Download Transcription Factor Veracity: 1s GBF3 Responsible for ABA

The Plant Cell, Vol. 8, 847-857, May 1996 O 1996 American Society of Plant Physiologists
Transcription Factor Veracity: 1s GBF3 Responsible for
ABA-Regulated Expression of Arabidopsis Adh?
G u i h u a Lu,' A n n a - L i s a Paul, D o n a l d R. McCarty, a n d R o b e r t
J.
Fer12
Program in Plant Molecular and Cellular Biology, Horticultural Sciences Department, 1143 Fifield Hall, University of
Florida, Gainesville, Florida 32611
Assignment of particular transcription factors to specific roles in promoter elements can be problematic, especially i n
systems such as the G-box, where multiple factors of overlapping specificity exist. In the Arabidopsis alcohol dehydfogenase
(Adh) promoter, the G-box regulates expression in response to cold and dehydration, presumably through the action
of abscisic acid (ABA), and is bound by a nuclear protein complex i n vivo during expression i n cell cultures. In this report,
we test the conventional wisdom of biochemical approaches used to identify DNA binding proteins and a s s e s their
specific interactions by using the G-box and a nearby half G-box element of the Arabidopsis Adh promoter as a model
system. Typical in vitro assays demonstrated specific interaction of G-box factor 3 (GBF3) with both the G-box and the
half G-box element. Dimethyl sulfate footprint analysis confirmed that the i n vitro binding signature of GBFB essentially
matches the footprint signature detected i n vivo at the G-box. Because RNA gel blot data indicated that GBFB is itself
induced by ABA, we might have concluded that GBFB i s indeed the GBF responsible in cell cultures for binding to the
Adh G-box and is therefore responsible for ABA-regulated expression of Adh. Potential limitations of this conclusion are
exposed by the fact that other GBFs bind the G-box with the same signature as GBF3, and subtle differences between
in vivo and in vitro footprint signatures indicate that factors other than or in addition to GBF3 interact with the half G-box
element.
INTRODUCTION
The G-box (5'-CCACGTGG-3') is a cis-acting element that is
present in the promoters of many plant genes and is responsive to diverse environmental stimuli (Katagiri and Chua, 1992;
Lu et al., 1992; Brunelle and Chua, 1993; Menkens and
Cashmore, 1994). More than 20 cDNA clones encoding G-box
binding factors (GBFs) have been isolated from severa1 plant
species (Brunelle and Chua, 1993; lzawa et ai., 1993, 1994).
GBFs are basic leucine zipper (bZIP) proteins that exhibit a
relaxed DNA binding specificity for sequences containing an
ACGT core (Schindler et al., 1992b; lzawa et al., 1993). The
ACGT core was thought to be essential for GBF binding, although sequences flanking the ACGT core affect the binding
specificity and affinity (Schindler et al., 1992b; lzawa et al.,
1993) of GBF interactions. The bZlP domain of GBFs as well
as the amino acid sequence adjacent to the basic domain appear to affect the DNA binding affinity as well (Schindler et
al., 1992b). Thus, there is a bewildering array of interaction
possibilities created by these various GBFs and the variations
on the flanking sequences surrounding the G-box core sequence. Because of the limited availability of GBF mutants,
a direct relationship between in vitro binding and in vivo acti-
Current address: Pioneer Hi-Bred lnternational Inc., Johnston, IA
50131.
To whom correspondence should be addressed.
vation exists only for the Opaque2 and RITA-1 bZlPs (Schmidt
et al., 1990, 1992; Varagona et al., 1991; lzawa et al., 1994).
Four of the GBF cDNA clones, GBF1, GBF2, GBF3, and
GBF4, were isolated from Arabidopsis by using the tomato small
unit of ribulose bisphosphate carboxylase (RbcS) G-box as
the oligonucleotide probe for protein interaction screening and
then by using GBFl as a hybridization probe (Schindler et al.,
1992a; Menkens and Cashmore, 1994). The N-terminalprolinerich domain of Arabidopsis GBFl activates gene transcription
in vivo (Schindler et al., 1992b). GBF4 has similarities to the
Fos oncoprotein in that it can bind to G-box elements only as
a heterodimer with GBF2 or GBF3 (Menkens and Cashmore,
1994). Arabidopsis GBF3 is highly expressed in roots but not
in leaves (Schindler et al., 1992a), making it a candidate for
tissue-specific regulation of the Arabidopsis alcohol dehydrogenase (Adh) gene (McKendree et al., 1990), which contains
a dyad G-box element (McKendree and Ferl, 1992) whose sequence falls within the range of G-box sequences strongly
bound by GBF3.
The G-box at position -214 in the Arabidopsis Adh promoter
is one of the functional cis-acting elements that is required
for constitutive expression in cultured cells and responsible
for abscisic acid (ABA)-related cold and dehydration induction in seedlings (McKendree and Ferl, 1992; Dolferus et al.,
1994). In vivo and in vitro DNA-protein interaction analyses
have demonstrated that the Arabidopsis Adh G-box interacts
848
The Plant Cell
with a nuclear protein complex (Ferl and Laughner, 1989;
DeLisle and Ferl, 1990; McKendree et al., 1990; Lu et al., 1992).
One part of the complex is composed of GF14s, which are 143-3 proteins that can be phosphorylated and can bind calcium
(Lu et al., 1992,1994). The GF14s do not bind the G-box directly
(Lu et al., 1992). Instead, the GF14s appear to interact physically with GBFs in a multiprotein complex. Although all of the
known Arabidopsis GBFs can bind to sequences similar to the
Adh G-box in vitro, GBFl does not bind with high affinity in
a random sequence pool (Schindler et al., 1992b), apparently
indicating that GBFl may not be the factor that binds to the
Adh G-box element in vivo. Whether GFB2 and GBF3 or other
GBF proteins are the in vivo Adh G-box binding factors remains
to be determined.
The -214 G-box in the Arabidopsis Adh promoter is similar
to the ABA response element present in the wheat Em gene
(Guiltinan et al., 1990). Adh is induced by ABA, and because
both cold and dehydration stresses have been correlated with
increased levels of ABA in plant tissues (Guy, 1990; Hetherington
and Quatrano, 1990; Jackson, 1991), a logical conclusion might
be that the G-box serves as the final receptor of ABA signals
involved in Adh gene expression. Thus, correct identification
of which GBF(s) binds to the Adh -214 G-box would lead to
increased understanding of the specificity of transcription factors involved in ABA signal transduction.
Within the context of the Arabidopsis Adh promoter, the -214
G-box element lies in proximity to a half-G-box element (Figure 1). The half G-box (5'-CCAAGTGG-3'; located at position
-190, just downstream of the G-box) lacks the ACGT core
thought to be necessary for bZlP binding but is necessary for
promoter activity in seedlings (Dolferus et al., 1994) and is
bound by nuclear proteins in vivo (Ferl and Laughner, 1989).
Given the proximity and sequence similarity of the half G-box
at position -190 and the dyad G-box at position -214, the region of the Adh promoter encompassing these elements
constitutes an interesting sequence for testing assumptions
and conclusions regarding biochemical assays for the cloning, identification, and characterization of factors associated
with regulating gene activity through G-box and G-box-like
elements.
This study addresses several questions about GBFs and
the abilities of biochemical techniques to distinguish among
them. First, do studies with the Adh G-box sequence identify
any new GBFs or provide further insights into the existing GBFs
that were recovered directly or indirectly by screening with the
tomato RbcS G-box element (Schindler et al., 1992a; Menkens
and Cashmore, 1994)? Second, do standard biochemical assays of protein-DNA interactions strengthen the case for
specificity between any of the GBFs and the Adh G-box? Third,
are GBFs involved in the interactions with the half-G-box element at position -190, even though that element lacks an ACGT
core? Finally, what are the limitations of existing biochemical
assays to identify unambiguously proteins that interact with
G-box-like sequences, and in particular, which GBF might be
involved in ABA signal transduction to the Adh promoter?
RESULTS
Cloning of the GBF3 cDNA
-214 G-bOx
Although many cDNA clones encoding G-box DNA binding
bZlP proteins have been isolated from a wide array of plant
species,
none have been isolated specifically with the Arabidop,__._._....___.__________
sis Adh G-box as a probe. By using the ligated Arabidopsis
GAATACTAGCAA+CCAAGTGG+GAG
Adh G-box oligonucleotide to screen a cDNA expression library
CTTATGATCGTTFGGTTCACCTTTCTC
......................... .
derived from cell suspension cultures, several positive cDNA
clones were identified from among 6 x 106 phage plaques.
P o s i t i o n Designation
4 3 i 1 do 1 ;3 4
Preliminary sequence analysis indicated that all were various
AAATGCCACGTGGACGAA
Adh G-box a t -214
Ytruncations
of the same cDNA. To recover potential full-length
RbcS G-box
ATCTTCCACGTGGCATTA
ACAAATGCCAC
ACGAATA
G-R
cDNAs, the same library was rescreened by hybridization with
ACAAATG
GTGGACGAATA
G-L
a fragment of one of the initial clones.
GM1
AAATGAAACGTGGACGAA
There are four stop codons in the 5' untranslated region of
GM2
AAATGCCAATTGGACGAA
GM3
AAATGCCACGGGGACGAA
GBF3, halting all three reading frames and resulting in the
Adh half G-box a t -,190
CTAGCAACGCCAAGTGGAAAGAG
separation of the truncated 0-glactosidase encoded by the
h g t l l vector from the predicted bZlP protein. Similar situations
Figure 1. Arabidopsis Adh G-Box Region.
are present in GBF1, GBF2, and GBF4 cDNAs (Schindler et
A portionof the Sflanking region of the ArabidopsisAdh gene isshown.
al., 1992a; Menkens and Cashmore, 1994). This may be why
The G-box at position -214 is indicated by the solid-line box. The half
only 5' truncated clones were recovered during the interacG-box at position -190 is indicated by the dotted-line box. The position screen, whereas full-length clones were recovered by
tions of the nucleotides in the G-box are indicated, as designated by
hybridization. The longest clone contains 1610 bp of cDNA and
lzawa et al. (1993). The oligonucleotides used in this study are indiis nearly full length, as indicated by RNA gel blot analysis showcated below the sequence and aligned with their homologous position
ing an mRNA of 4 . 6 kb. A single extended open reading frame
of the Adh sequence, with blanks indicating deletions in the right half
encodes a 41-kD polypeptide of 378 amino acids (Figure 2).
site (G-R) and in the left half site (G-L). Dolferus et al. (1994) refer to
Length heterogeneity exists in the 3'ends of the clones, where
the -214 G-box as G-box 1 and the -190 half G-box as G-box 2.
-220
I
-210
-190 half G-box
-200
I
-1 90
I
-180
I
Transcription Factor Veracity
ATTTGAATTTCTGGGTTTCTCTCTGTTTAAGCTTCTTCTTCTTCATCTTCTGCTTACGTT
TCTTCTTCAAGGAGCTTTCGGATTCTTGTAGAAAGAGTCATTGTTCTCTTGAGTGGGAAA
CCTTGAAACCATTCCTATGGGAAATAGCAGCGAGGAACCAAAGCCTCCTACCAAATCAGA
M G N S S E E P K P _ P T K S D
TAAACCATCTTCACCCCCGGTGGATCAAACAAATGTTCATGTCTACCCTGATTGGGCAGC
K P S S P P - V D Q T N V H V Y P D W A A
TATGCAGGCATATTATGGTCCAAGAGTAGCAATGCCTCCTTATTACAATTCAGCTATGGC
H Q A Y Y G P R V A M P P Y Y N S A M A
TGCATCTGGTCATCCTCCTCCTCCTTACATGTGGAATCCTCAGCATATGATGTCACCATC
A S G H P P P P V M W N P Q H M M S P S
TGGAGCACCCTATGCTGCTGTTTATCCTCATGGAGGAGGAGTTTACGCTCATCCCGGTAT
G A P Y _ A A V Y P H G G G V Y A H P G I
TCCCATGGGATCACTGCCTCAAGGTCAAAAGGATCCACCTTTAACAACTCCGGGGACGCT
P M G 3 L P Q G Q K D I P P L T T P G T L
TTTGAGCATCGACACTCCTACTAAATCTACAGGGAACACAGACAATGGAITGATGAAGAA
L S I D T P T K S T G N T D N G L M K K
GCTGAAAGAGTTTGATGGGCTTGCTATGTCTCTAGGAAATGGGAATCCTGAAAATGGTGC
L K E F D G L A M 3 L G N G N P C N G A
AGATGAACATAAACGATCACGGAACAGCTCAGAAACTGATGGTTCTACTGATGGAAGTGA
D E H K R S R N S S E T D G 5 T D G S D
TGGGAATACAACTGGGGCAGATGAACCGAAACTTAAAAGAAGTCGAGAGGGAACTCCAAC
G N T T G A D E P K L K R S R E G T P T
AAAAGATGGGAAACAATTGGTTCAAGCTAGCTCATTTCATTCTGTTTCTCCGTCAAGTGG
K D G K Q L V Q A S S F H S V S P S S G
TGATACCGGCGTAAAACTCATTCAAGGATCTGGAGCTATACTCTCTCCTGGTGTAAGTGC
D T G V K L I Q G S G A I L S P G V S A
AAATTCCAACCCCTTCATGTCACAATCTTTAGCCATGGTTCCTCCTGAAACTTGGCTTCA
N S N P F M S Q S L A M V P P E T W L O
GAACGACAGAGAACTGAAACGGGAGCGAAGGAAACAGTCTAATAGAGAATCTGCTAGAAG
E L
R E R R K Q S
R E S A R Rj
GTCAAGATTAAGGAAACAGGC
,GGAAACACGCCGACACACAAGAACJC.TCC
C
JGCTAGGAAAGTGGAAGCCTIGAC
60
120
180
240
300
360
420
480
540
600
660
720
780
840
900
960
1020
[_________
?
Rt
R
R K | Q A E T E E ( L ) AA R K V E A ( L ) T
AGCCGAAAACATGGCATJI^GATCTGAACTAAACCAACJTAATGAGAAATCTGATAXACT
1080
JGGCATTAAGATCTGAACTAAACCAACI
A E N M A ( L ) R ) S E L N Q ( L ) N E K S D K ( L )
AAGAGGAGCAAATGCAACCTIGTTGGACAAACTGAAATSCTCGGAACCCGAAAAGAGAST 1140
R G A N A T U O L D K L K C S E P E K R V
CCCCGCAAATATGTTGTCTAGAGTTAAGAACTCAGGAGCTGGAGATAAGAACAAGAACCA 1200
P A N M L S R V K N S G A G D K N K N Q
AGGAGACAATGATTCTAACTCTACAAGCAAATTCCATCAACTGCTCGATACGAAGCCTCG 1260
G D N D S N S T S K F H O L L D T K P R
AGCTAAAGCAGTAGCTGCAGGCTGAATCGATGGTAATTCATGTCGATTTCTACTTAATTT
1320
A K A V A A G *
GTCGACATAAACAAAGAAAATAAGTGCTACTAATTTCAGAAAAACTTGATAGATAGATAG
TATAGTAGAGAGAGAGAGAGAGAGAGAGGTGTGATGATTATTGATCTATAAATTTTCGGA
GAGAGAGAGGGAGAAAGAGAAACTTTTCCTCCAGATCAAAATTTGGTGTTATGGTTTGTT
ACTGTTAATATAGAGAGGCTTTTCTTTTTTTATAAAATGGCTTCCTTTGTTGC^TTTCCT
TGTTTTAGACCTGATGTAATTTTATGAAATCGGTGTTATTGCTlfSCGTJf*
1380
1440
1500
1560
1611
849
Both cold and dehydration stresses are apparently related to
increased levels of ABA (Guy, 1990; Hetherington and Quatrano,
1990; Jackson, 1991). To address the possible relationships
among Adh expression, the G-boxes, GBF3, and ABA, we examined the effects of various treatments on the expression
of GBF3 in cell suspension cultures. As shown in Figure 3,
treatment with additional ABA resulted in a fourfold induction
of GBF3 transcript accumulation.
At this point, the data indicated that we had cloned a known
GBF by using the G-box found within the context of the Adh
promoter as a probe in a standard protein-DNA interaction
screen. Although the cDNA clones extended existing information on GBF3, we failed to find any new or unique GBFs due
to any novel features that the Adh G-box might have. However,
by conducting the screen under stringent interaction conditions and thereby finding only one species of interacting clone,
combined with the data on induction characteristics of GBFS
mRNA, we made the tentative inference that GBF3 is in fact
the G-box factor that interacts with the Adh G-box in suspension cells. Because GBF3 is itself induced by ABA, the extended
conclusion would be that GBF3 delivers ABA-related signals
to the Adh regulatory apparatus through binding to the G-box.
Figure 2. Arabidopsis GBF3.
The sequence of the longest GBF3 cDNA is indicated, with the nucleotides numbered to the right. The derived amino acid sequence is
indicated below the nucleotides in the single-letter designation.
The proline-rich domain is underlined, the basic region is boxed, and
the leucine residues of the zipper region are circled. The locations
of the various 3' ends of the cDNAs are indicated by arrows near the
end of the sequence. The position of the N-terminal deletion of GBF3a
and GBF3b is indicated by a bracket at nucleotide 455. The position
of the C-terminal deletion of GBF3b is indicated by a bracket at nucleotide 1041. The stop codon is indicated by an asterisk. The GenBank
accession number is U151850.
poly(A) tails of up to 150 bases are found at three different sites
in the cDNA clones. All of the positive clones are homologs
of GBF3, indicating a relative abundance of GBF3 cDNA in
the suspension culture cells, which also express Adh (Ferl and
Laughner, 1989).
The derived primary amino acid sequence of these clones
is, for the most part, identical with that of GBF3 (Schindler et
al., 1992a). This full-length version of GBF3, however, contributes unique information on GBF structure in that it apparently
completes the proline-rich N terminus of the protein and provides the 5' nontranslated region.
Expression of GBF3 mRNA
Adh expression is regulated by cold and dehydration mediated through the -214 G-box element (Dolferus et al., 1994).
C
IAA
ABA
minus
2,4-D
cold
Figure 3. Accumulation of GBF3 mRNA in Suspension Cultures.
An RNA gel blot hybridized with GBF3 is shown, together with a bar
graph of the quantitative data derived from dot blot hybridizations of
three replicated experiments. The data were normalized against actin
mRNA (solid bars) and rRNA (open bars). The error bars indicate the
standard deviation for the three replicate experiments in each set. Cell
suspension cultures were either untreated (C) or treated with 20 nM
indolacetic acid (IAA) or 50 nM (ABA) for 24 hr. Additional treatments
included removing 2,4-D from the media (minus 2,4-D) or placing the
cultures at 4°C (cold) for 24 hr before isolation of total RNA.
850
The Plant Cell
Purification from Escherichia coli and Biochemical
Characterization of GBF3
To characterize more fully the interactions between GBF3 and
the Adh G-box, two forms of the G BF3 protein were expressed
and purified from E. coli. The full-length GBF3 protein was
largely insoluble and presented several purification problems.
However, N-terminal truncation at amino acid 106 greatly enhanced the solubility of recombinant GBF3. Two truncations
were produced and are shown in Figure 4. GBF3a contains
amino acids 106 to the C terminus at 382, whereas GBFSb
contains amino acids 106 to 302 and is thus additionally truncated at the C terminus in the middle of the leucine zipper
domain. The GBF3a and GBFSb truncations were expressed
in the pET-15 system and purified from the soluble lysate by
immobilized metal affinity chromatography made possible by
the short N-terminal histidine tract provided by the vector.
The truncated GBF proteins were purified further by using
Superdex-75 column chromatography. GBF3a and GBF3b were
highly purified as determined by staining after SDS-PAGE (Figure 4).
The final purification using Superdex-75 column chromatography confirmed the dimeric structure of both GBF3a and
GBF3b, even though GBFSb is missing much of its leucine
zipper domain. GBFSa resolved as a native protein peak at
~69 kD (data not shown), whereas the protein in the peak fractions consisted of a band at ~34 kD, as determined by
M
46kD
GBFSa
GBFSb
f
30kD
21kD
GBF3
GBFSa
GBFSb
Figure 4. Purification and Characterization of Recombinant GBF3.
Two peak fractions from Superdex-75 chromatography of recombinant
GBF3a and GBF3b were analyzed by using SDS-PAGE with the fol-
lowing markers in lane M: ovalbumin at 46 kD, carbonic anhydrase
at 30 kD, and trypsin inhibitor at 21 kD. Intervening lanes between those
of GBFSa and GBFSb were removed. Diagrammatic representations
of the final GBF recombinant proteins are shown below the gel.
SDS-PAGE (Figure 4). The truncated GBF3b protein resolved
as peak at ~50 kD on the Superdex-75 column and produced
a protein doublet at ^26 kD after SDS-PAGE, indicating that
GBFSb also exists as a homodimer despite its truncated leucine zipper. Formation of the doublet band is a consistent but
poorly understood phenomenon in the production of GBFSb.
Additional confirmation of native dimer formation was obtained
by the treatment of native recombinant GBF3 with 10 mM
glutaraldehyde, which resulted in dimer-sized peptides when
analyzed by SDS-PAGE (data not shown).
Specific Binding of GBF3 to the G-Box and Half G-Box
Standard electrophoretic mobility shift assays were used to
determine the binding parameters of GBF3 to the G-box at position -214 and the half G-box at position -190, as found in
the context of the Adh promoter. The in vivo dimethyl sulfate
(DMS) footprinting assay had demonstrated that both the G-box
at -214 and the half G-box at -190 were bound by nuclear
proteins (Ferl and Laughner, 1989). As shown in Figure 5A,
both labeled the -214 G-box element, and the -190 half-Gbox element formed single retarded protein-DNA complexes
with purified GBFSa. The more severely truncated GBFSb also
formed a single shifted complex with both sites. These complexes were stable in the presence of 1000-fold excess poly(dl-dC) in the binding reaction as a nonspecific competitor, and
the binding was dependent on the concentration of the added
GBF protein for all four protein/site combinations.
Competition assays further defined the specificities and affinities of the GBF3 proteins for G-box elements. As shown
in Figure 5B, the -214 G-box-GBF3a complex was reduced
by competition with the 100- to 200-fold unlabeled flbcS G-box
element, indicating that the complex is quite specific for the
5'-GCCACGTGGA-3' extended core G-box sequence (see also
Figure 1). However, neither the right half site (G-R) nor the left
half site (G-L) of the Adh G-box competed for GBFSa binding
(Figure 5B), initially suggesting that the intact dyad G-box motif
is essential for the binding of GBFSa and that half-G-box sites
are not sufficient to create a binding site for GBF3. To characterize further the important nucleotides in the central G-box
core motif, three additional G-box mutants (GM1, GM2, and
GM3) and the -190 half G-box (see also Figure 1) were used
in the competition assay. None of the mutants could compete
with labeled G-box oligonucleotide for binding to GBFSa, even
at 200-fold excess of the competitor (Figure 5B, top). These
data suggest that (1) the two C residues at positions -3 and
-2 of the G-box cannot both be mutated and still maintain
strong binding competency (see GM1); (2) the central CG pair
at positions -0 and 0 of the dyad cannot be mutated as a pair
and still maintain strong binding competency (see GM2); (3)
the T residue at position 1 of the G-box is essential for strong
binding competency (see GM3); and (4) the C residue at position -0 of the G-box also is essential (see -190 half G-box).
The truncated GBFSb protein demonstrated a similar set of
binding competitions, although the apparent binding was
Transcription Factor Veracity
-214G-box
GBF3b
GBF3a
B
-190 half G-box
-
851
GBF3b GBF3a
COMPETITIONS
0)
g
2
0.
Q.
O
O
S
T— fsj
Q O QQ Q O O O O O OO
OO O O O O O O O O O O
T— CM
T— C M » — C N J » — C M * — C N l T — CM
X
2
6
I*
to .a
"6
Figure 5. Electrophoretic Mobility Shift Assays of GBF3.
(A) The binding of GBF3a and GBF3b to the G-box and the half G-box in the presence of poly(dl-dC) as nonspecific competitor was analyzed
by using electrophoretic mobility shift assays. At left and right, the first lanes contain no GBF protein, and the next three lanes contain 1, 3, and
5 ^L of recombinant GBF protein extract. Horizontal triangles indicate the increasing protein.
(B) Electrophoretic mobility shift assays were conducted with the addition of 100- and 200-fold excess of specific competitor sequences, as indicated at the top. The designations of the competitors are detailed in Figure 1. In the top row, the -214 G-box is the labeled probe and GBFSa
is the protein. In the middle row, the G-box is the probe and GBFSb is the protein. In the bottom row, the -190 half G-box is the probe and GBF3a
is the protein.
generally weaker, revealing some slight competition by GM1,
GM2, and GM3 (Figure 58, middle). Nonetheless, similar clear
conclusions about the binding specificities of GBF3 were obtained from both GBF3a and the additionally truncated form
GBF3b. Thus, binding specificity appears to be determined
by the bZIP region of the GBFs, and truncation of the leucine
zipper may slightly reduce overall DNA binding capacity but
does not affect sequence specificity.
All of the competition data presented here are consistent
with previous data on GBF binding to G-box-like sequences
and, in the context of our current work, immediately call into
question the earlier conclusion that GBF3 specifically interacts with the -190 half-G-box element of Adh. However,
competition assays with the -190 half G-box as the labeled
probe revealed a second layer of specificity in GBF3-DNA interactions. When the -190 half G-box was used as the probe
(Figure 5B, bottom), it was quickly reduced by competition with
the RbcS G-box. This is in keeping with the failure of the half
G-boxes to compete for binding to the full G-box. However, binding to the -190 half G-box was not competed by the G-box
deletions (left half site and right half site) or GM2.
These data are consistent with a conclusion that the -190
half G-box is indeed a specific binding site for GBFS. However, the susceptibility of the -190 half G-box to competition
suggests an overall affinity for GBF3 much lower than that of
the complete dyad -214 G-box. In addition, the competition
data with the -190 half G-box as a probe indicate a hierarchy
of importance to binding for several of the internal residues
of the G-box: (1) the central CG pair at positions -0 and 0 cannot both be mutated and maintain binding to GBF3, because
GM2 fails to compete even with the -190 half G-box; (2) the
CC pair at positions -3 and -2 may both be mutated and
maintain some binding activity, because mild competition was
seen with GM1; and (3) the T residue at position 1 is the least
required of the central elements tested, because GM3 nearly
fully competed for binding. The main conclusion from these
data is that both the -214 dyad G-box and the -190 half G-box
are specific target sites for GBFS binding.
DNase I Footprints
The ability of GBF3 to bind specifically to the -214 G-box and
the -190 half G-box was further examined by DNase I footprint
analysis by using GBF3a and 5'end-labeled double-stranded
DNA extending from positions -107 to -300 of the Adh 5' flanking region. Figure 6 shows the footprints generated by
increasing concentrations of GBF3a. The bottom strand footprints of a 20-fold range of concentration of GBF3a are
examined in Figure 6A. A clear and distinct pattern of DNase
I footprints is evident, with each individual footprint characterized by a dramatic hypersensitivity at its 3' terminus. At low
GBFSa concentrations, a DNase I footprint can be observed
over the -214 G-box, whereas the -190 half G-box is largely
unoccupied. However, at higher concentrations, footprinting
is evident over both the -214 G-box and the -190 half G-box.
Examination of the increase in footprint strength as a function
of increasing GBFSa concentration indicates an ~10-fold difference in binding affinity for GBFSa to the dyad -214 G-box
compared with the -190 half G-box (compare Figure 6A, lanes
852
The Plant Cell
B
Bottom Strand
.1 .5 1 5 0
G [GBF3a] G
0
Top Strand
1 2 4 8
0
-190 half-G-box footprint is evident only at relatively high GBF3
concentrations. No obvious evidence for cooperativity in binding at the two sites was observed, because the linear increase
in GBFSa concentration produced an approximate linear increase in the -190 half-G-box footprint (as measured by the
disappearance or gain of bands within the footprints of Figure
6B), even while the -214 G-box was fully occupied. These
footprinting data strengthen an emerging model in which GBF3
binds to both the -214 G-box and the -190 half-G-box elements in cultured cells, and the -190 half G-box represents
a specific but lower affinity site for GBFS binding.
DNA Binding Signatures of GBF3 at the G-Box
and Half G-Box
As a final test of specificity and identity, the in vitro DMS footprinting signature of GBFSa was compared directly with the
DMS signature obtained by in vivo footprinting of Arabidopsis
suspension cells. The in vitro and in vivo DMS footprint signatures shown in Figure 7 were obtained from separate
experiments. Therefore, the run lengths are different but the
patterns of G-residues are directly comparable. Also, because
the in vivo footprinting procedure involves hybridization of
genomic DNA electrotransferred from sequencing gels, the
in vivo footprints are somewhat less well resolved.
Bottom Strand
vitro
vivo
*****
- - - - t
« , * * * •
fttttt
-226
-217/168
-214°
Figure 6. In Vitro DNase I Footprint Analysis of GBF3 in the Adh
Promoter.
(A) The binding of GBF3a to the bottom strand of the Adh promoter
is demonstrated by DNase I footprint analysis.
(B) The binding of GBF3a to the top strand of the Adh promoter is shown.
For both (A) and (B), the marker lane (G) and positions of selected
G residues are indicated, and the positions of the -214 dyad G-box
and the -190 half G-box are indicated by solid and dotted boxes, respectively. The relative concentration of GBF3a is indicated above each lane.
.1 and 1 as well as lanes .5 and 5). This conclusion regarding
binding affinities of the G-box and the half G-box is consistent
with the earlier conclusion drawn from competition data.
Footprinting of the top strand was conducted over a tighter,
eightfold range of GBF3a concentrations to address the possibility of cooperativity in the binding of GBFs to the nearly
adjacent -214 and -190 sites. As shown in Figure 6B, a distinct
pair of GBFSa footprints is evident again, with the characteristic hypersensitivity at the 3' terminus of each footprint. The
-193,
-192*
Top Strand
vivo vitro
- -182
S -186/7
-189
g-210/11
°-213
•=-218
-225
-179
Figure 7. Comparison of in Vitro and in Vivo DMS Footprint Signatures.
DMS footprint signatures for the G-box region of the Adh promoter are
shown for the bottom strand (left) and top strand (right). The in vivo
footprints are from McKendree et al. (1990); the top strand in vivo lanes
have been electronically inverted to correspond to the direction of the
other lanes. Lanes designated (-) indicate naked DNA analyses that
demonstrate the reactivities of G residues in the absence of proteins.
Lanes designated ( + ) indicate that GBFSa was added to the reaction
during the in vitro analyses or that intact cells were treated in the in
vivo analyses. The regions of the -214 dyad G-box and the -190 half
G-box are indicated by solid and dotted boxes, respectively, and specific interactions are indicated by filled ovals for enhancements and
open ovals for protections. In vivo interactions at positions -182 and
-194 are italicized and indicated by dotted ovals.
Transcription Factor Veracity
As shown in Figure 7, the DMS footprint of in vitro GBF3a
interactions at the -214 G-box is very similar to the in vivo
footprint for both the bottom and top strands. At the -214 G-box,
there is a bottom strand enhancement at position -217 and
protections at positions -216 and -214 visible in the in vitro
GBF3a footprint. The same pattern can be observed in the
in vivo footprint, and although the doublet at positions -217
and -216 is difficult to resolve in the in vivo footprint, the pattern is clearly consistent with the in vitro footprint of GBF3a.
On the top strand, protections at positions -218, -213, and
-211 and a slight enhancement at position -210 characterize the GBF3a footprint in vitro as well in vivo.
A set of qualitatively similar interactions also characterizes
the -190 half-G-box footprints. In both the in vivo and the in
vitro footprints, there is protection of position -192 and enhancement of position -193 on the bottom strand, as well as
protection of positions -187 and -189 and slight enhancement of position -186 on the top strand. In this case, however,
differences exist between the in vitro and in vivo footprints on
the top strand. The first involves a prominent protection at position -182 that is observed in vivo but not in vitro. The second
difference involves a more subtle protection at position -194
that is fairly well observed in vivo but difficult to establish in vitro.
Thus, the comparison of in vivo and in vitro DMS binding
signatures is consistent with the conclusion that GBF3 is the
GBF responsible for protein interactions with the -214 G-box
element of the Adh promoter region. However, the pattern of
interactions observed in vivo at the -190 half G-box and the
pattern produced by GBF3 in vitro are clearly not identical,
indicating the possibility that factors other than or in addition
to GBF3 may be responsible for in vivo interactions with that
element.
853
_-186
°-187
o-189
• -210
'-213
o-218
Top Strand
,-217
'-216
'-214
in •»
-193
o-192
Bottom Strand
Figure 8. In Vitro Footprint Signatures of GBF3a, GBFSb, and Maize
GBF1.
The G-box (-210 to -218) and half G-box (-186 to -193) regions of
DMS footprinting gels are shown, with the top strand at the top and
the bottom strand at the bottom. In vitro interactions are indicated by
filled and open ovals, as given in Figure 7. mGBFl, maize GBF1.
DNA Binding Signatures of Truncated GBF3
and Maize GBF1
To test further the veracity of these conclusions and as an additional approach to defining the discrimination limits of the
DMS footprint signature, the DMS footprints of GBF3b and
maize GBF1 on the Arabidopsis Adh promoter were determined. GBFSb lacks the entire C-terminal portion of GBF3 and
more than half of the leucine zipper, and thus GBFSb tests
the effect of the additional truncation on the DMS footprint signature of GBF3. Maize GBF1 is quite diverged from Arabidopsis
GBF3 in overall amino acid sequence but is similar within the
basic DNA binding region (deVetten and Ferl, 1995). Thus, the
binding signature of maize GBF1 essentially tests the effect
of substituting the entire protein outside of the basic region.
As shown in Figure 8, the DMS footprint signatures of maize
GBF1 and the truncated GBFSb are similar to that of GBFSa.
It appears then that the DMS footprint signature is a product
only of the intimate contacts that occur between DNA and the
basic region of GBFs and is insensitive to massive changes
in GBF structure outside of the basic region.
DISCUSSION
Studies of the G-box and G-box-like elements of the Arabidopsis Adh gene have led to questions regarding the signal
transduction pathways involving cold, dehydration, and ABA.
As the apparent DNA binding termini of these signaling pathways, GBFs play a major role in transducing signals to the Adh
promoter, and a clear understanding of which GBF interacts
with which Adh element becomes a key issue. However, these
sorts of fundamental issues surrounding the identification of
rrans-acting factors extend well beyond the current study and
present questions that could be addressed in any element-factor relationship.
Search for GBFs That Interact with Adh Finds
Only GBF3
Only GBF3 was recovered in the interaction screen of the library by using commonly accepted methods and stringencies.
854
The Plant Cell
Although some new information about GBF3 with regard to
its N-terminalsequences and its multiple 3’ends was obtained,
no new GBFs were recovered from the screen. Thus, it would
appear initially that the Adh G-box selectively identifies GBF3
from among the many bZlPs that are likely to be encoded within
the cDNA library. At this point in our study, GBF3 becomes
a candidate to be the GBF responsible for carrying signals
to Adh through specific interactions with the G-box elements.
GBF3 1s lnduced by ABA and Binds Specifically t o
G-Box Sequences
GBF3 mRNA accumulation is induced by ABA. The subsequent potential increase in the GBFB concentration supports
the idea that GBFB plays a role in conducting ABA-related signals to the Adh G-box. The electrophoretic mobility shift assay
and DNase I footprint analysis confirmed that GBF3 binds specifically to the dyad G-box at position -214 of the Adb promoter.
The leve1 of specificity (as demonstrated by competition assays using the Adh G-box as a probe and DNase I footprinting
of the Adh promoter) supports the conclusion that GBF3 is the
GBF that interacts with the Adh G-box in vivo and is consonant
with expectations based strictly on in vitro binding data (Izawa
et al., 1993). GBF3 also is capable of specifically interacting
with the half G-box at position -190, albeit at a lower overall
affinity. This conclusion is surprising primarily because the
-190 half G-box site lacks the ACGT central core thought to
be absolutely required for bZIP/GBF binding (Izawaet al., 1993).
in vitro DMS footprint signature of GBFB at the -214 G-box
matches the in vivo footprints within the limits of resolution
of the technique. Therefore, the primary conclusion might be
that GBF3 is responsible for binding to the -214 G-box in suspension cells, thereby bringing cold, dehydration, and perhaps
other ABA-related signals to the Adh promoter via interactions
with the -214 G-box.
The half G-box at position -190 appears to be a relatively
low-affinity site for GBF3 binding as defined by in vitro DNA
binding studies. These data alone might lead to the inference
that the GBF3 binding to the half G-box is weak. And because
the -190 half G-box lacks the ACGT core sequence, we might
speculate that a heterologous, non-GBF pairing partner is required to create a high-affinity interaction with the -190 half
G-box. Careful comparison of in vivo and in vitro footprints supports this conjecture. An obvious interaction at position -182
that was observed in vivo was not observed in vitro with GBF3,
and a more subtle interaction at postion -194 appeared to be
similarly absent in the in vitro footprint. Although position -182
is outside the generally accepted limits of the G-box sequence,
it does lie within the DNase I footprint of GBF. Do these observations mean that homodimeric GBFB is not the factor bound
to the -190 half G-box in vivo? At the very least, recombinant
GBF3 alone is not capable of reconstructing the entire footprint signature in the -190 half G-box.
The Value and Limits of Current Biochemical Methods
in General and DMS Footprinting Signatures
in Particular
Does GBF3 Bind t o the G-Box in Vivo?
The Arabidopsis Adh 5‘flanking region is one of the few plant
promoters to be footprinted in vivo. The intrinsic value of in
vivo DMS footprinting is twofold. First, clusters of interactive
G residues can identify sequences as potential cis-acting elements, thereby providing target sequences for mutational
analysis. In fact, the,G-box at position -214 and the half G-box
at position -190 both were identified initially by in vivo footprinting and then subsequently confirmed as cis-acting
elements by transgenic analyses (Ferl and Laughner, 1989;
McKendree and Ferl, 1992; Dolferus et al., 1994). Second, in
vivo DMS footprinting provides a DNA binding signature for
the protein-DNA interaction that occurs in the living cell. This
binding signature is defined by the pattern of enhancements
and protections observed in the footprinted region and is the
result of the presumably unique interactionsthat occur between
DNA binding proteins and their recognition sequences. An immediate application of in vivo footprinting would be the ability
to identify uniquely the protein-DNA interaction in vitro and
thereby confirm the identity of the factor responsible for the
in vivo footprint and the regulatory effect of the target cis-acting
element.
GBF3 meets all of the generally accepted in vitro criteria
for DNA binding specificity for the Adh G-box. In addition, the
Although supporting the possibility that GBF3 interacts with
the G-box and perhaps even the half G-box, DMS footprinting
itself cannot exclude other GBFs from a similar role. DMS footprinting cannot distinguish GBF3a from its more severely
truncated form, GBF3b. Therefore, it seems that protein domains outside of the bZlP region have little influence on the
DMS signature. The in vitro binding signature of maize GBFl
also is identical to that of GBF3. Because maize GBF1 shares
extensive homology with GBFB only in the basic region, it would
seem that any bZlP with sequence conservation to GBF3 in
the basic domain might leave the same footprint signature.
Although this has yet to be tested experimentally, there are
many bZlP proteins with basic region sequences quite similar to those of GBF3 and maize GBF1. These include at least
GBFl and GBF2 from Arabidopsis as well as EmBP-1, TAF-1,
CPRF-1, and CPRF-3 from other species (Izawa et al., 1993).
Can we determine which GBF is responsible for carrying
ABA-related signals to Adh? Given the apparent discrimination limits of DMS footprinting, the answer is clearly “no, not
yet.” At the least, all related GBFs should be tested to see
whether they bind this G-box with the same signature as GBF3.
We are now pursuing this experiment. It may be that all type
I GBF interactions (Izawa et al., 1993) will leave the same DMS
footprint signature on the Adh dyad G-box at position -214.
Therefore, it is possible that current biochemical methods that
Transcription Factor Veracity
allow comparison of in vivo and in vitro binding data would
not be able to distinguish among the GBFs and other bZlP
homologs likely to exist in any cell type.
Additional in vivo and in vitro methods are needed if the biochemical approach is to be relied on to identify uniquely a
specific protein-DNA interaction out of a family of possible interactions. Clearly, some in vitro methodscan and do distinguish
among GBFs: Arabidopsis GBF2 can be distinguished from
GBFB by methylation interference (Schindler et al., 1992b),
and tomato GBF9 can be distinguished from GBF12 and GBF4
by DNase I footprint analysis (Meir and Gruissem, 1994). However, neither methylation interference nor DNase Ifootprinting
can yet be done in vivo, hence limiting their application for
the purpose of correlating specific factors with specific responses and elements. Additional correlating methods, such
as assaying the effect of expression of a transcription factor
on reporter gene expression or the characterization of the
phenotypes of mutant transcription factors, would certainly help
to solidify the potential role(s) of transcription factors, but that
approach also may be limited in many cases by overlapping
expression patterns and activities of related family members.
Therefore, until the biochemical approaches are strengthened
or combined with clear mutant data, assignment of any transcription factor, particularly any GBF-like factor, to a unique
or specific function will remain a tentative and inexact correlative science.
Model for GBF lnteraction w i t h Adh
We propose the following model for transcription factor interactions in the -190 to -214 region of the Arabidopsis Adh
promoter (see Figure 9). For the dyad G-box at position -214,
a GBF is responsible for bringing ABA-related signals to the
promoter. GBF3 is a likely candidate, because it leaves the
proper footprint, is expressed in the proper tissues to control
Adh, and is itself induced by ABA. However, this conclusion
must be tempered by the observation that other GBFs may
leave the same signature, and until all GBFs and related bZlPs
are fully characterized with respect to expression patterns, induction by ABA, and DMS footprints, there is a possibility that
other factors may exhibit an equal or better claim to the role
of ABA-regulated expression of Adh. GBF3 alone also can specifically bind the half G-box at position -190 in vitro, but
differences in the in vivo and in vitro binding signatures suggest that factors other than or in addition to GBF3 deliver signals
to the -190 half-G-box element.
GBF3 delivers
ABA-related signals
to the G-box
-220
Factors other than
or in addition to GBF3
interact ai me half Gbox
-zoa
-210
855
-190
c;!..........
-180
ee.~..i , I
GAATACTAGCAA CCAA T AAAGRGCGTT
CTTATGATCGTT+:TTCC$TTCTCGCAA
A
A
ma
o DMS
I
7
protection
A
DNAse-l protection
DNAse-l enhancement
DMS enhancement
DMS orotection observed in vivo but not in vitro
Figure9. Summary of GBF lnteraction with the ArabidopsisAdh G-Box
Region.
The Arabidopsis Adh 5'flanking region from positions -180 to -220
is presented,along with the matching in vitro GBF3a and in vivo DMS
binding signatures at the -214 G-box (solid-line box) and -190 half
G-box(dotted-linebox). The model indicatesthat the binding of a single GBF type can accommodate all of the current in vitro and in vivo
DNA binding data for the -214 G-box. GBF3a is a likely candidate
and meets all of the criteria for binding, but the current technology
cannot prove that binding to the G-box is accomplished exclusively
by GBF3. Other GBFs may meet the current DNA binding criteria, so
suggestions as to which GBF is responsible for a particular signal remain based on correlative data. The binding at the -190 half G-box
may be accomplished in vivo by GBF3, but differences between in
vivo and in vitro interactionsat positions -194 and -182 suggest that
GBF3 binding alone cannot account for the in vivo interaction data.
Thus, factors other than or in addition to GBF3 are likely to be involved.
-214 G-box oligonucleotide (5'-AGAAATGCCACGTGGACGAATA-3
see Figure I)(Miskiminset al., 1985; Sambrooketal., 1989). Thedoubleand T4
stranded oligonucleotide was 5' end labeled with Y-~~P-ATP
polynucleotide kinase. The binding buffer was 10 mM Hepes buffer,
pH 8.0, containing 50 mM NaCI, 10 mM MgCIZ,0.1 mM EDTA, 1 mM
DTT, and 0.25% nonfatdry milk. Filterswere washed in three changes
0 After screenof binding buffer containing 100 mM NaCl for ~ 9 min.
ing 6 x 106bacteriophage plaques, positive clones were isolated and
plaquepurified.One of the positive cDNA clones (G-boxfactor 3 IGBF3J)
is 1494 bp long (Figure 2, positions 155 to 1649). Four positive clones
were obtained from 2 x 105 phages of the same library when
rescreened by hybridization with the EcoRI-BamHIfragment of the
5'region of the GBFB cDNA (Figure2, positions 155 to 450). The cloning and sequencing of the DNA inserts were as described previously
(Lu et al., 1992).
Expression and Characterization of Recombinant GBF3
METHODS
Library Screening and DNA Sequencing
An Arabidopsis thaliana suspension cell cDNA expression library was
screened for interaction with the ligated alcohol dehydrogenase(Adh)
The full-length GBF3 and truncated GBF3a and GBF3b expression
constructs were made as follows. The EcoRl fragment of the GBF3
cDNA was subcloned into the EcoRl site of the pET3C vector (Lu et
al., 1992) to express the full-length GBF protein. The 1221-bp GBFB
cDNA BamHl fragment (from position 450 to the BamHl site in the
pUC18 vector) and the BamHI-Bglllfragment (from position 450 toposition 1039)were subcloned into the BamHl site of pET15b (Novagen,
Inc., Madison, WI) to express truncated GBF3a and GBF3b. Correct
856
The Plant Cell
orientationswere confirmed by restrictionanalysis and DhJA sequencing. When expressed in fscherichia coli, the full-length GBF3 protein
mainlypelleted in inclusion bodies(data not shown). However,the truncated GBF3a (from residues 106 to 382) and GBF3b (residues 106
to 302) are largely soluble. To characterize the GBF3 binding activity,
the truncated GBF3a and GBF3bforms were expressedand purified.
The pET15b vector provides the expressed GBF3 proteins with a
histidine tract at their N termini, allowing purification by Ni+-charged
immobilized metal-affinity chromatographyacccjrding to the manufacturer’s protocol (Novagen). The peak fractions were combined and
further purified by Superdex-75(Pharmacia)column chromatography
in NEBD buffer (20 mM Hepes, pH 7.6, 100 mM KCI, 0.1 mM EDTA,
5 mM P-mercaptoethanol,and 10% glycerol). Superdex-75 chromatography and SDS-PAGE of purified GBF proteins were performed as
described previously (Lu et al., 1994).
Electrophoretic Mobility Shift Assay
The electrophoreticmobility shift assays were performed as described
previously(McKendreeet al., 1990). DNA oligonucleotideswere 5’end
labeled with Y-~~P-ATP
and T4 polynucleotide kinase (Sambrook et al.,
1989). A total of 15 pL of binding reactioncontained 0.5 ng of 32P-labeled
probe, 1 pg of poly(d1-dC),2 pg of tRNA, I pg of BSA, and GBF3a,
or GBF3b in NEBD buffer. After incubating for 15 min at room temperature, the sampleswere separated by electrophoresisin a nondenaturing
5% polyacrylamide gel. When used, the unlabeled competitors were
added to the reaction mixture before the labeled probe.
Probes for Dimethyl Sulfate and DNase I Footprinting
Double-strandedprobes for developingDNase I footprints and dimethyl
sulfate (DMS) footprintsignatureswere producedby polymerase chain
reaction, using oligonucleotides whose 5’ ends correspond to positions -300 (on the top strand) and -107 (on the bottom strand). One
of the oligonucleotides was end labeled with y3’P-ATP and T4 polynucleotide kinase (Sambrook et al., 1989) and then paired with the
unlabeled opposing primer for amplification of plasmid templates of
the Adh Yregion. The resulting strand-specific end-labeled probe was
purified by agarose gel electrophoresis and recovered by filter centrifugation and precipitation.
then maintainedfor 2 min at room temperaturebefore phenol-chloroform extraction and precipitation with ethanol and tRNA. After the
piperidine cleavage reaction, samples were separated by electrophoresis in 7 M urea-8% polyacrylamide sequencing gels (Maxam and
Gilbert, 1980).
The in vivofootprinting lanes that appear in Figure 7 are taken from
the same autoradiographsas in vivo DMS experiments of McKendree
et al. (1990). The film was scanned, and the top strand in vivo lane
was electronically inverted to align with the gel from in vitro treatments.
RNA Analysis
RNA was isolatedfrom Arabidopsissuspensioncells as described previously (Lu et al., 1992).Four days after subculture,cellswere subjected
to 4C
’ or were treated by the addition of 20 pM indolacetic acid or
50 pM abscisic acid (ABA), or by the removal of 2.3 pM 2,4-D for 24
hr with constant shaking. RNAwas isolatedfrom the treatedcells, separated on formaldehyde-agarose gels, and transferred onto a GeneScreen
membrane (Du Pont-New England Nuclear). Three replicate experiments also were analyzed by dot blot analysis. The blots were probed
by hybridization with the GBF3 cDNA, the Arabidopsis Atc4 actin gene
(Nairn et al., 1988),and rRNA at high stringency (Paul and Ferl, 1991).
Quantitative data of hybridization intensity were obtained from a Molecular Dynamics (Sunnyvale, CA) Phosphorlmager. The amount of
GBF3 mRNA was determined relative to the amount of rRNA and actin mRNA and graphed along with the standard deviation.
ACKNOWLEDGMENTS
We are grateful to Beth Laughner for her excellent technical assistance
and to Paul Sehnke for his advice on purification of recombinant proteins. We thank Ernie Almira in the Biotechnology Program DNA
Sequencing Core Laboratory at the University of Florida for DNA sequencing. This work was supported by National lnstitutes of Health
Grant No. ROI GM40061to R.J.F. This is manuscript No. R-05030 of
the Florida Agricultura1 Experiment Station.
Received November 8, 1995; accepted March 13, 1996.
DNase I Footprinting
REFERENCES
The labeled probe was incubated with purified GBF in NEBD buffer
for 15 min, and then DNase 1(20 nglpL) was added to the reaction.
After digestion for 60 sec at room temperature,the reactionwas stopped
by adding one-tenth volume of 5% SDS and 100 mM EGTA and vortexing. After two chloroform extractions, the DNA was precipitated by
the addition of me-tenth volume of 3 M NaOAc containing5 pg of tRNA
and 2.5 volumes of ethanol. Samples were separated by electrophoresis in a 7 M urea-8Vo polyacrylamide sequencing gel along with
the G reaction marker of the same fragment(Maxamand Gilbert, 1980).
DMS Footprint Signature Analysis
After incubating the labeled probe with protein in NEBD buffer (total
50 pL), 1 pL of fourfold-diluted DMS was added into the mixture and
Brunelle, A.N., and Chua, N.-H. (1993). Transcription regulatory proteins in higher plants. Curr. Opin. Gen. Dev. 3, 254-258.
DeLisle, A.J., and Ferl, R.J. (1990). Characterizationof the Arabidopsis
Adh G-box binding factor. Plant Cell 2, 547-557.
devetten, N.C., and Ferl, R.J. (1995). Characterizationof a maizeG-box
binding factor that is induced by hypoxia. Plant J. 7, 589-601.
Dolterus, R., Jacobs, M., Peacock, W.J., and Dennis, E.S. (1994).
Differential interactions of promoter elements in stress responses
of Arabidopsis Adh gene. Plant Physiol. 105, 1075-1087.
Ferl, R.J., and Laughner, B.H. (1989). In vivo detection of regulatory
factor binding sites of Arabidopsis thaliana Adh. Plant MOI.Biol. 12,
257-266.
Transcription Factor Veracity
Guiltinan, M.J., Marcotte, W.M., and Quatrano, R.S. (1990). A leucine zipper proteinthat recognizes an abscisic acid responseelement.
Science 250, 267-271.
Guy, C.L. (1990). Cold acclimationand freezingstress tolerance: Role
of protein metabolism. Annu. Rev. Eiochem. 41, 187-223.
Hetherington, A.M., and Quatrano, R.S. (1990). Mechanism of action of abscisic acid at the cellular level. New Phytol. 119, 9-32.
Izawa, T., Foster, R., and Chua, N.-H. (1993). Plant bZlP protein DNA
binding specificity. J. MOI.Eiol. 230, 1131-1144.
Iam,T., Foster, R., Nakajlma, M., Shlmamoto, K., and Chua, N.-H.
(1994). The rice bZlP transcriptional activator RITA-1 is highly expressed during seed development. Plant Cell 6, 1277-1287.
Jackson, M.B. (1991). Regulationof water relationshipsin flooded plants
by ABA from leaves, roots, and xylem sap. In Environmental Plant
PhysiologySeries: Abscisic Acid, Physiologyand Eiochemistry,W.J.
Davies and H.G.Jones, eds (Oxford, UK: Eios ScientificPublishers),
pp. 217-226.
Katagiri, E , and Chua, N.-H. (1992). Planttranscription factors: Present knowledge and future challenges. Trends Eiol. Sci. 8, 22-27.
Lu, G., DeLisle, A.J., devetten, N.C., and Ferl, R.J. (1992). Erain
proteins in plants: An Arabidopsis homologto neurotransmitterpathway activators is part of a DNA binding complex. Proc. Natl. Acad.
Sci. USA 9, 11490-11494.
Lu, G., devetten, N.C., Sehnke, P.C., Isobe, T., Ichimura, T., Fu, H.,
van Heusden, G.P.H., and Ferl, R.J. (1994). A single Arabidopsis
GF14 isoformpossessesbiochemicalcharacteristicsof diverse 143-3 homologues. Plant MOI. Eiol. 25, 659-667.
Maxam, A.M., and Gilbert, W. (1980). Sequencing end-labeled DNA
with base-specificchemicalcleavage. Methods Enzymol. 65,497-560.
McKendree, W.L., and Ferl, R.J. (1992). Functional elements of the
Arabidopsis Adh promoter include the G-box. Plant MOI.Biol. 19,
859-862.
McKendree, W.L., Paul, A.-L., OeLisle, A.J., and Ferl, R.J. (1990).
In vivo and in vitro characterizationof protein interactionswith the
dyad G-box of the Arabidopsis Adh gene. Plant Cell 2, 207-214.
857
Meir, I., and Gruissem, W. (1994). Nove1conserved sequence motifs
in plant G-box binding proteins and implicationsfor interactivedomains. Nucleic Acids Res. 22, 470-478.
Menkens, A.E., and Cashmore, A.R. (1994). lsolation and characterization of a fourth Arabidopsis G-box binding factor which has
similarities to FOS oncoprotein. Proc. Natl. Acad. Sci. USA 91,
2522-2526.
Miskimins, W.K., Robert, M.D., McClelland, A., and Ruddle, F.H.
(1985). Use of a protein-blottingprocedure and specific DNA probe
to identify nuclear proteinsthat recognizea regionof the transferrin
receptor gene. Proc. Natl. Acad. Sci. USA 82, 6741-6744.
Nairn, C.J., Winesett, L., and Ferl, R.J. (1988). Nucleotidesequence
of an actin gene of Arabidopsis thalíana. Gene 65, 247-257.
Paul, A.-L., and Ferl, R.J. (1991).Adhl and AdhP regulation. Maydica
36, 129-134.
Sambrook, J., Fritsch, E.F., and Maniatis, 1.(1989). Molecular Cloning: A Laboratory Manual. (Cold Spring Harbor, NY Cold Spring
Harbor Laboratory).
Schindler, U., Beckmann, H., and Cashmore, A.R. (1992a). TGAl
and G-box binding factors: Two distinct classes of Arabidopsis leucine zipper proteinscompete for the G-box-like element TGACGTGG.
Plant Cell 4, 1309-1319.
Schindler, U., Menkens, A.E., Beckmann, H., Ecker, J.R., and
Cashmore, A.R. (1992b). Heterodimerizationbetween light-regulated
and ubiquitouslyexpressedArabidopsis thaliana GEF bZlP proteins.
EMBO J. 4, 1261-1273.
Schmidt, R.J., Burr, F.A., Aukerman, M.J., and Burr, B. (1990).Maize
regulatory gene opaque-2encodes a proteinwith a "leucine-zipper"
matif that binds to zein DNA. Proc. Natl. Acad. Sci. USA 87,4640.
Schmidt, R.J., Ketudat, M., Aukerman, M.J., andHoschek, G. (1992).
Opaque-2 is a transcriptional activator that recognizes a specific
target site in 22-kD zein genes. Plant Cell 4, 689-700.
Varagona, M.J., Schmidt, R. J., and Raikhel, N.V. (1991). Monocot
regulatory protein Opaque-2 is localized in the nucleus of maize
endosperm and transformed tobacco plants. Plant Cell3, 105-113.
Transcription Factor Veracity: Is GBF3 Responsible for ABA-Regulated Expression of
Arabidopsis Adh?
G. Lu, A. L. Paul, D. R. McCarty and R. J. Ferl
PLANT CELL 1996;8;847-857
DOI: 10.1105/tpc.8.5.847
This information is current as of November 12, 2008
Permissions
https://www.copyright.com/ccc/openurl.do?sid=pd_hw1532298X&issn=1532298X&WT.mc_id=pd_hw1532298X
eTOCs
Sign up for eTOCs for THE PLANT CELL at:
http://www.plantcell.org/subscriptions/etoc.shtml
CiteTrack Alerts
Sign up for CiteTrack Alerts for Plant Cell at:
http://www.plantcell.org/cgi/alerts/ctmain
Subscription Information
Subscription information for The Plant Cell and Plant Physiology is available at:
http://www.aspb.org/publications/subscriptions.cfm
© American Society of Plant Biologists
ADVANCING THE SCIENCE OF PLANT BIOLOGY