lacZ
transgenic embryos described here, also beginning at day 10.5,
suggest that the pro/mesonephros may be the analogous developmental site for mammalian HSCs. Thus, the highly-specific
and regulated expression pattern of the Ly-6E.1-lacZ transgene
in adult HSCs, diverse hematopoietic cell lineages and the
pro/mesonephros of the developing embryo poses many interesting questions for further study on the origins and manipulation of definitive HSCs.
The authors thank H. Tidcombe for staining and sectioning Ly6E.1-lacZ embryos, A. Holmes for technical assistance, C. Atkins for
cell sorting, V. Wilson for embryonic anatomy expertise, D. Meijer
for the lacZ plasmid and A. Mullard and staff for animal care. Special
thanks to F. Grosveld, S. Phillipsen and T. Enver for critical comments
on the manuscript. This work was funded by the Medical Research
Council, UK and a Leukemia Society of America Scholar award to
E.D.
REFERENCES
Abramson, S., Miller, R. G. and Phillips, R. A. (1977). The identification in
adult marrow of pluripotent and restricted stem cells of the myeloid and
lymphoid systems. J. Exp. Med. 145, 1567-1579.
Aihara, Y., Bühring, H. J., Aihara, M. and Klein, J. (1986). An attempt to
produce ‘pre-T’ cell hybridomas and to identify their antigens. Eur. J.
Immunology 16, 1391-1399.
Capel, B., Hawley, R., Covarrubias, L., Hawley, T. and Mintz, B. (1989).
Clonal contributions of small numbers of retrovirally marked hematopoietic
stem cells engrafted in unirradiated neonatal W/Wv mice. Proc. Natl. Acad.
Sci. USA 86,4564-4568.
Codias, E. K., Cray, C., Baler, R. D., Levy, R. B. and Malek, T. R. (1989).
Expression of Ly-6A/E alloantigens in thymocyte and T-lymphocyte subsets:
variability related to the Ly-6a and Ly-6b haplotypes. Immunogenetics 29, 98107.
Cray, C., Keane, R. W., Malek, T. R. and Levy, R. B. (1990). Regulation and
selective-expresson of Ly-6A/E, a lymphocyte activation molecule, in the
central nervous system. Mol. Brain Res. 8, 9-15.
Dillon, N. and Grosveld, F. (1993). Transcriptional regulation of multigene
loci: Multilevel control. Trends Genet. 9, 134-137.
Dumont, F. J. and Boltz, R. C. (1987). The augmentation of surface Ly-6A/E
molecules in activated T cells is mediated by endogenous interferon-γ. J.
Immunol. 139, 4088-4095.
Dzierzak, E., Daly, B., Fraser, P., Larsson, L. and Müller, A. (1993). Thy-1
tk transgenic mice with a conditional lymphocyte deficiency. Internat.
Immunol. 5, 975-984.
Dzierzak, E., Müller, A., Sinclair, A., Miles, C., Gillett, N., Daly, B.,
Sanchez, M.-J. and Medvinsky, A. (1995). Hematopoietic stem cell
development in the mouse embryo. In Proceedings of the Ninth Conference
on Hemoglobin Switching (ed. G. Stamatoyannopoulos), pp. 109-121.
Incercept.
Dzierzak, E. and Medvinsky, A. (1995). Mouse embryonic hematopoiesis.
Trends Genet. 11, 359-366.
Fraser, P., Hurst, J., Collis, P. and Grosveld, F. (1990). DNaseI hypersensitive
sites 1, 2, and 3 of the human β-globin dominant control region directs
position-independent expression. Nucleic Acids Res. 18, 3503-3508.
Gokkel, E., Grossman, Z., Ramot, B., Yarden, Y., Rechavi, G. and Givol, D.
(1992). Structural organization of the murine c-kit proto-oncogene.
Oncogene 7, 1423-1429.
Grosveld, F. G., van Assendelft, G. B., Greaves, D. R. and Kollias, G. (1987).
Position-independent, high level expression of the human β-globin gene in
transgenic mice. Cell 51, 975-985.
Hendriks, P. J., Martens, A. C. M., Visser, J. W. M. and Hagenbeek, A.
(1994). Differential suppressionof background mammalian lysosomal βgalactosidase increases the detection sensitivity of LacZ marked leukemic
cells. Anal. Biochem. 222, 456-460.
Huang, H. and Auerbach, R. (1993). Identification and characterization of
hematopoietic stem cells from the yolk sac of the early mouse embryo. Proc.
Natl. Acad. Sci. USA 90, 10110-10114.
Ikuta, K., Kina, T., MacNeil, I., Uchida, N., Peault, B., Chien, Y. and
Weissman, I. L. (1990). A developmental switch in thymic lymphocyte
maturation potential occurs at the level of hematopoietic stem cells. Cell 62,
863-874.
Ikuta, K. and Weissman, I. L. (1992). Evidence that hematopoietic stem cellsexpress mouse c-kit but do not depend on steel factor for their generation.
Proc. Natl. Acad. Sci. USA 89, 1502-1506.
Jordan, C. T., McKearn, J. P. and Lemischka, I. R. (1990). Cellular and
developmental properties of fetal hematopoietic stem cell. Cell 61, 953-963.
Kahn, K. D., Lindwall, G., Maher, S. E. and Bothwell, A. L. M. (1990).
Characterization of promoter elements of an interferon-inducible Ly-6E/A
differentiation antigen which is expressed on activated T cells and
hematopoietic stem cells. Mol. Cell Biol. 10, 5150-5159.
Kamiura, S., Nolan, C. M. and Meruelo, D. (1992). Long-range physical map
of the Ly-6 complex: Mapping the Ly-6 multigene family by field-inversion
and two-dimensional gel electrophoresis. Genomics 12, 89.
Kaufman, M. H. (1992). In The Atlas of Mouse Development, pp. 465-468.
Academic Press: London, UK.
Kimura, S., Tada, N., Liu-Lam, Y. and Hammerling, U. (1984). Studies of
the mouse Ly-6 alloantigen system: II. Complexities of the Ly-6 region.
Immunogenetics 20, 47-56.
Krasnow, M. A., Cumberledge, S., Manning, G., Herzenberg, L. A. and
Nolan, G. R. (1991). Whole animal sorting of Drosophila embryos. Science
251, 81-85.
Krause, D. S., Ito, T., Fackler, M. J., Smith, O. M., Collector, M. I., Sharkis,
S. J. and May, W. S. (1994). Characterization of murine CD34, a marker for
hematopoietic progenitor and stem cells. Blood 84, 691-701.
Lawrence, P. A., Johnston, P., MacDonald, P. and Struhl, G. (1987). Borders
of parasegments in Drosophila embryos are delimited by the fushi tarazu and
even skipped genes. Nature 328, 440-442.
LeClair, K. P., Palfree, R. G. E., Flood, P. M., Hammerling, U. and
Bothwell, A. (1986). Isolation of a murine Ly-6 cDNA reveals a new
multigene family. EMBO J. 5, 3227-3234.
May, G. and Enver, T. (1995). Targeting gene expression to haemopoietic stem
cells: a chromatin-dependent upstream element mediates cell type-specific
expression of the stem cell antigen CD34. EMBO J. 14, 564-574.
McGrew, J. T. and Rock, K. L. (1991). Isolation, expression and sequence of
the TAP/Ly-6A. 2 chromosomal gene. J. Immunol. 146,3663-3638.
Medvinsky, A. L., Samoylina, N. L., Müller, A. M. and Dzierzak, E. A.
(1993). An early pre-liver intraembryonic source of CFU-S in the developing
mouse. Nature 364, 64-67.
Michlem, H. S., Ford, C. E., Evans, E. P. and Gray, J. (1966).
Interrelationships of myeloid and lymphoid cell studies with chromosomemarked cells transplanted into lethally irradiated mice. Proc. R. Soc. Lond.
165, 78.
Moore, M. A. S. and Metcalf, D. (1970). Ontogeny of the haematopoietic
system: yolk sac origin of in vivo and in vitro colony forming cells in the
developing mouse embryo. Br. J. Haematol. 18, 279-296.
Müller, A. M., Medvinsky, A., Strouboulis, J., Grosveld, R. and Dzierzak,
E. (1994). Development of hematopoietic stem cell activity in the mouse
embryo. Immunity 1, 291-301.
Müller-Sieburg, C. E., Whitlock, C. A. and Weissman, I. L. (1986). Isolation
of two early B lymphocyte progenitors from mouse marrow: A committed
pre-pre-B cell and a clonogenic Thy-1lo hematopoietic stem cell. Cell 44,
653-662.
Nolan, G. P., Fiering, S., Nicolas, J. -F. and Herzenberg, L. A. (1988).
Fluorescence-activated cell analysis and sorting of viable mammalian cell
based on β-d-galactosidase activity after transduction of Escherichia coli
lacZ. Proc. Natl. Acad. Sci. USA 85, 2603-2607.
Palfree, R. G. E. and Hammeling, U. (1986). Biochemical characterization of
the murine activated lymphocyte alloantigen Ly-6E. 1 controlled by the Ly6locus. J. Immunol. 136, 594-600.
Ly-6E.1 (Sca-1) transgene in mouse hematopoietic stem cells
Ploemacher, R. E. and Brons, R. H. C. (1989). Separation of CFU-S from
primitive cells responsible for reconstitution of the bone marrow hemopoietic
stem cell compartment following irradiation: Evidence for a pre-CFU-S cell.
Exp. Hematol. 17, 263-266.
Porter, A. C. G., Chernajovski, Y., Dale, T. C., Gilbert, C. S., Stark, G. R.
and Kerr, I. M. (1988). Interferon response element of the human gene 6-16.
EMBO J. 7, 85-92.
Reid, L. E., Basnett, A. H., Gilbert, C. S., Porter, A. C. G., Gewert, D. R.,
Stark, G. R. and Kerr, I. M. (1989). A single DNA response element can
confer inducibility by both α and β interferons. Proc. Natl. Acad. Sci. USA
86, 840-844.
Reiser, H., Coligan, J., Palmer, E., Benacerraf, B. and Rock, K. L. (1988).
Cloning and expression of a cDNA for the T-cell-activating protein TAP.
Proc. Natl. Acad. Sci USA 85, 2255-2259.
Rock, K. L., Yeh, E. T. H., Haber, S. I., Reiser, H. and Benacerraf, B. (1986).
TAP, a novel T cell-activating protein involved in the stimulation of MHCrestricted T lymphocytes. J. Exp. Med. 163, 315-333.
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). In Molecular Cloning: A
Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, NY.
Sinclair, A. M. and Dzierzak E. A. (1993). Cloning of the complete Ly-6E. 1
gene and identification of DNaseI hypersensitive sites corresponding to
expression in hematopoietic cells. Blood 82, 3052-3062.
Sinclair, A., Daly, B. and Dzierzak, E. (1996). The Ly-6E. 1 (Sca-1). gene
requires a 3′ chromatin dependent region for high level γ-interferon induced
hematopoietic cell expression. Blood 87, 2750-2761.
547
Spangrude, G. J., Aihara, Y., Weissman, I. L. and Klein, J. (1988a). The
stem cell antigens Sca-1 and Sca-2 subdivide thymic and peripheral T
lymphocytes into unique subsets. J. Immunol. 141, 3697-3707.
Spangrude, G. J. and Brooks, D. M. (1993). Mouse strain variability in the
expression of the hematopoietic stem cell antigen Ly-6A/E by bone marrow
cells. Blood 82, 3327-3332.
Spangrude, G. J., Heimfeld, S. and Weissman, I. L. (1988b). Purification and
characterization of mouse hematopoietic stem cells. Science 241, 58-62.
Spanopoulou, E., Giguere, V. and Grosveld, G. (1988). Transcriptional unit
of the murine Thy-1 gene: Different distribution of transcriptional initiation
sites in brain. Mol. Cell Biol 8, 3847-3856.
Su, B. and Bothwell, A. L. M. (1989). Biosynthesis of a phosphatidylinositolglycan-linked membrane protein: Signals for posttranslational processing of
the Ly-6E antigen. Mol. Cell Biol. 9, 3369-3376.
Turpen, J. B., Knudson, M. and Hoefen, P. B. (1981). The early ontogeny of
hematopoietic cells studied by grafting cytogenetically labeled tissue
anlagen: localization of a prospective stem cell compartment. Dev. Biol. 85,
99-112.
van de Rijn, M., Heimfeld, S., Spangrude, G. J. and Weissman, I. L. (1989).
Mouse hematopoietic stem-cell antigen Sca-1 is a member of the Ly-6
antigen family. Proc. Natl. Acad. Sci. USA 86, 4634-4938.
Visser, J. W. M., Bauman, J. G. J., Mulder, A. H., Eliason, J. F. and de
Leeuw, A. M. (1984). Isolation of murine pluripotent hemopoietic stem
cells. J. Exp. Med. 59, 1579-1590.
(Accepted 18 October 1996)