Download Excludes Superantigen-Like Recognition Complementarity

This information is current as
of June 15, 2017.
TCR Reactivity in Human Nickel Allergy
Indicates Contacts with
Complementarity-Determining Region 3 but
Excludes Superantigen-Like Recognition
Jörg Vollmer, Hans Ulrich Weltzien and Corinne Moulon
J Immunol 1999; 163:2723-2731; ;
http://www.jimmunol.org/content/163/5/2723
Subscription
Permissions
Email Alerts
This article cites 62 articles, 23 of which you can access for free at:
http://www.jimmunol.org/content/163/5/2723.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 1999 by The American Association of
Immunologists All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
References
TCR Reactivity in Human Nickel Allergy Indicates Contacts
with Complementarity-Determining Region 3 but Excludes
Superantigen-Like Recognition1
Jörg Vollmer,2*† Hans Ulrich Weltzien,3* and Corinne Moulon4*
T
he heterodimeric TCR of most human and mouse T cells
consists of an a- and a b-chain (1, 2). The high diversity
of these Ag receptors is caused by the rearrangement of
distinct gene elements during T cell ontogeny (3). The complementarity-determining regions (CDRs)5 CDR1, CDR2, and CDR3,
located in the variable parts of the TCR a- and b-chains are essential for the recognition of antigenic determinants presented to T
lymphocytes (4, 5). These determinants are often recognized by
the TCR in the form of peptides bound to the Ag binding grooves
of MHC class I and class II molecules (6). Mutational analyses
have allowed the characterization of distinct interaction sites of the
TCR, not only for peptide Ags, but also for superantigens (7–10).
Crystallographic studies of human and mouse TCR in complex
with peptide or with superantigen and MHC molecules have confirmed the specific contacts made by the CDR1, CDR2, CDR3, and
also hypervariable (HV) 4 regions of the TCR a- or b-chains (11–
*Max-Planck-Institut für Immunbiologie, Freiburg, Germany; and †Fakultät für Biologie, Universität Freiburg, Freiburg, Germany
Received for publication December 22, 1998. Accepted for publication June 25, 1999.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
This work was supported by the Bundesministerium für Bildung, Wissenschaft,
Forschung und Technologie (Grant FKZ 07ALL10), and by the Klinische Forschergruppe “Pathomechanismen der allergischen Entzündung” (Grant FKZ 01GC9701/7).
2
Current address: CpG ImmunoPharmaceuticals GmbH, c/o Qiagen GmbH, Hilden,
Germany.
3
Address correspondence and reprint requests to Dr. H. U. Weltzien, Max-PlanckInstitut für Immunbiologie, Stübeweg 51, 79108 Freiburg, Germany. E-mail address:
[email protected]
4
Current address: Department of Immunology, IR Jouveinal/Parke Davis, Fresnes,
France.
5
Abbreviations used in this paper: CDR, complementarity-determining region; HV,
hypervariable; SEB, staphylococcal enterotoxin B; CTLL, CTL line; IHW, International Histocompatibility Workshop.
Copyright © 1999 by The American Association of Immunologists
14). In these complexes the CDR3s of both TCR chains are located
mainly over the central part of the peptide, whereas CDR1 and
CDR2 of the two chains may contact both peptide- and MHCdefined determinants. Activation of TCR by superantigens, in contrast, occurs mainly through the CDR1, CDR2, and HV4 regions of
the TCR b-chain (14).
During recent years, more and more reports have described TCR
with specificities for nonpeptidic Ags such as carbohydrates, lipids, or reactive chemicals known as haptens (15, 16). Another example of nonclassical Ags is represented by metals that can induce
contact hypersensitivities by activation of ab T cells in humans
(17, 18). Ni, as a typical representative for metal Ags, forms
mainly square-planar coordination complexes with side-chain or
main-chain atoms of amino acids in peptides or proteins (19, 20).
These coordination complexes are rather stable and, therefore, a
noncovalent interaction of Ni21 ions with MHC-embedded peptides was suggested as a hapten-like epitope for Ni-reactive T cells
(21, 22). However, the definitive structure of the antigenic determinants created by Ni21 ions remains unknown (23). One way to
address this question is to identify prominent TCR structures in
allergic individuals, assuming that they interact with dominant allergenic epitopes. In previous studies, we demonstrated an overrepresentation of VA11 and VB171 TCR chains in Ni-specific T
cell lines of strongly allergic patients (24). In addition, an amino
acid motif in the CDR1B region was found to be unique for the
TCRBV17 element and another in the CDR3B region to be conserved among the VB171 TCR of one donor, indicating their possible involvement in direct contacts to MHC-Ni epitopes.
In this study, we have investigated the importance of several
elements of these Ni-specific TCR and their contribution to the
recognition of Ni21 ions as representatives of metal Ags. Distinct
human Ni-reactive TCR were expressed on mouse hybridoma T
cells and functionally studied by TCR-mediated IL-2 release. To
0022-1767/99/$02.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Nickel is the most common inducer of contact sensitivity in humans. We previously found that overrepresentation of the TCRBV17
element in Ni-induced CD41 T cell lines of Ni-allergic patients relates to the severity of the disease. Amino acid sequences of these
b-chains suggested hypothetical contact points for Ni21 ions in complementarity-determining region (CDR) 1 and CDR3. To
specifically address the molecular requirements for Ni recognition by TCR, human TCR a- and b-chains of VB171 Ni-reactive
T cell clones were functionally expressed together with the human CD4 coreceptor in a mouse T cell hybridoma. Loss of CD4
revealed complete CD4 independence for one of the TCR studied. Putative TCR/Ni contact points were tested by pairing of TCR
chains from different clones, also with different specificity. TCRBV17 chains with different J regions, but similar CDR3 regions,
could be functionally exchanged. Larger differences in the CDR3 region were not tolerated. Specific combinations of a- and
b-chains were required, excluding a superantigen-like activation by Ni. Mutation of amino acids in CDR1 of TCRBV17 did not
affect Ag recognition, superantigen activation, or HLA restriction. In contrast, mutation of Arg95 or Asp96, conserved in many
CDR3B sequences of Ni-specific, VB171 TCR, abrogated Ni recognition. These results define specific amino acids in the CDR3B
region of a VB171 TCR to be crucial for human nickel recognition. CD4 independence implies a high affinity of such receptor types
for the Ni/MHC complex. This may point to a dominant role of T cells bearing such receptors in the pathology of contact
dermatitis. The Journal of Immunology, 1999, 163: 2723–2731.
2724
MUTATIONS OF NICKEL-SPECIFIC TCR
identify regions involved in Ag contact, a- and b-chains of different TCR with or without specificity for Ni were paired, and
individual amino acids within the CDR1B and CDR3B regions
were mutated.
mAb. Fluorescence was determined in a FACScan instrument (Becton
Dickinson, Mountain View, CA).
Materials and Methods
Total RNA of human T cell clones 4.13, ANi1.3, and ANi2.3 was extracted
from 5 3 106 cells using the TRI reagent RNA/DNA/protein isolation
reagent (Molecular Research Center, Cincinnati, OH). Transcription into
cDNA and analysis of TCR a- and b-chains were done as previously described (24). Nomenclature used for TCR gene segments is according to
Arden et al. (31), and CDR3 regions were defined according to Moss and
Bell (32). Functionally rearranged human TCR a and b genes were used
for construction of mouse-human hybrid TCR expression vectors (consisting of mouse constant regions and human rearranged variable regions) as
described in Vollmer et al. (28). Briefly, full-length rearranged TCRV regions of the TCR a- and b-chains of clones 4.13, ANi1.3, and ANi2.3 were
amplified from cDNA with the primers listed in Table I. Standard PCR
procedures were used, including 5 cycles of 30 s at 95°C, 40 s at 60°C, and
40 s at 72°C, followed by 30 cycles of 30 s at 94°C, 40 s at 57°C, and 40 s
at 72°C. The primer pair mut13AV3S1 sense and mut13AV3S1 antisense
(Table I) was used to eliminate an endogenous BamHI site in the
TCRAV3S1 element without altering the amino acid sequence. The final
PCR products were cloned into the pCR-Script vector (Stratagene, Heidelberg, Germany) and sequenced using the Big Dye sequencing kit (Applied
Biosystems, Foster City, CA) according to the manufacturer’s instructions.
Sequences were read on a 310 Genetic Analyzer (Applied Biosystems).
Primers used for sequencing were humanLVb17 (ATGAGCAAC
CAGGTGCTCTGC), humanVb17 (TTTCAGAAAGGAGATATAGCT),
humanVa1 (TTGCCCTGAGAGATGCCAGAG), humanVa3 (GGT
GAACAGTCAACAGGGAGA), and a universal and reverse primer (Pharmacia, Freiburg, Germany). The rearranged human TCRV regions were
then cloned into the TCR expression vectors pV2-15a (conferring resistance to mycophenolic acid) and pV2-15b (conferring resistance to G418)
(33), so that they contained the rearranged human variable parts joined to
the complete constant regions of the mouse TCR. Vectors were linearized
with ClaI and EcoRI, respectively, and used for transfection.
Ags, reagents, and media
Metal salts and other reagents were used at the following concentrations,
if not otherwise specified: NiSO4 3 6H2O, 1024 M; CuSO4 3 5H2O,
5 3 1025 M (both from Sigma, Deisenhofen, Germany); PHA, 1 mg/
ml (Murex, Dartford, U.K.); staphylococcal enterotoxin B (SEB), 20 ng/
ml (Serva, Heidelberg, Germany); tetanus toxoid peptide TT830-843
(QYIKANSKFIGITE), 5 mg/ml; Con A-induced rat spleen supernatant
(10%) served as source of IL-2 to maintain CTL line (CTLL) cells. Growth
medium for T cell hybridomas (RPMI-FCS) contained RPMI 1640 supplemented with 2 mM L-glutamine, 100 mg/ml kanamycin (all from Life
Technologies/BRL, Eggenstein, Germany), 5 3 1025 M 2-ME (Roth,
Karlsruhe, Germany), and 10% heat-inactivated FCS. Culture of human T
cell clones was described previously (25).
Cell lines and T cell clones
Proliferation assay
Mutations of CDR1B and CDR3B regions
The T cell clone 4.13 (4 3 104 cells) was cocultured in triplicate with 4 3
104 irradiated (6000 rad) EBV-B cells of donor IF in 200 ml of complete
RPMI 1640 with or without NiSO4 (1024 M). After 48 h at 37°C, cultures
were incubated with 0.5 mCi [3H]thymidine (Amersham Buchler, Braunschweig, Germany), and incorporation of radioactivity was measured in a
beta counter (INOTECH, Asbach, Germany) after another 18 h. To assess
the requirement of the T cell clone for CD4, the T cell clone was cultured
with B cells, 1024 M NiSO4, and either anti-CD4 (13B8.2) (5 mg/ml) or
anti-CD8 mAb (B9.11) (5 mg/ml) (both mAb were obtained from Immunotech, Marseille-Luminy, France).
The rearranged TCRBV17 chain of 4.13 cloned into the pCR Script vector
was used as a template for subsequent site-directed mutagenesis. Amino
acids in CDR1B (His in position 27) and CDR3B (Arg and Asp in positions
95 and 96, respectively) were mutated into Ala. The Asp at position 28 in
CDR1B was mutated into Gly (CDR1D-G), as Gly is located at this position in other human TCRBV chains exhibiting high homology to
TCRBV17S1. This should avoid possible alterations of the TCR structure
due to the mutations (34, 35). Introduction of point mutations was performed using the QuickChange site-directed mutagenesis kit (Stratagene)
according to the manufacturer’s instructions. Primers used are listed in
Table I. Mutated TCR b-chains were sequenced as described above and
cloned into the TCR b-chain expression vector pV2-15b.
IL-2 secretion assay
Transfectants (5 3 104 cells) were cocultured in duplicate or in triplicate
in 200 ml RPMI-FCS with 5 3 104 irradiated B cells in the presence or
absence of Ag. After 20 h at 37°C, 100 ml of the supernatant was used for
a CTLL assay as described in Grabstein et al. (27). Stimulation with immobilized purified anti-CD3e mAb (145-2C11) (PharMingen, San Diego,
CA) or anti-VB17 mAb (E17.5F3.15.13, Immunotech) was described previously (28). APC were fixed according to the method of Shimonkevitz et
al. (29). Briefly, B cells were resuspended at room temperature in 1 ml of
PBS containing 0.05% glutaraldehyde (Life Technologies/BRL). After
45 s, 1 ml of 0.2 M L-lysine (Life Technologies/BRL) was added for an
additional 45 s. Cells were then washed. To assess class specificity of HLA
restriction, T cells were cultured with B cells, 1024 M NiSO4, and either
anti-DR (L243, American Type Culture Collection, Manassas, VA
(ATCC)), anti-DP (B7.21, ATCC), or anti-DQ (SPVL3, ATCC) mAb (1:10
diluted culture supernatant). IL-2 secretion was determined as above.
Abs and flow cytometry
Hamster anti-murine CD3e mAb (145-2C11) (30) was used with FITCconjugated rabbit anti-hamster Ig (Dianova, Hamburg, Germany). Mouse
anti-human mAb used included FITC-conjugated and nonconjugated
TCRBV17 (E17.5F3.15.13) and FITC-conjugated CD4 (13B8.2) (all from
Immunotech). FITC-conjugated mouse IgG1 (MOPC-21) (Sigma) was
used as isotype control. For flow cytometric analysis, 2 3 105 cells were
stained at 4°C in 96-well round-bottom plates either directly with FITClabeled or with unlabeled mAb, followed by staining with the secondary
Transfection of TCR expression vectors into mouse hybridoma
cells
The murine TCR-negative hybridoma T cell line 54z17, expressing a human CD4 molecule, was used as recipient cell for transfection of TCR aand b-chain expression vectors. Recipient cells (8 3 106) were transfected
by electroporation as described previously (28). Cultures resistant for G418
(Life Technologies/BRL) were analyzed by FACS for surface expression
of TCR, CD3e, and CD4, and expression of the correct TCR a- or b-chains
was confirmed by PCR and/or TCR sequencing. Briefly, total RNA was
extracted and transcribed into cDNA. PCR amplifications were performed
as above using the primers humanLVb17, humanVa1, and humanVa3 (for
primer sequences see above) together with mouseCaint (TGTCCT
GAGACCGAGGATCT); mouseCbint (TGATGGCTCAAACAAGGA
GAC); or 413JB1S6Splice/SalI, 23JB2S2Splice/SalI, and 13JB1S2Splice/
SalI (Table I). PCR products were purified with the Qiagen gel extraction
kit (Qiagen, Hilden, Germany) and sequenced using the Big Dye sequencing kit as described above. TCR- and CD4-positive transfected hybridoma
cell lines homogeneously expressing the chimeric TCR as well as the human coreceptor CD4 were used for subsequent analyses of T cell responses
to Ag, superantigen, and mAb as described above. Transfectants that had
poor or nonhomogeneous TCR expression were cloned by limiting dilution, and clones were again tested for Ag responses. Representative lines or
clones were used for all additional experiments.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
The Ni-specific T cell clones 4.13, ANi1.3, and ANi2.3 were obtained from
the Ni-allergic donor IF and have been previously described (24). Donor IF
had been HLA typed (24) as follows: HLA-A1, A26, B35, DRB1*1302,
DRB1*0401, DR52, DR53, DQ6 (1), and DQ7 (3). The murine T cell
hybridomas 54z17 (26) and Ta8.1 were a kind gift of Dr. O. Acuto (Institut
Pasteur, Paris, France). For APC, we used either autologous EBV-transformed B cells of donor IF or HLA-DR homozygous B cell lines, originating from the International Histocompatibility Workshop (IHW), WT47
(IHW No. 9063) (DRB1*1302, DR52), BSM (IHW No. 9032)
(DRB1*0401, DR53), PLH (IHW No. 9047) (DRB1*07, DR53), SWEIG
(IHW No. 9037) (DRB1*1101, DR52), and EK (IHW No. 9054)
(DRB1*1401, DR52). The EBV-B cell line APD (DRB1*1301) was obtained from Dr. F. Koning, Leiden University Medical Center, Leiden, The
Netherlands.
Construction of TCR expression vectors
The Journal of Immunology
2725
Table I. Nucleotide sequences of primers used for construction of TCR expression vectors and mutation of TCR a- or b-chains
Transfectant
T413
TCR Chain
TCRA
TCRB
T23
TCRB
T13
TCRA
TCRB
CDR1H-A
CDR1D-G
CDR3R-A
Orientation
LeaAV1S4Pro
413JA37Splice/BamHI
413PromLeaVB17
413JB1S6Splice/SalI
23JB2S2Splice/Sal1
ACTCCAGTGGCTCAGAAAATGCTCCTGGAGCTTATC
GATCGGATCCacttacCTGGTTTTACTTGTAAAGab
ACCTGCCTTGGTCCCAAGATGAGCAACCAGGTGCTC
ATCGTCGACtcttacCTGTCACAGTGAGCCTGGTCCC
ATCGTCGACtcttacCCAGTACGGTCAGCCTAGAGCC
Sense
Antisense
Sense
Antisense
Antisense
LeaAV3S1Pro
mut13AV3S1sense
mut13AV3S1antisense
13JA56Splice/BamHI
13JB1S2Splice/Sali
ACTCCAGTGGCTCAGAAAATGGAAACTCTCCTGGGA
GAGAAGAGGACCCTCAGGCCTc
AGGCCTGAGGGTCCTCTTCTC
GATCGGATCCacttacCTGGTCTAACACTCAGAG
ATCGTCGACtcttacCTACAACGGTTAACCTGGTCC
Sense
Sense
Antisense
Antisense
Antisense
MutB17HA/CDR1sense
MutB17HA/CDR1antisense
MutB17DG/CDR1sense
MutB17DG/CDR1antisense
MutB17RA/CDR3sense
MutB17RA/CDR3antisense
MutB17DA/CDR3sense
MutB17DA/CDR3antisense
GAACAGAATTTGAACGCCGATGCCATGTACTGG
CCAGTACATGGCATCGGCGTTCAAATTCTGTTC
CAGAATTTGAACCACGGTGCCATGTACTGGTAC
GTACCAGTACATGGCACCGTGGTTCAAATTCTG
CTGTGCCAGTAGTATTGCGGACGGTTATAATTC
GAATTATAACCGTCCGCAATACTACTGGCACAG
CCAGTAGTATTCGGGCCGGTTATAATTCACC
GGTGAATTATAACCGGCCCGAATACTACTGG
Sense
Antisense
Sense
Antisense
Sense
Antisense
Sense
Antisense
a
Restriction sites for BamHI and SalI are in bold print.
Introduced splice sites are indicated by lowercase letters.
c
Mutated nucleotides are underlined.
b
Results
Characterization of Ni-specific human TCR transfectants and
role of the CD4 coreceptor in Ni recognition
In a previous study, we observed an overrepresentation of the
TCRBV17 element among CD41 T cell lines raised from donors
with strong hyperreactivity to Ni (24). TCR sequencing of a panel
of Ni-specific T cell clones for one of these donors revealed interesting features of these TCRBV17 chains. In many cases, the
amino acid Arg is conserved in position 95 of the CDR3B region
and is frequently accompanied by an Asp in position 96. We
wanted to further examine the role of these specific Ag receptors
in Ni recognition, using our previously described method to express Ni-reactive human TCR together with the human CD4 coreceptor in the mouse hybridoma cell line 54z17 (28). The amino
acid sequences of the CDR1, CDR2, and CDR3 regions of TCR aand b-chains of three CD41 human T cell clones under investi-
gation are shown in Table II. All three clones were obtained from
the Ni-allergic patient IF. Two of these clones, namely, 4.13 and
ANi2.3, contained very similar TCR a-chains (VA1, JA37) exhibiting 99% similarity. In contrast, clone ANi1.3 expressed VA3 and
JA56 and exhibited only ;35% similarity to the other two clones.
Concerning their b-chains, clones 4.13 and ANi2.3 possess identical TCRBV17 alleles and highly similar CDR3B sequences, including an Arg95-Asp96 amino acid motif, but different TCRBJ
elements. In contrast, the TCRBV17 chain of ANi1.3 differed from
the other two TCR b-chains not only in the TCRBJ region, but also
by a different CDR3B sequence and in a slightly different allele of
the TCRBV17 segment (Table II).
Expression vectors for the TCR of clones 4.13, ANi2.3, and
ANi1.3 were constructed as described in Materials and Methods
and transfected into 54z17 cells. The resulting TCR transfectants,
T413, T23, and T13, respectively, were analyzed for TCR and
Table II. TCRV and TCRJ usage and amino acid sequences of hypervariable TCRa and/or TCRb regions of T cell clones AL8.1, ANi1.3, ANi2.3,
and 4.13
TCRV
CDR1a
TCRa
AL8.1
ANi1.3
ANi2.3
4.13
Position
AV8S1A1
AV3S1c
AV1S4A1N2T
AV1S4A1N2T
SDSASNY
KTSINN
SYGATPY
SYGATPY
DIRSNVGE
LIRSNERE
KYFSGDTLV
KYFSGDTLV
CA
CA
CA
CA
90
AENYGGSQGNLI
TAMTPNSKLT
VGASGNTGKLI
VGGSGNTGKLI
F
F
F
F
TCRb
ANi1.3
ANi2.3
4.13d
Position
BV17S1A1T
BV17S1
BV17S1
NLNHDA
NLNHDA
NLNHDA
27
YSQIVNDFQKGDI
YSQIVNDFQKGDI
YSQIVNDFQKGDI
CAS
CAS
CAS
90
RWDMDYGY T
S L R D G Y T G EL F
S I RDGYNSPLH
95
FG
FG
FG
T Cell Clone
CDR3b
CDR2
TCRJ
G
G
G
G
AJ42
AJ56
AJ37
AJ37
BJ1S2
BJ2S2
BJ1S6
a
The assignments of the CDR1, CDR2, and CDR3 loops of the TCR a- and b-chains are according to Moss and Bell (32), and the numbering of the amino acids is described
in Ref. 31.
b
N or D/N regions contributing to each CDR3 are underlined.
c
The V region amino acid sequences were previously reported (24), nucleotide sequences of 4.13 and ANi2.3 are available from EMBL under accession numbers Y10198
to Y10201 or are described in Ref. 31, except for the amino acid sequence of the TT-peptide-specific TCR a-chain of TCR AL8.1, which was described in Ref. 36.
d
Mutated amino acids of the T413 TCR b-chain are indicated in bold.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
CDR3D-A
Sequence (59 3 39)
Primer
2726
MUTATIONS OF NICKEL-SPECIFIC TCR
Table III. TCR and CD4 surface expression of TCR transfectants
Mean Fluorescence Intensitya
TCR Transfectant
Control Anti-CD3e Control Anti-VB17 Anti-CD4
54z17
T413
T413CD42
4.17
4.17
3.51
4.91
12.42
17.48
4.19
4.19
3.01
4.39
17.92
12.17
48.79
13.12
2.13
T13
T13A/413B
T413A/13B
4.53
4.53
4.53
44.56
31.75
25.58
3.95
3.95
3.95
35.93
31.75
17.11
40.55
30.88
42.30
T23
T23A/413B
T413A/23B
4.17
4.17
4.17
14.40
23.79
17.33
4.19
4.19
4.19
19.91
27.72
23.86
35.67
27.56
23.23
CDR1HA
CDR1DG
CDR3RA
CDR3DA
3.39
3.39
3.39
3.39
19.87
9.76
43.80
72.03
2.41
2.41
2.41
2.41
14.55
8.76
30.74
46.38
34.71
21.38
25.98
5.23
CD4 cell surface expression by FACS analysis. These data are
summarized in Table III and compared with the TCR-negative
recipient cell line 54z17. Table III also shows data for several other
TCR transfectants, which will be discussed later. The reactivities
of the TCR transfectants are shown in Fig. 1. For T413, Fig. 1A
reveals that, as for the corresponding T cell clone 4.13 (not
shown), the activation by NiSO4 is inhibited by anti-HLA-DR but
not by anti-HLA-DP or anti-HLA-DQ mAbs. HLA-DR restriction
was also observed for the other two transfectants (not shown).
Consistent with clone 4.13, the TCR transfectant T413 also crossreacted with Cu (Fig. 1A). This cross-reactivity, which was also
observed for T23 and T13 (data not shown), proves that both metal
reactivities are mediated by the same TCR. It is also important to
note that all three transfectants reacted to NiSO4 in the presence of
glutaraldehyde-fixed autologous B cells (not shown). This implies
that Ag processing is not required and that the epitopes for all three
TCR might include Ni21 ions as essential components.
The HLA-DR restriction of T413, T23, and T13 was further
defined by using HLA-DR homozygous B cell lines matching the
HLA-DR haplotype of donor IF. IF was typed as expressing HLADRB1*0401, DRB1*1302, DR52, and DR53. Attempts to activate
the transfectants in the presence of the B cell lines BSM (HLADRB1*0401, DR53), WT47 (HLA-DRB1*1302, DR52), or PLH
(HLA-DRB1*07, DR53) are shown in Fig. 1, B to D. Only the cell
line WT47 effectively presented Ni to all of the transfectants, revealing a HLA-DRB1*1302 restriction. HLA-DR52 restriction
was excluded using the B cell line SWEIG, homozygous for HLADRB1*1101 and DR52 (not shown). As the Ni-specific TCR of
these transfectants originate from CD41 T cell clones, we have
also studied the role of the human CD4 coreceptor in Ni-specific
TCR activation. A CD4-negative variant of T413 (T413CD42)
was selected by cloning of T413 (see Table III for phenotyping).
As shown in Fig. 1E, there was no decrease in the reactivity of
T413CD42 in response to anti-TCR mAb, superantigen, or NiSO4.
In addition, we assessed the CD4 dependence of the parent CD4 T
cell clone 4.13. As shown in Fig. 1F, the activation by NiSO4 is
only slightly inhibited by anti-CD4 mAb. The recognition of Ni by
the TCR of clone 4.13 thus appears to be independent of the engagement of CD4 coreceptors.
One possibility for the overrepresentation of VB171 TCR in
NiSO4-induced human T cell cultures might be a superantigen-like
interaction of Ni21 ions with amino acids specific for this TCRBV
region. In this case, the TCRBV17 sequence alone might dominate
the recognition of Ni epitopes and might even be sufficient for Ag
recognition. To test this hypothesis, we introduced the TCR
b-chain of the Ni-reactive T cell clone 4.13 into a transfectant
(Ta8.1) containing the a-chain of the unrelated human T cell clone
AL8.1 (Table II). The TCR of clone AL8.1 has been previously
described to react to the tetanus toxoid peptide TT830-843 presented by either HLA-DRB1*1102 or DRB1*1302 (26), i.e., the
same HLA-DR13 allele to which T413 was restricted (Fig. 1B).
The resulting transfectant TAL8.1A/413B expressed both TCR
and CD4 (not shown). However, TAL8.1A/413B could be stimulated neither by NiSO4 nor by TT830-843 presented by the HLADRB1*1302-positive B cell line WT47, but could be activated by
SEB and anti-TCR mAb (not shown). This indicates that Ni does
not act in a superantigen-like fashion, but that the structural elements of both chains of the Ni-specific TCR are needed to create
a functional Ag recognition site. In a subsequent analysis, we
tested the combination of the TCR a- and b-chains of the two
Ni-specific HLA-DR13-restricted T cell clones 4.13 and ANi1.3. The
resulting TCR transfectants were designated as T413A/13B (TCR
a-chain of clone 4.13 and b-chain of clone ANi1.3) and T13A/413B
(reverse combination). The comparable responses of the two hybrid
TCR and of their original TCR in T413 and T13 to mAb and SEB
(Fig. 2A) reflect the structural and functional integrity of these Ag
receptors. However, neither of the two hybrid TCR was activated in
the presence of NiSO4 (Fig. 2B). The same result was obtained for the
cross-reactive Ag Cu SO4 (not shown). These data confirm, in addition to transfectant TAL8.1A/413B, the contribution of both TCR
chains to Ni and Cu specificity and highlight the possible importance
of the Arg95-Asp96 motif in the CDR3B region in mediating Ni recognition for the transfectants T413 and T23.
As the two TCR of clones 4.13 and ANi2.3 primarily differ in their
CDR3B and TCRBJ regions (Table II), we produced hybrid receptors
of their TCR a- and b-chains by transfection into 54z17 cells. The
resulting TCR transfectants T413A/23B (TCR a-chain of clone 4.13
and b-chain of clone ANi2.3) and the reverse T23A/413B expressed
TCR and human CD4 (Table III) and compared well with the original
TCR transfectants, T23 and T413, in SEB- and anti-CD3e mAb-mediated activation (Fig. 2C). However, unlike the T413/T13 hybrids
(Fig. 2B), both T413/T23 hybrids were stimulated by NiSO4 in a
manner comparable with that of the parental TCR (Fig. 2D). This
result was also observed for Cu-specific TCR responses (not shown).
It implies that a significant part of the CDR3B and the complete
TCRBJ regions do not interfere with Ag and restriction specificity.
This, in turn, puts into focus those amino acids of the CDR3B region
that are identical or highly similar between the TCR b-chains of
clones 4.13 and ANi2.3 and differ between those and clone ANi1.3.
These are the amino acids in positions 93–98 (Table II), and particularly those in positions 95 and 96 (Arg and Asp), which, in several
TCR crystals, were shown to be most closely in contact with MHCassociated peptide determinants (12, 37).
Mutational analysis of single amino acids in the CDR1 and
CDR3 regions of a Ni-specific human TCRBV17 chain
One peculiarity of the TCRBV17 element is the amino acid sequence His-Asp-Ala in positions 27 to 29 of its CDR1 loop. Although His27 is highly conserved among various TCRBV seg-
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
a
Mean fluorescence intensity of staining with mAb was determined by flow cytometry on representative transfectants. Controls included stainings with a goat antihamster Ig for the anti-CD3e staining and with isotype control (mouse IgG1) for
anti-VB17 and anti-CD4 stainings.
Shuffling of TCR a- and b-chains between different DR13restricted human TCRs
The Journal of Immunology
2727
ments (30, 38, 39), the combination His-Asp-Ala is rather unique.
These amino acids have been identified as participating in the Ni
binding sites of several Ni-complexing proteins (40 – 42). Although the above experiments excluded that the motif HDA in the
CDR1 region of TCRBV17 itself was sufficient to mediate Ni reactivity, the motif might still participate in the interaction with Ni
epitopes. A second possible point of contact between VB171 TCR
b-chains and Ni antigenic determinants has been indicated to be
represented by the amino acids Arg95 and Asp96 in the CDR3B
region of the Ni-reactive T cell clones 4.13 and ANi2.3. For further
investigations of TCR contacts with Ni, we therefore mutated each
of the four amino acids, i.e., His27 and Asp28 in CDR1 and Arg95
and Asp96 in CDR3 of the TCRBV17 chain of clone 4.13 individually into Ala or Gly. The positions of the mutated amino acids in
the CDR1B and CDR3B regions are indicated in Table II. The
mutated TCR b-chains were transfected together with the nonmutated 4.13 a-chain into 54z17 cells, resulting in the transfectants
CDR1H-A, CDR1D-G, CDR3R-A, and CDR3D-A. Surface ex-
pression of TCR and CD4 on these transfectants is summarized in
Table III. All four mutated TCR were effectively activated by antiTCR mAbs (Fig. 3, A and B) and SEB (Fig. 3, C and D), demonstrating their integrity and capacity to signal.
The reactivity of the CDR1B mutants to SEB is of particular
interest, because amino acids in positions 27 and 28 have been
shown for several other TCR to be involved in superantigen contact, including SEB (14, 43, 44). When tested for reactivity to Ni
on autologous APC, both CDR1 mutants were indistinguishable
from the original T413 transfectant (Fig. 3E). The same result was
obtained for stimulation with Cu (not shown). Some authors have
proposed a role for the conserved His27 and adjacent amino acids
in defining MHC restriction (38). Therefore, we tested the ability
of the CDR1 mutants to be activated by NiSO4 in the presence of
APC expressing nonmatching HLA-DR alleles such as HLADRB1*1301, DRB1*1401, or DRB1*1101. Although these
HLA-DR molecules exhibit the highest similarities to the restricting HLA-DRB1*1302 molecule and all of them mediated SEB
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. Characterization of Ni-specific TCR transfectants and influence of the CD4 coreceptor on Ni recognition. A, Stimulation of the transfectant
T413 with (Ni) or without (Ctrl.) 1024 M NiSO4 in the presence of the autologous B cell line IF. HLA restriction was determined by adding mAb against
HLA-DR (DR), HLA-DP (DP), or HLA-DQ (DQ) as described in Materials and Methods. Cross-reactivity to Cu was assessed by incubation with APC
and 5 3 1025 M CuSO4. B through D, Incubation of TCR transfectants T413 (B), T13 (C), and T23 (D) with (Ni) or without (Ctrl.) 1024 M NiSO4 in the
presence of APC BSM (HLA-DRB1*0401, DR53), WT47 (HLA-DRB1*1302, DR52), and PLH (HLA-DRB1*07, DR53). E, Comparison of CD41
transfectant T413 and CD42 transfectant T413CD42 upon culturing on immobilized anti-VB17 mAb (1023 mg/well) (Ab) or by stimulation with (Ni) or
without (Ctrl.) 2 3 1024 M NiSO4 or with SEB (20ng/ml) in the presence of APC WT47. Production of IL-2 was determined by [3H]thymidine
incorporation of CTLL cells, and results are expressed as cpm 6 SD. F, Proliferative response of the T cell clone 4.13 to 1024 M NiSO4 (Ni) or PHA (1
mg/ml) was assessed in the presence of autologous B cells from donor IF. CD4 dependence was determined by adding mAb (5 mg/ml) against the human
CD4 (CD4) coreceptor or the CD8 (CD8) coreceptor as control. Proliferation was determined by incorporation of [3H]thymidine as described in Materials
and Methods. Results are expressed as cpm 6 SD.
2728
MUTATIONS OF NICKEL-SPECIFIC TCR
activation, none of them was able to present Ni to T413 or the two
CDR1 mutants (data not shown).
The reactivity to mAb (Fig. 3B)- or SEB (Fig. 3D)-mediated
triggering of the CDR3 mutants was also unaffected by the introduced mutations. However, in contrast to the CDR1 mutants, the
reactivity of the two CDR3 mutants to Ni-induced epitopes in the
presence of autologous APC of donor IF was completely abrogated
(Fig. 3F). The same loss of activation was also true for the crossreactivity to Cu (not shown). These data complete the observations
made by shuffling of the TCR chains of clones 4.13 and ANi2.3.
They allow us to conclude that the Ni-mediated activation of those
two T cell clones is independent of the TCRJB region but directly
involves the Arg95-Asp96 motif of their CDR3B sequences. We
have also produced more conservative mutations in positions 95
and 96 by replacing Arg95 with Lys and Asp96 with Glu. Preliminary data (not shown) revealed that Asp-Glu exchange also abrogated Ni reactivity, whereas the Arg-Lys replacement had no
effect; i.e., antigen contacts mediated by position 95 appear more
flexible than those by position 96.
Discussion
Nickel ions are nonclassical Ags that specifically activate human
ab T lymphocytes in an HLA-restricted manner (18). Although
these reactions form the basis for occasionally severe contact hypersensitivities in a large proportion of the caucasian population
(45), the precise structure of the allergenic determinants involved
and the mode of Ni-induced TCR activation remain poorly under-
stood (22, 23). One way to address these questions is to study the
major structural features of Ni-reactive TCR.
We have previously described an overrepresentation of VB171
TCR among CD41 (not CD81) Ni-induced T cell lines from the
peripheral blood of patients with particularly severe contact hypersensitivity to Ni (24). Furthermore, others have reported the
detection of elevated numbers of TCRBV171 Ni-reactive T cells
in skin lesions (46). We took this to indicate an important role of
so-far-unknown properties of this VB171 T helper population in
mediating and defining the severity of Ni contact dermatitis. To
study the influence of certain structural features of such TCR, we
used our recently described system to express human-mouse hybrid TCR in the receptor-deficient mouse hybridoma 54z17 together with human CD4 (28). Such hybridomas have two advantages over T cell clones: they clearly link recognition specificity to
the transfected TCR and they lack the expression of MHC class II
and, hence, the possibility of “self-presentation” of Ni.
A first experiment (Fig. 1E) revealed a complete CD4 independence of Ni recognition by at least one of the VB171 TCR transfectants studied. In addition, the parent T cell clone (4.13) was
inhibited only to a minor degree by mAb to the CD4 coreceptor
(Fig. 1F), confirming that this Ni-specific TCR is independent of
CD4 signaling. This may indicate a high TCR affinity for the
DR13-Ni combination and/or that Ni21 ions, in addition to conferring specificity, may be involved in an aggregation of TCRMHC-Ni complexes. This CD4 independence resembles exceptional TCR interactions with peptide Ags (47) but also with
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 2. Shuffling of TCR
chains between DR13-restricted
Ni-specific T cell clones. A, Stimulation of transfectants T13A/413B
and T413A/13B (combination of
TCR a-chain of clone ANi1.3 with
b-chain of 4.13 and vice versa) and
original transfectants T13 and
T413bycultureonimmobilizedantiVB17 mAb (1023 mg/well) (shaded bars) or with different concentrations of SEB with autologous
APC IF. IL-2 secretion was determined by [3H]thymidine incorporation of CTLL cells (for details,
see Materials and Methods), and
results are expressed as cpm 6 SD.
B, Incubation of transfectants
T13A/413B, T413A/13B, T13, and
T413 with graded concentrations
of NiSO4 in the presence of IF
APC. C, Incubation of transfectants T23A/413B and T413A/23B
(TCR combination of clones
ANi2.3 and 4.13) in comparison
with original transfectants T23 and
T413 with SEB and APC WT47 or
with immobilized anti-CD3e mAb
(1023 mg/well) (shaded bars) as
described in Fig. 3A. D, IL-2 responses of T23A/413B, T413A/
23B, T23, and T413 in the presence of graded concentrations of
NiSO4. For details, see Materials
and Methods.
The Journal of Immunology
2729
superantigens. It is not yet clear whether this effect is restricted to
VB171 TCR, but earlier data concerning a DQ-restricted, VB131
TCR revealed some CD4 dependence of Ni reactivity (28). Different TCR might, therefore, recognize the Ni-induced antigenic
determinant with distinct affinities. Thus, VB171 T cells might
possess a higher affinity to the MHC-Ag complex in Ni recognition
than most other TCRBV elements.
We also examined a potential TCRBV17-dependent superantigen-like T cell activation by Ni. It has indeed been previously
reported in another hapten-mediated system of T cell activation
that a transfer of Ag specificity (to p-azobenzenearsonate) could be
obtained alone by the TCR a-chain of the original TCR (48). From
control experiments (not shown), we already knew that tetanus
toxoid-specific CD41, TCRBV171 T cells (from the same donor,
IF, providing the Ni-reactive clones) did not cross-react with Ni.
Moreover, pairing of the TCRBV17 chain of an HLA-DR13-restricted Ni-reactive T cell clone with the a-chain of a DR13-restricted TT-specific clone abolished reactivity to Ni, but not to
superantigen. Even the crosswise combination of TCR a- and
b-chains of the two DR13-restricted, TCRBV171, Ni-reactive T
cell clones ANi1.3 and 4.13 (Fig. 2, A and B) could not restore Ni
reactivity. Hence, TCRBV17 chains alone, even if derived from
Ni-specific TCR, are not sufficient to create a functional Ni binding
site, and, therefore, Ni does not activate the TCR in a superantigenlike fashion. Similar to nominal peptide Ags (26, 49, 50) and nonclassical Ags (51), interactions with Ni for VB171 TCR also
clearly depend on properties provided only by the specific combination of a- and b-chains.
Clones 4.13 and ANi1.3, the TCR of which were used in the
above experiment, possessed different a-chains and also revealed
large sequence differences in the CDR3 and J regions of their
b-chains (Table II). In contrast, clone ANi2.3 expressed an
a-chain differing from clone 4.13 by only one conservative amino
acid exchange in its CDR3 loop. The b-chains of the two TCR
differed in the J-proximal half of their CDR3 sequence as well as
in the TCRBJ elements used, but exhibited the same TCRBV17
sequence and very similar amino acids in positions 93–98 of their
CDR3 sequences (Table II). Both T cell clones revealed HLADR13-restricted specificity for Ni and Cu. The crosswise combination of their TCR a- and b-chains did not alter their recognition
specificities (Fig. 2, C and D). Such TCR, therefore, might adopt
the same or very similar orientations in the TCR-Ag-MHC complex as proposed for TCR recognizing classical peptide Ags (52).
However, our data are in contrast to other studies identifying the J
region to be responsible for a heterogeneous pattern of recognition
(53, 54).
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 3. Characterization
of TCR b-chain mutants of Nispecific T cell clone 4.13. The
mutated TCR b-chains of clone
4.13 were transfected together
with the 4.13 a-chain into hybridoma cells, and the resulting
transfectants were CDR1D-G,
CDR1H-A (mutation of Asp28
and His27 in CDR1B to Gly and
Ala, respectively) or CDR3R-A,
CDR3D-A (mutation of Arg95
or Asp96 in CDR3B to Ala). A
and B, IL-2 responses of these
transfectants and the nonmutated transfectant T413 after culturing on immobilized antiVB17 (1021 mg/well) (gray
bars) or anti-CD3e (1021 mg/
well) mAb (hatched bars). C and
D, Incubation of the TCR transfectants with different concentrations of SEB in the presence
of autologous IF APC. E and F,
Stimulation of the CDRB mutants with graded concentrations
of NiSO4 and APC IF. Production
of IL-2 was determined by
[3H]thymidine incorporation of
CTLL cells, and results are expressed as cpm 6 SD. For details,
see Materials and Methods.
2730
might clarify this point. In addition, we cannot yet explain which
structural features of the human TCRBV17 element favor its preferred usage in Ni-reactive TCR of highly allergic individuals.
However, a superantigen-like activation of VB171 TCR mediated
by Ni21 ions could be excluded. The finding that TCR specificity
and the sensitivity of its activation was untouched by removal of
CD4 implies a particularly high affinity of such receptor types for
the Ni-MHC complex. This, in turn, may point to a dominant role
of T cells bearing such receptors in the pathogenesis of contact
dermatitis. In this respect, it should be recalled that overrepresentation of TCRBV17 among Ni-reactive TCR is restricted to
CD41 T cells and was not observed for CD81 T cells of the same
individual (24).
Acknowledgments
We thank Dr. O. Acuto, who supplied the cell lines 54z17 and Ta8.1, and
H. Ruh for expert technical assistance. We also thank Dr. E. Padovan for
helpful discussion and Dr. I. Haidl for critically revising the manuscript.
References
1. Davis, M. M., and P. J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell
recognition. Nature 334:395.
2. van den Elsen, P. J., ed. 1995. The Human T-Cell Receptor Repertoire and Transplantation. Springer-Verlag, Berlin.
3. Petrie, H. T., F. Livak, D. Burtrum, and S. Mazel. 1995. T cell receptor gene
recombination patterns and mechanisms: cell death, rescue and T cell production.
J. Exp. Med. 182:121.
4. Chothia, C., D. Ross Boswell, and A. M. Lesk. 1988. The outline structure of the
T-cell ab receptor. EMBO J. 7:3745.
5. Chien, Y., and M. M. Davis. 1993. How ab T-cell receptors see peptide/MHC
complexes. Immunol. Today 14:597.
6. Jorgensen, J. L., U. Esser, B. Fazekas de St. Groth, P. A. Reay, and M. M. Davis.
1992. Mapping T cell receptor-peptide contacts by variant peptide immunization
of single-chain transgenics. Nature 355:224.
7. Hong, S.-C., G. Waterbury, and C. A. Janeway. 1996. Different superantigens
interact with distinct sites in the Vb domain of a single T cell receptor. J. Exp.
Med. 183:1437.
8. Kelly, J. M., S. J. Sterry, S. Cose, S. J. Turner, J. Fecondo, S. Rodda, P. J. Fink,
and F. R. Carbone. 1993. Identification of conserved T cell receptor CDR3 residues contacting known exposed peptide side chains from a major histocompatibility complex class I-bound determinant. Eur. J. Immunol. 23:3318.
9. Ehrich, E. W., B. Devaux, E. P. Rock, J. L. Jorgensen, M. M. Davis, and
Y. Chien. 1993. T cell receptor interaction with peptide/major histocompatibility
complex (MHC) and superantigen/MHC ligands is dominated by antigen. J. Exp.
Med. 178:713.
10. Manning, T. C., C. J. Schlueter, T. C. Brodnicki, E. A. Parke, J. A. Speir,
K. C. Garcia, L. Teyton, I. A. Wilson, and D. M. Kranz. 1998. Alanine scanning
mutagenesis of an ab T cell receptor: mapping the energy of antigen recognition.
Immunity 8:413.
11. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, and D. C. Wiley.
1996. Structure of the complex between human T-cell receptor, viral peptide and
HLA-A2. Nature 384:134.
12. Garcia, K. C., M. Degano, R. L. Stanfield, A. Brunmark, M. R. Jackson,
P. A. Peterson, L. Teyton, and I. A. Wilson. 1996. An ab T cell receptor structure
at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.
13. Housset, D., G. Mazza, C. Grégoire, C. Piras, B. Malissen, and
J. C. Fontecilla-Camps. 1997. The three-dimensional structure of a T-cell antigen
receptor VaVb heterodimer reveals a novel arrangement of the Vb domain.
EMBO J. 16:4205.
14. Fields, B. A., E. L. Malchiodi, H. Li, X. Ysern, C. V. Stauffacher,
P. M. Schlievert, K. Karjalainen, and R. A. Mariuzza. 1996. Crystal structure of
a T-cell receptor b-chain complexed with superantigen. Nature 384:188.
15. Weltzien, H. U., C. Moulon, S. Martin, E. Padovan, U. Hartmann, J. Kohler.
1996. T cell immune responses to haptens: structural models for allergic and
autoimmune responses. Toxicology 107:141.
16. Porcelli, S. A., C. T. Morita, and R. L. Modlin. 1996. T-cell recognition of
non-peptide antigens. Curr. Opin. Immunol. 8:510.
17. Sinigaglia, F., D. Scheidegger, G. Garotta, R. Scheper, M. Pletscher, and
A. Lanzavecchia. 1985. Isolation and characterization of Ni-specific T cell clones
from patients with Ni-contact dermatitis. J. Immunol. 135:3929.
18. Sinigaglia, F. 1994. The molecular basis of metal recognition by T cells. J. Invest.
Dermatol. 102:398.
19. Pettit, L. D., J. E. Gregor, and H. Kozlowski. 1991. Complex formation between
metal ions and peptides. In Perspectives on Bioinorganic Chemistry, Vol. 1. JAI
Press Ltd, Stamford, CT p. 1.
20. Basketter, D., A. Dooms-Goossens, A.-T. Karlberg, and J.-P. Lepoittevin. 1995.
The chemistry of contact allergy: why is a molecule allergenic? Contact Dermatitis 32:65.
21. Romagnoli, P., A. M. Labhardt, and F. Sinigaglia. 1991. Selective interaction of
Ni with a MHC-bound peptide. EMBO J. 10:1303.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
The different results obtained for the shuffling of the TCR a- and
b-chains of clones 4.13, ANi1.3, and ANi2.3 might be explained
by a difference in CDR3 length, leading to different TCR orientations above the antigenic determinant, as suggested for peptide
Ags (13, 55). On the other hand, this puts into focus the V-proximal sequence of CDR3B, which is identical or very similar between the b-chains of clones 4.13 and ANi2.3. Those amino acids
are located at or near the tip of the CDR3B loops in a variety of
peptide- or hapten-specific TCR (10, 35, 56 –58), indicating TCR
contact sites with Ni determinants to be represented by the HV
regions comparable with classical peptide Ags (5, 59). Crystallographic analysis of TCR even showed intimate contact of these
amino acids in the CDR3B region to MHC-bound antigenic
peptides (12, 37).
In this CDR3B region, we previously noticed a particular conservation of an Arg95-Asp96 motif in Ni-reactive TCRBV17 chains
of donor IF (24). Here we show that mutation of either of these two
amino acids to Ala resulted in complete loss of Ni specificity (Fig.
3, D and F). This underlines the importance of these amino acids
in HLA-DR-restricted Ni recognition and, again, stresses the similarity between the reactivity of Ni- and peptide-specific TCR. Indeed, for peptide-specific T cells, positions 95 and 96 in the
b-chain CDR3 have repeatedly been shown to be involved in major contacts with MHC-associated antigenic peptides (6, 10, 56,
57, 60, 61). As Arg and Asp have been demonstrated to be involved in binding of Ni in peptides or in proteins such as arginase
(42, 62), direct interactions with Ni21 ions are conceivable. Therefore, one could imagine the nucleophilic nitrogen groups of Arg
and/or the negatively charged oxygen group of Asp as contributing
one or two coordination bonds to a Ni complex. This would make
Ni-mediated activation similar to hapten recognition by T cells of
hapten-peptide-MHC complexes (15). Moreover, the fact that the
same results were obtained for Cu21 ions clearly demonstrates that
cross-reactive TCR adopt the same molecular interactions with
Cu- as with Ni-induced antigenic determinants.
We have also compared the TCRBV17 sequence with other human TCRBV segments, particularly with regard to their CDR1 and
CDR2 regions. Although His in position 27 is highly conserved in
human CDR1B sequences (31, 38, 39), the amino acid motif His27Asp28-Ala29 is unique for TCRBV17. This is interesting, as these
same amino acids have been reported to participate in the complexing of Ni in several Ni-binding proteins such as human serum
albumin or urease (40, 41, 63). The conservation of His27 in
CDR1B led several authors to the conclusion that this amino acid
might participate in conserved MHC-contacts or might be important for the overall structure of the TCR (38, 39, 64). Therefore, we
assumed that the CDR1 of TCRBV17 might supply a second important site for Ni recognition and, thus, might explain the correlation of the TCRBV17 element with the severity of Ni hyperreactivity. However, mutation of neither His27 nor Asp28 interfered
in any way with the reactivity of the 4.13 TCR with Ni or with
SEB (Fig. 3, C and E). It thus appears that the CDR1 loop of
TCRBV17 in the receptor studied does not contribute significantly
to the TCR-Ag, TCR-HLA, or TCR-SEB contacts. This is in contrast to several studies describing the involvement of especially the
amino acids in positions 27 and 28 of CDR1B in hapten (35, 58),
peptide (10, 35, 44, 65, 66), or MHC (38, 44) contact.
In conclusion, we were able to define the amino acids Arg95 and
Asp96 in the non-template-encoded region of the CDR3B loop as
playing a crucial role in Ni recognition. We cannot exclude the
possibility that amino acids other than the herein described Arg
and Asp are involved in the recognition of Ni-induced antigenic
determinants. Further mutational analysis of putative contact
points in the TCR a as well as b-chains of Ni-specific T cell clones
MUTATIONS OF NICKEL-SPECIFIC TCR
The Journal of Immunology
46. Zollner, T. M., C. Neubert, A. Wettstein, W.-H. Boehnke, W.-H. Manfras, B. O.
Böhm, and W. Sterry. 1998. The T-cell receptor Vb repertoire of nickel-specific
T cells. Arch. Dermatol. Res. 290:397.
47. Shi, Y., A. Kaliyaperumal, L. Lu, S. Southwood, A. Sette, M. A. Michaels, and
S. K. Datta. 1998. Promiscuous presentation and recognition of nucleosomal
autoepitopes in lupus: role of autoimmune T cell receptor a chain. J. Exp. Med.
187:367.
48. Tan, K.-N., B. M. Datlof, J. A. Gilmore, A. C. Kronman, J. H. Lee,
A. M. Maxam, and A. Rao. 1988. The T cell receptor Va3 gene segment is
associated with reactivity to p-azobenzenearsonate. Cell 54:247.
49. Hong, S.-C., A. Chelouche, R.-H. Lin, D. Shaywitz, N. S. Braunstein,
L. Glimcher, and C. A. Janeway. 1992. An MHC interaction site maps to the
amino-terminal half of the T cell receptor a chain variable domain. Cell 69:999.
50. Katayama, C. D., F. J. Eidelman, A. Duncan, F. Hooshmand, and S. M. Hedrick.
1995. Predicted complementary determining regions of the T cell antigen receptor determine antigen specificity. EMBO J. 14:927.
51. Bukowski, J. F., C. T. Morita, H. Band, and M. B. Brenner. 1998. Crucial role of
TCR g-chain junctional region in prenyl pyrophosphate antigen recognition by gd
T cells. J. Immunol. 161:286.
52. Wucherpfennig, K. W., D. A. Hafler, and J. L. Strominger. 1995. Structure of
human T-cell receptors specific for an immunodominant myelin basic protein
peptide: positioning of T-cell receptors on HLA-DR2/peptide complexes. Proc.
Natl. Acad. Sci. USA 92:8896.
53. Ostrov, D., J. Krieger, J. Sidney, A. Sette, and P. Concannon. 1993. T cell receptor antagonism mediated by interaction between T cell receptor junctional
residues and peptide antigen analogues. J. Immunol. 150:4277.
54. Quaratino, S., M. Feldman, C. M. Dayan, O. Acuto, and M. Londei. 1996. Human
self-reactive T cell clones expressing identical T cell receptor b chains differ in
their ability to recognize a cryptic self-epitope. J. Exp. Med. 183:349.
55. Li, H., M. I. Lebedeva, E. S. Ward, and R. A. Mariuzza. 1997. Dual conformation
of a T cell receptor Va homodimer: implications for variability in VaVb domain
association. J. Mol. Biol. 269:385.
56. Engel, I., and S. M. Hedrick. 1988. Site-directed mutations in the VDJ junctional
region of a T cell receptor b chain cause changes in antigenic peptide recognition.
Cell 54:473.
57. Chang, H.-C., A. Smolyar, R. Spoerl, T. Witte, Y. Yao, E. C. Goyarts,
S. G. Nathenson, and E. L. Reinherz. 1997. Topology of T cell receptor-peptide/
class I MHC interaction defined by charge reversal complementation and functional analysis. J. Mol. Biol. 271:278.
58. Ganju, R. K., S. T. Smiley, J. Bajorath, J. Novotny, and E. L. Reinherz. 1992.
Similarity between fluorescein-specific T-cell receptor and antibody in chemical
details of antigen recognition. Proc. Natl. Acad. Sci. USA 89:11552.
59. Wang, F., T. Ono, A. M. Kalergis, W. Zhang, T. P. DiLorenzo, K. Lim, and
S. G. Nathenson. 1998. On defining the rules for interactions between the T cell
receptor and its ligand: a critical role for a specific amino acid residue of the T
cell receptor b chain. Proc. Natl. Acad. Sci. USA 95:5217.
60. Bowness, P., P. A. H. Moss, S. Rowland-Jones, J. I. Bell, and A. J. McMichael.
1993. Conservation of T cell receptor usage by HLA B27-restricted influenzaspecific cytotoxic T lymphocytes suggests a general pattern for antigen-specific
major histocompatibility complex class I-restricted responses. Eur. J. Immunol.
23:1417.
61. Turner, S. J., S. C. Jameson, and F. R. Carbone. 1997. Functional mapping of the
orientation for TCR recognition of an H2-Kb-restricted ovalbumin peptide suggests that the b-chain can dominate the determination of peptide side chain specificity. J. Immunol. 159:2312.
62. Kramer, A., A. Schuster, U. Reineke, R. Malin, R. Volkmer-Engert, C. Landgraf,
and J. Schneider-Mergener. 1994. Combinatorial cellulose-bound peptide libraries: screening tools for the identification of peptides that bind with predefined
specificity. Methods Enzymol. 6:388.
63. Gajda, T., B. Henry, A. Aubry, and J.-J. Delpuech. 1996. Proton and metal ion
interactions with glycylglycylhistamine, a serum albumin mimicking pseudopeptide. Inorg. Chem. 35:586.
64. Bentley, G. A., and R. A. Mariuzza. 1996. The structure of the T cell antigen
receptor. Annu. Rev. Immunol. 14:563.
65. White, J., A. Pullen, K. Choi, P. Marrack, and J. W. Kappler. 1993. Antigen
recognition properties of mutant Vb31 T cell receptors are consistent with an
immunoglobulin-like structure for the receptor. J. Exp. Med. 177:119.
66. Lone, Y.-C., M. Bellio, A. Prochnicka-Chalufour, D. M. Ojcius, N. Boissel,
T. H. M. Ottenhoff, R. D. Klausner, J.-P. Abastado, and P. Kourilsky. 1994. Role
of the CDR1 region of the TCRB chain in the binding to purified MHC-peptide
complex. Int. Immunol. 6:1561.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
22. Griem, P., M. Wulferink, B. Sachs, J. González, and E. Gleichmann. 1998. Allergic and autoimmune reactions to xenobiotics: how do they arise? Immunol.
Today 19:133.
23. Kapsenberg, M. L., J. D. Bos, and E. A. Wierenga. 1992. T cells in allergic
responses to haptens and proteins. Springer Semin. Immunopathol. 13:303.
24. Vollmer, J., M. Fritz, A. Dormoy, H. U. Weltzien, and C. Moulon. 1997. Dominance of the BV17 element in nickel-specific human T cell receptors relates to
severity of contact sensitivity. Eur. J. Immunol. 27:1865.
25. Moulon, C., J. Vollmer, and H.-U. Weltzien. 1995. Characterization of processing requirements and metal cross-reactivities in T cell clones from patients with
allergic contact dermatitis to nickel. Eur. J. Immunol. 25:3308.
26. Blank, U., B. Boitel, D. Mège, M. Ermonval, and O. Acuto. 1993. Analysis of
tetanus toxin peptide/DR recognition by human T cell receptors reconstituted into
a murine T cell hybridoma. Eur. J. Immunol. 23:3057.
27. Grabstein, K., J. Eisenmann, D. Modizuki, P. Schanebeck, P. Cordon, T. Hopp,
C. March, and S. J. Gilles. 1986. Purification to homogeneity of B cell stimulating
factor: a molecule that stimulates proliferation of multiple lymphokine-dependent
cell lines. J. Exp. Med. 163:1405.
28. Vollmer, J., H. U. Weltzien, A. Dormoy, F. Pistoor, and C. Moulon. 1999. Functional expression of a human HLA-DQ restricted, nickel-reactive T cell receptor
in mouse hybridoma cells. J. Invest. Dermatol. 113:101.
29. Shimonkevitz, R., J. Kappler, P. Marrack, and H. Grey. 1983. Antigen recognition by H-2-restricted T cells. I. Cell-free antigen processing. J. Exp. Med.
158:303.
30. Leo, O., M. Foo, D. H. Sachs, L. E. Samelson, and J. A. Bluestone. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc.
Natl. Acad. Sci. USA 85:1374.
31. Arden, B., S. P. Clark, D. Kabelitz, and T. W. Mak. 1995. Human T-cell receptor
variable gene segment families. Immunogenetics 42:455.
32. Moss, P. A. H., and J. I. Bell. 1996. Sequence analysis of the human ab T-cell
receptor CDR3 region. Immunogenetics 42:10.
33. Casorati, G., A. Traunecker, and K. Karjalainen. 1993. The T cell receptor ab
V-J shuffling shows lack of autonomy between the combining site and the constant domain of the receptor chains. Eur. J. Immunol. 23:586.
34. Wells, J. A. 1991. Systematic mutational analysis of protein-protein interfaces. In
Molecular Design and Modeling, Vol. 202. J. J. Langone, ed. Academic Press,
New York, p. 390.
35. Kasibhatla, S., E. A. Nalefski, and A. Rao. 1993. Simultaneous involvement of all
six predicted antigen binding loops of the T cell receptor in recognition of the
MHC/antigen peptide complex. J. Immunol. 151:3140.
36. Boitel, B., M. Ermonval, P. Panina-Bordignon, R. A. Mariuzza, A. Lanzavecchia,
and O. Acuto. 1992. Preferential Vb gene usage and lack of junctional sequence
conservation among human T cell receptors specific for a tetanus toxin-derived
peptide: evidence for a dominant role of a germline-encoded V region in antigen/
major histocompatibility complex recognition. J. Exp. Med. 175:765.
37. Ding, Y.-H., K. J. Smith, D. N. Garboczi, U. Utz, W. E. Biddison, and
D. C. Wiley. 1998. Two human T cell receptors bind in a similar diagonal mode
to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity
8:403.
38. Vasmatzis, G., J. Cornette, U. Sezerman, and C. DeLisi. 1996. TCR recognition
of the MHC-peptide dimer: structural properties of a ternary complex. J. Mol.
Biol. 261:72.
39. Arden, B. 1998. Conserved motifs in T-cell receptor CDR1 and CDR2: implications for ligand and CD8 co-receptor binding. Curr. Opin. Immunol. 10:74.
40. Glennon, J. D., and B. Sarkar. 1982. Nickel(II) transport in human blood serum.
Biochem. J. 203:15.
41. Lippard, S. J. 1995. At last: the crystal structure of urease. Science 268:997.
42. Kanyo, Z. F., L. R. Scolnick, D. E. Ash, and D. W. Christianson. 1996. Structure
of a unique binuclear manganese cluster in arginase. Nature 383:554.
43. Patten, P. A., E. P. Rock, T. Sonoda, B. Fazekas de St. Groth, J. L. Jorgensen, and
M. M. Davis. 1993. Transfer of putative complementary-determining region
loops of T cell receptor V domains confers toxin reactivity but not peptide/MHC
specificity. J. Immunol. 150:2281.
44. Bellio, M., Y.-C. Lone, O. de la Calle-Martin, B. Malissen, J.-P. Abastado, and
P. Kourilsky. 1994. The Vb complementary determining region 1 of a major
histocompatibility complex (MHC) class I-restricted T cell receptor is involved in
the recognition of peptide/MHC I and superantigen/MHC II complex. J. Exp.
Med. 179:1087.
45. Basketter, D. A., G. Briatico-Vangosa, W. Kaestner, C. Lally, and
W. J. Bontinck. 1993. Nickel, cobalt and chromium in consumer products: a role
in allergic contact dermatitis? Contact Dermatitis 28:15.
2731