* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download English - Illumina
Nutriepigenomics wikipedia , lookup
Genetic code wikipedia , lookup
Saethre–Chotzen syndrome wikipedia , lookup
Gene therapy wikipedia , lookup
Pharmacogenomics wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Polymorphism (biology) wikipedia , lookup
Genetic drift wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Cell-free fetal DNA wikipedia , lookup
Artificial gene synthesis wikipedia , lookup
Skewed X-inactivation wikipedia , lookup
Gene expression programming wikipedia , lookup
Quantitative trait locus wikipedia , lookup
Y chromosome wikipedia , lookup
Heritability of IQ wikipedia , lookup
Fetal origins hypothesis wikipedia , lookup
Behavioural genetics wikipedia , lookup
Human genetic variation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Neocentromere wikipedia , lookup
Population genetics wikipedia , lookup
Genetic engineering wikipedia , lookup
X-inactivation wikipedia , lookup
Genetic testing wikipedia , lookup
Public health genomics wikipedia , lookup
Genetic engineering in science fiction wikipedia , lookup
Microevolution wikipedia , lookup
Preimplantation genetic diagnosis wikipedia , lookup
Medical genetics wikipedia , lookup
A Patient Counseling Guide for Reproductive Genetics Educational content provided by Table of contents Genetics overview 3 Chromosome conditions 12 Single gene inheritance 37 IVF and embryo development 44 Preimplantation genetic screening (PGS) 51 Preimplantation genetic diagnosis (PGD) 54 Prenatal screening and diagnostic options 57 This Counseling Guide is intended to offer health care providers basic information on genetic counseling and is for general educational purposes only. The guide is not intended to be used to substitute for the exercise of the health care provider’s professional judgment in providing professional services. 2 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Genetics overview 3 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Cells, chromosomes, and DNA Human Nucleus DNA Base pairs Cell A T G C Chromosome US National Library of Medicine. Help Me Understand Genetics: Cells and DNA. https://ghr.nlm.nih.gov/primer/basics.pdf. Published May 30, 2016. Accessed June 6, 2016. 4 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Cells, chromosomes, and DNA ■ The human body is made up of trillions of cells. ■ Inside the nucleus of cells, are structures called chromosomes. Chromosomes are made up of genes. ■ Genes are individual instructions that tell the body how to develop and function. ■ The four bases of DNA (A,T,G,C) are the building blocks of genes. The order of these bases determines how genes instruct our bodies. Human Nucleus DNA Base pairs US National Library of Medicine. Help Me Understand Genetics: Cells and DNA. https://ghr.nlm.nih.gov/primer/basics.pdf. Published May 30, 2016. Accessed June 6, 2016. Cell A T G C Chromosome 5 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening 5 and diagnostic options Human chromosomes From Mother From Father 1 2 3 6 7 8 13 14 15 9 4 5 10 11 12 16 17 18 or 19 20 21 22 Autosomes X X Female X Y Male 23 Sex Chromosomes Image adapted from Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. 6 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Human chromosomes ■Humans typically have 23 pairs of chromosomes (for a total of 46 chromosomes). –Half of the chromosomes come from the mother and the other half from the father. ■The first 22 pairs are the same whether you are male or female. These are called autosomes. ■The last pair of chromosomes are called sex chromosomes. Females typically have two copies of the X chromosome and males typically have one X and one Y chromosome. From Mother From Father 1 2 3 6 7 8 13 14 15 9 4 5 10 11 12 16 17 18 or 19 Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. 20 21 22 Autosomes X X Female X Y Male 23 Sex Chromosomes 7 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening 7 and diagnostic options Cell division in primary germ cells (meiosis) Primary germ cell Chromosomes copied 1st Meiosis 2nd Meiosis Gametes (sperm/egg) 8 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Cell division in primary germ cells (meiosis) ■The human gametes are sperm and eggs. ■Each gamete typically has only one set of chromosomes (23 total). ■At fertilization/conception, the father’s sperm joins with the mother’s egg to form a zygote, which becomes an embryo (with 46 chromosomes). Primary germ cell Chromosomes copied 1st Meiosis 2nd Meiosis Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Gametes (sperm/egg) 9 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening 9 and diagnostic options Nondisjunction – an error in cell division Nondisjunction Typical meiosis Eggs Sperm Fertilization Trisomy Monosomy 10 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Nondisjunction – an error in cell division ■Aneuploidy: an incorrect number of chromosomes –Trisomy: three copies of a specific chromosome –Monosomy: one copy of a specific chromosome ■Aneuploidy can lead to: –Failure of an embryo to implant in the uterus –Pregnancy loss/miscarriage –Birth of a baby with a chromosome condition (eg., trisomy 21, which is also known as Down syndrome) Nondisjunction Typical meiosis Eggs Sperm Fertilization Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Trisomy Monosomy 11 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening11 and diagnostic options Chromosome conditions 12 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Trisomy 21 (Down syndrome) 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 X X 22 13 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Trisomy 21 (Down syndrome) ■Trisomy 21 is the most common chromosome condition in live births. ■Trisomy 21 occurs in approximately 1 in every 660 live births. ■Common characteristics of trisomy 21: –Intellectual disability –Heart problems –Low or poor muscle tone –Characteristic facial features Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 22 X X 14 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening14 and diagnostic options Trisomy 18 (Edwards syndrome) 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 X Y 22 15 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Trisomy 18 (Edwards syndrome) ■Trisomy 18 occurs in approximately 1 in every 3,333 live births. ■Severe chromosome condition; life expectancy usually less than 1 year. ■Common characteristics of trisomy 18: – Intrauterine growth retardation – Unusual positioning of the hands and/or feet – Severe developmental and intellectual disabilities Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 22 X Y 16 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening16 and diagnostic options Trisomy 13 (Patau syndrome) 1 2 3 6 7 8 13 14 15 19 9 20 21 4 5 10 11 12 16 17 18 22 X X 17 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Trisomy 13 (Patau syndrome) ■Trisomy 13 occurs in approximately 1 in every 5,000 live births. ■Severe chromosome condition; life expectancy usually less than 1 year. ■Common characteristics of trisomy 13: – Heart, brain, kidney abnormalities – Incomplete fusion of the lip and/or palate (clefting) – Severe developmental and intellectual disabilities 1 2 3 6 7 8 13 14 15 19 Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 9 20 4 5 10 11 12 16 17 18 21 22 X X 18 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening18 and diagnostic options Monosomy X (Turner syndrome) 1 2 3 6 7 8 13 14 15 19 9 20 21 4 5 10 11 12 16 17 18 22 X 19 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Monosomy X (Turner syndrome) ■Monosomy X occurs in 1-1.5% of pregnancies. However, most (~99%) of these pregnancies do not survive to term. –Monosomy X occurs in approximately 1 in every 2,000 female live births ■Common characteristics of monosomy X: – Heart defects – Shorter than average height – Delayed puberty – Infertility 1 2 3 6 7 8 13 14 15 Hook EB, Warburton D. Hum Genet. 2014;133(4):417-424. Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 9 20 4 5 10 11 12 16 17 18 21 22 X 20 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening20 and diagnostic options 47,XXX (Triple X syndrome) 1 2 3 6 7 8 13 14 15 19 9 20 21 4 5 10 11 12 16 17 18 22 X X X 21 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options 47,XXX (Triple X syndrome) ■47,XXX occurs in approximately 1 in every 1,000 female live births. ■Many females with 47,XXX do not have any visible characteristics. ■Variable characteristics of 47,XXX: – Taller than average height – Learning difficulties, speech, and language delays – Delayed development of motor skills – Behavioral and emotional difficulties 1 2 3 6 7 8 13 14 15 Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 19 9 20 4 5 10 11 12 16 17 18 21 22 X X X 22 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening22 and diagnostic options 47,XXY (Klinefelter syndrome) 1 2 3 6 7 8 13 14 15 19 20 9 21 22 4 5 10 11 12 16 17 18 X X Y 23 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options 47,XXY (Klinefelter syndrome) ■Klinefelter syndrome occurs in approximately 1 in every 500 male live births. ■Many males with 47,XXY do not have any visible characteristics. ■Variable characteristics of Klinefelter syndrome: – Speech and/or learning difficulties – Tall stature – Small testes – Infertility Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 22 X X Y 24 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening24 and diagnostic options 47,XYY (Jacobs syndrome) 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 X 22 Y Y 25 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options 47,XYY (Jacobs syndrome) ■47,XYY occurs in approximately 1 in every 840 male live births. ■Many males with 47,XYY do not have any visible characteristics. ■Variable characteristics of 47,XYY: – Delayed development of speech and language skills – Learning disabilities – Autism spectrum disorder Jones KL, Jones MC, del Campo M. Smith’s Recognizable Patterns of Human Malformation. 7th ed. Philadelphia: Elsevier Saunders; 2013. 1 2 3 6 7 8 13 14 15 19 20 9 21 4 5 10 11 12 16 17 18 22 X Y Y 26 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening26 and diagnostic options Chromosome deletions and microdeletions Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Normal Deletion Microdeletion Normal 27 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening27 and diagnostic options Chromosome deletions and microdeletions ■ Deletions and mircodeletions are caused by missing pieces of chromosome material. – Microdeletions are smaller than deletions and cannot be seen under a microscope. ■ Chromosome deletions and microdeletions may result in intellectual disability, developmental disabilities, and/or birth defects. Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Normal Telomere Telomere Deletion Telomere Normal Telomere Microdeletion Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. 28 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening28 and diagnostic options Chromosome duplications and microduplications Telomere Telomere Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Telomere Telomere Normal Duplication Microduplication Normal 29 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening29 and diagnostic options Chromosome duplications and microduplications ■ Duplications and mircoduplications are caused by extra pieces of chromosome material. – Microduplications are smaller than duplications and cannot be seen under a microscope. ■ Chromosome duplications and microduplications may result in intellectual disability, developmental disabilities, and/or birth defects. Telomere Normal Telomere p arm p arm p arm p arm Centromere Centromere Centromere Centromere q arm q arm q arm q arm Telomere Telomere Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Telomere Duplication Telomere Normal Telomere Microduplication 30 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening30 and diagnostic options Chromosome translocation: Reciprocal Balanced translocation carrier parent Non-carrier parent Gamete from non-carrier parent Possible gametes from carrier parent Fertilization Possible zygotes Non-carrier Balanced translocation carrier Partial trisomy + partial monosomy Partial trisomy + partial monosomy 31 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Chromosome translocation: Reciprocal ■A reciprocal translocation is the result of two chromosomes exchanging segments. ■Reciprocal translocations are present in approximately 1 in 500 individuals. ■Most individuals who carry a reciprocal translocation do not have any visible characteristics. ■Carriers of a reciprocal translocation may be at risk for: – Infertility – Recurrent pregnancy loss Balanced translocation carrier parent – Babies with birth defects and/or intellectual disabilities Non-carrier parent Gamete from non-carrier parent Possible gametes from carrier parent Fertilization Possible zygotes Non-carrier Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Balanced translocation carrier Partial trisomy + partial monosomy Partial trisomy + partial monosomy 32 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening32 and diagnostic options Chromosome translocation: Robertsonian Balanced translocation carrier parent Non-carrier parent Gamete from non-carrier parent Possible gametes from carrier parent Fertilization Possible zygotes Non-carrier Translocation carrier Trisomy Monosomy Trisomy Monosomy 33 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Chromosome translocation: Robertsonian ■A Robertsonian translocation happens when two certain chromosomes (13, 14, 15, 21, 22) join together. ■Robertsonian translocations are present in approximately 1 in every 1,000 individuals. ■Most individuals who carry a Robertsonian translocation do not have any visible characteristics. ■Carriers of a Robertsonian translocation may be at risk for: – Infertility – Recurrent pregnancy loss Balanced translocation carrier parent – Babies with birth defects and/or intellectual disabilities Non-carrier parent Gamete from non-carrier parent Possible gametes from carrier parent Fertilization Possible zygotes Gardner RJM, Sutherland GR, Schaffer LG. Chromosome Abnormalities and Genetic Counseling. 4th ed. New York, NY: Oxford University Press; 2012. Non-carrier Translocation carrier Trisomy Monosomy Trisomy Monosomy 34 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening34 and diagnostic options Mosaicism (an error in cell division causing cells with a genetic change) Fertilization Embryo Mosaic Somatic cell division (mitosis) Normal cells Cells with genetic change Adapted from: Campbell IM, Shaw CA, Stankiewicz P, Lupski JR. Somatic mosaicism: implications for disease and transmission genetics. Trends Genet. 2015;31(7):382-392. 35 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Mosaicism (an error in cell division causing cells with a genetic change) ■Mosaicism is the presence of two or more cell lines with different genetic make-ups. ■It is caused by an error during cell division (mitosis). ■The proportion of each cell line is variable. – The clinical impact of mosaicism on an individual varies depending on the number and type of cells affected. Fertilization Embryo Somatic cell division (mitosis) Mosaic Normal cells Cells with genetic change U.S. National Library of Medicine. Medical Encyclopedia: Mosaicism. https:// www.nlm.nih.gov/medlineplus/ency/article/001317.htm Updated May 3, 2016. Accessed June 3, 2016. 36 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening36 and diagnostic options Single gene inheritance 37 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Autosomal dominant inheritance Parents mutation normal Unaffected Affected Children Unaffected (50%) Affected (50%) 38 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Autosomal dominant inheritance ■With autosomal dominant inheritance, only one copy of a mutated gene is necessary for the condition to be present. ■An affected parent has the following reproductive risks per pregnancy: – 50% chance to have a fetus affected with the condition – 50% chance to have a fetus without the condition (unaffected) – Males and females are at equal risk Parents mutation normal Affected Unaffected Children US National Library of Medicine. Help Me Understand Genetics: Inheriting Genetic Conditions. https://ghr.nlm.nih.gov/primer/inheritance.pdf. Published June 6, 2016. Accessed June 7, 2016. Unaffected (50%) Affected (50%) 39 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening39 and diagnostic options Autosomal recessive inheritance Parents mutation mutation normal normal Carrier Carrier Children Unaffected non-carrier (25%) Carrier (50%) Affected (25%) 40 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Autosomal recessive inheritance ■With autosomal recessive inheritance, two copies of a mutated gene are necessary for the condition to be present. ■Individuals with only one copy of a mutated gene are called carriers and are typically unaffected. ■If both parents are carriers of the same condition, they have the following reproductive risks per pregnancy: – 25% chance to have a fetus affected with the condition – 50% chance to have a fetus who is a carrier of the condition – 25% chance to have a fetus without the condition and a non-carrier (unaffected noncarrier) – Males and females are at equal risk US National Library of Medicine. Help Me Understand Genetics: Inheriting Genetic Conditions. https://ghr.nlm.nih.gov/primer/inheritance.pdf. Published June 6, 2016. Accessed June 7, 2016. Parents mutation mutation normal normal Carrier Carrier Children Affected (25%) Carrier (50%) Unaffected non-carrier (25%) 41 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening41 and diagnostic options X-linked recessive inheritance Parents mutation X X Y X normal Carrier Unaffected Children X Y X Unaffected (25%) X X Unaffected non-carrier (25%) X X Carrier (25%) Y Affected (25%) 42 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options X-linked recessive inheritance ■X-linked inheritance involves a mutated gene that occurs on the X chromosome. ■Males who have a mutated gene on their X chromosome are affected with the condition. ■Females who have a mutated gene on one of their two X chromosomes are called carriers of the condition. – Female carriers are typically unaffected; however, some female carriers may display characteristics of the condition. ■Females who carry an X-linked recessive condition have the following reproductive risks per pregnancy: – 25% chance of having a son who is not affected with the condition – 25% chance of having a daughter who is not a carrier of the condition – 25% chance of having a daughter who is a carrier of the condition – 25% chance of having a son who is affected with the condition Parents mutation X X Y X normal Carrier Unaffected Children US National Library of Medicine. Your guide to understanding genetic conditions: What are the different ways in which a genetic condition can be inherited? https://ghr.nlm.nih.gov/primer/inheritance/inheritancepatterns. Published May 31, 2016. Accessed June 3, 2016. X Y X Unaffected (25%) X X X X Unaffected non-carrier (25%) Carrier (25%) Y Affected (25%) 43 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening43 and diagnostic options IVF and embryo development 44 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options In vitro fertilization (IVF) Uterus Ovary 1 3 Ovarian stimulation and egg retrieval Embryo transfer 2 Fertilization 45 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options In vitro fertilization (IVF) ■There are 3 main steps in an IVF cycle: 1. Ovarian stimulation and egg retrieval 2. Fertilization – sperm and egg are combined in the laboratory to form an embryo 3. Embryo transfer into the uterus or frozen for future use Uterus Ovary 1 3 Ovarian stimulation and egg retrieval Embryo transfer 2 Fertilization 46 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening46 and diagnostic options Percentage of embryos with a chromosome abnormality (aneuploidy) increases with maternal age % of Embryos With Aneuploidy 90 80 70 60 50 40 30 20 10 0 <35 35-37 38-40 41-42 >42 Maternal Age Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. 47 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Percentage of embryos with a chromosome abnormality (aneuploidy) increases with maternal age ■Aneuploid embryos can occur in women of all ages, but the risk increases with maternal age. ■Risks associated with an aneuploid embryo: – Implantation failure – Miscarriage – Babies born with birth defects/intellectual disabilities % of Embryos With Aneuploidy 90 80 70 60 50 40 30 20 10 0 <35 35-37 38-40 41-42 >42 Maternal Age Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. Scott RT Jr., et al. Fertil Steril. 2012;97(4):870-875. Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. 48 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening48 and diagnostic options Stages of embryo development 2-cell stage 8-cell stage (cleavage stage) Blastocyst (100+ cells) Inner cell mass Fertilization Day 2 Day 3 Outer layer (Trophectoderm) Day 5 49 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Stages of embryo development ■Following ■Cell egg retrieval, fertilization occurs in the laboratory. division occurs in the days following fertilization. ■By day 5, a blastocyst has formed with an outer layer and an inner cell mass. 2-cell stage 8-cell stage (cleavage stage) Inner cell mass Fertilization Day 2 Day 3 Blastocyst (100+ cells) Outer layer (Trophectoderm) Day 5 Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. 50 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening50 and diagnostic options Preimplantation genetic screening (PGS) 51 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Preimplantation genetic screening (PGS) Embryo unlikely to have aneuploidy Embryo likely to have aneuploidy 1 2 3 Embryo Biopsy Chromosome Screening Embryo Transfer 52 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Preimplantation genetic screening (PGS) ■PGS process: 1.Embryo Biopsy: One or more cells from each embryo is removed for screening 2.Chromosome Screening: Biopsied cells are screened for aneuploidy (too many or too few chromosomes) 3.Embryo Transfer: Embryos that are unlikely to have aneuploidy are available for transfer into the uterus or can be frozen for future use ■Potential benefits: – Increased implantation, pregnancy, and live birth rates – Decreased miscarriage rates – Selection of most viable embryo for single embryo transfer ■Limitations: Embryo unlikely to have aneuploidy – PGS only screens for aneuploidy – PGS does not screen for other conditions – PGS is not 100% accurate Forman EJ, et al. Fertil Steril. 2013;100(1):100-107. Scott RT Jr, et al. Fertil Steril. 2013;100(3):697- 703. Harton GL, et al. Fertil Steril. 2013;100(6):1695-1703. Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5):451-63. Embryo likely to have aneuploidy 1 2 3 Embryo Biopsy Chromosome Screening Embryo Transfer 53 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening53 and diagnostic options Preimplantation genetic diagnosis (PGD) 54 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Preimplantation genetic diagnosis (PGD) Embryo likely to be unaffected Embryo likely to be affected 1 2 3 Embryo Biopsy Genetic Testing Embryo Transfer 55 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Preimplantation genetic diagnosis (PGD) ■PGD process: 1.Embryo Biopsy: One or more cells from each embryo is removed for testing 2.Genetic Testing: Biopsied cells are tested for the inherited condition of interest 3.Embryo Transfer: Embryos that are likely to be unaffected with the condition are available for transfer to the uterus or can be frozen for future use ■Benefits: – Reduced risk of having a baby with an inherited condition ■Limitations: Embryo likely to be unaffected – PGD does not test for all possible conditions – PGD is not 100% accurate Embryo likely to be affected 1 2 3 Embryo Biopsy Genetic Testing Embryo Transfer Practice Committee of Society for Assisted Reproductive Technology; Practice Committee of American Society for Reproductive Medicine. Fertil Steril. 2008;90(5 Suppl):S136-143. Dahdouh EM, et al. J Obstet Gynaecol Can. 2015;37(5):451-463. 56 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening56 and diagnostic options Prenatal screening and diagnostic options 57 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Prenatal screening and diagnostic options* NO Patient counseled and elects prenatal testing YES Serum screening cfDNA screening 10 0/7 weeks - 22 6/7 weeks of pregnancy 10 weeks of pregnancy until delivery Is the result positive for a chromosome condition? Is the result positive for a chromosome condition? YES CVS/Amniocentesis CVS: 10-13 weeks of pregnancy Amniocentesis: typically 15-20 weeks of pregnancy YES Offer further counseling and diagnostic testing NO NO Patient and provider to discuss next steps Diagnostic Patient and provider to discuss next steps Patient and provider to discuss next steps ACOG Practice Bulletins—Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108–e122. ACOG Practice Bulletins—Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123–e137. 58 *Typical in USA but may differ by country. TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Prenatal screening and diagnostic options* ■Prenatal aneuploidy screening assesses a woman’s risk of carrying a fetus with certain chromosome conditions. –If a screening result is positive, further counseling and diagnostic testing should be offered ■Diagnostic testing can provide definitive information about: – Chromosome conditions – Certain genetic conditions Patient counseled and elects prenatal testing NO YES Serum screening cfDNA screening 10 0/7 weeks - 22 6/7 weeks of pregnancy 10 weeks of pregnancy until delivery Is the result positive for a chromosome condition? Is the result positive for a chromosome condition? YES ACOG Practice Bulletins—Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108–e122. ACOG Practice Bulletins—Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123–e137. NO Patient and provider to discuss next steps Diagnostic YES Genetics overview Chromosome conditions Offer further counseling and diagnostic testing NO Patient and provider to discuss next steps Patient and provider to discuss next steps 59 *Typical in USA but may differ by country. TOC CVS/Amniocentesis CVS: 10-13 weeks of pregnancy Amniocentesis: typically 15-20 weeks of pregnancy Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening59 and diagnostic options Cell-free DNA (cfDNA) screening Unaffected pregnancy Affected pregnancy CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Maternal cfDNA Fetal cfDNA 1 3 Analysis via counting 2 Sequencing of cfDNA Maternal blood draw and isolation of cfDNA 60 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Cell-free DNA (cfDNA) screening ■cfDNA screening process: 1.Blood is drawn from pregnant woman’s arm at 10 weeks of gestation or greater. cfDNA is isolated from the maternal blood in the laboratory. 2.cfDNA is sequenced to determine chromosome of origin 3.Sequenced cfDNA is counted to screen for chromosome conditions ■Benefits: – High detection rates for conditions tested – Very low false positive rates ● Fewer patients will need to have follow-up diagnostic testing compared with serum screening ■Limitations: – Not diagnostic (false positives and false negatives can occur) – In some instances, results may represent a maternal, rather than fetal, condition Unaffected pregnancy Affected pregnancy CCCTTAGCGCTTTAACGTACGTAAAACCCTT AACGTACGTAAAAACGGGGTCAAAGGTTCCC GACTTAAAATCGGAATCGATGCCCAAACTT AATCGATGCCCAAACGGGGTCAAAGTTCCC Maternal cfDNA Fetal cfDNA 1 Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3):249-266. ACOG Practice Bulletins—Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123–e137. Maternal blood draw and isolation of cfDNA 2 Sequencing of cfDNA 3 Analysis via counting 61 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening61 and diagnostic options Classification of cfDNA screening results Negative cfDNA results Positive cfDNA results True negatives True positives False positives and false negatives 62 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Classification of cfDNA screening results ■ True positive: a positive result, and the fetus has the condition ■ False positive: a positive result, but the fetus does not have the condition ■ True negative: a negative result, and the fetus does not have the condition ■False negative: a negative result, but the fetus has the condition Negative cfDNA results Positive cfDNA results True negatives True positives False positives and false negatives 63 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening63 and diagnostic options cfDNA: Negative results Negative cfDNA results Fetuses who have the condition (false negatives) 64 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options cfDNA: Negative results ■The chance that the fetus does not have the condition is greater than 99%. – False negatives do occur rarely ■The results apply only to the conditions tested. ■No additional screening tests for aneuploidy should be offered as this will increase the potential for a false positive result. Negative cfDNA results ACOG Practice Bulletins—Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123–e137. Gil MM, et al. Ultrasound Obstet Gynecol. 2015;45(3):249-266. Fetuses who have the condition (false negatives) 65 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening65 and diagnostic options cfDNA: Positive results No additional risk factors present Additional risk factor(s) present All positive cfDNA results Fetuses who have the condition 66 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options cfDNA: Positive results ■A positive result means the fetus has an increased chance of having a chromosome condition. ■The overall chance for the condition depends on a combination of the cfDNA result and any additional risk factors, including: – Maternal age – Ultrasound results – Serum screening results – Family history of chromosome condition ■Further counseling and diagnostic testing should be offered. No additional risk factors present Additional risk factor(s) present All positive cfDNA results Fetuses who have the condition ACOG Practice Bulletins—Screening for Fetal Aneuploidy. Obstet Gynecol. 2016;127:e123–e137. 67 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening67 and diagnostic options Diagnostic testing: chorionic villus sampling (CVS) Placenta Ultrasound probe Placenta Chorionic villi Ultrasound probe Chorionic villi Transcervical CVS Transabdominal CVS 68 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Diagnostic testing: chorionic villus sampling (CVS) ■Can determine, with as much certainty as is possible, whether a chromosome condition is present. – Additional genetic testing can be performed if indicated ■Involves testing of cells collected from the placenta. – Typically performed between 10 weeks and 13 weeks of pregnancy ■Has a risk of miscarriage. Placenta Ultrasound probe Placenta Ultrasound probe Chorionic villi Chorionic villi Transcervical CVS Transabdominal CVS ACOG Practice Bulletins—Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108–e122. 69 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening69 and diagnostic options Diagnostic testing: Amniocentesis Ultrasound probe Amniotic fluid Uterine wall 70 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Diagnostic testing: Amniocentesis ■Can determine, with as much certainty as is possible, whether a chromosome condition is present. – Additional genetic testing can be performed if indicated ■Involves testing of fetal cells collected from fluid surrounding the fetus (amniotic fluid). – Typically performed between 15 weeks and 20 weeks of pregnancy ■Has a risk of miscarriage. Ultrasound probe Amniotic fluid Uterine wall ACOG Practice Bulletins—Prenatal Diagnostic Testing for Genetic Disorders. Obstet Gynecol. 2016;127:e108–e122. 71 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening71 and diagnostic options Types of fetal chromosomal mosaicism Normal cells Chromosomally abnormal cells Generalized mosaicism Fetal mosaicism Confined placental mosaicism Kalousek DK. Pediatr Pathol. 1990;10(1-2):69-77. Kalousek DK. Pediatr Pathol. 1990;10(1-2):69-77. 72 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options Types of fetal chromosomal mosaicism ■Generalized mosaicism: presence of two or more chromosomally different cell lines in both the placenta and the fetus. – Can lead to a false positive or a false negative cfDNA result ■ Confined placental mosaicism: presence of two or more chromosomally different cell lines in the placenta, but not the fetus. – Can lead to a false positive cfDNA result ■ Fetal mosaicism: presence of two or more chromosomally different cell lines that are present in the fetus, but not the placenta. Normal cells Chromosomally abnormal cells – Can lead to a false negative cfDNA result Generalized mosaicism Confined placental mosaicism Grati FR. J Clin Med. 2014;3(3):809-837. Van Opstal D, et al. PLoS One. 2016;11(1):e0146794. Fetal mosaicism Kalousek DK. Pediatr Pathol. 1990;10(1-2):69-77. 73 TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening73 and diagnostic options This Counseling Guide is intended to offer health care providers basic information on genetic counseling and is for general educational purposes only. The guide is not intended to be used to substitute for the exercise of the health care provider’s professional judgment in providing professional services. © 2016 Illumina, Inc. All rights reserved. TOC Genetics overview Chromosome conditions Single gene inheritance IVF and embryo development Preimplantation genetic screening (PGS) Preimplantation genetic diagnosis (PGD) Prenatal screening and diagnostic options