Download The importance of Src homology 2 domain-containing

From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
IMMUNOBIOLOGY
The importance of Src homology 2 domain-containing leukocyte phosphoprotein
of 76 kilodaltons sterile-␣ motif domain in thymic selection and T-cell activation
Shudan Shen,1 Jasmine Lau,1 Minghua Zhu,1 Jianwei Zou,1 Deirdre Fuller,1 Qi-jing Li,1 and Weiguo Zhang1
1Department
of Immunology, Duke University Medical Center, Durham, NC
The Src homology 2 domain–containing leukocyte phosphoprotein of 76 kilodaltons
(SLP-76) is a cytosolic adaptor protein essential for thymocyte development and T-cell
activation. It contains a sterile-␣ motif (SAM)
domain, 3 phosphotyrosine motifs, a prolinerich region, and a Src homology 2 domain.
Whereas the other domains have been extensively studied, the role of the SAM domain in SLP-76 function is not known. To
understand the function of this domain, we
generated SLP-76 knockin mice with the
SAM domain deleted. Analysis of these mice
showed that thymocyte development was
partially blocked at the double-positive to
single-positive transition. Positive and negative thymic selection was also impaired. In
addition, we analyzed T-cell receptor (TCR)–
mediated signaling in T cells from these
mutant mice. TCR-mediated inositol 1,4,5triphosphate production, calcium flux, and
extracellular signal-regulated kinase activa-
tion were decreased, leading to defective
interleukin-2 production and proliferation.
Moreover, despite normal association between Gads and SLP-76, TCR-mediated formation of SLP-76 microclusters was impaired by the deletion of the SAM domain.
Altogether, our data demonstrated that the
SAM domain is indispensable for optimal
SLP-76 signaling. (Blood. 2009;114:74-84)
Introduction
The Src homology (SH)2 domain-containing leukocyte phosphoprotein of 76 kilodaltons (SLP-76) is a hematopoietic cell-specific
adaptor protein that plays a critical role in thymocyte development1,2 and T-cell receptor (TCR) signaling.3 The N terminus of
SLP-76 contains 3 tyrosine residues that are phosphorylated upon
TCR engagement.4 These phosphotyrosines serve as docking sites
for recruiting the Rac/Rho guanine nucleotide exchange factor
Vav,5 the Tec-family protein tyrosine kinase Itk,6-8 and the adaptor
protein Nck.9 The central proline-rich region of SLP-76 contains a
specific sequence (amino acids 224-244) that constitutively binds
to the adaptor protein Gads.10-12 An additional sequence (named P1
domain) in this proline-rich region also mediates a constitutive
interaction with phospholipase C (PLC)-␥1.13,14 The C-terminal
SH2 domain of SLP-76 provides TCR-dependent association with
TCR-dependent association with adhesion- and degranulationpromoting adaptor protein (ADAP)15,16 and hematopoietic progenitor kinase 1 (HPK1).17,18 Upon TCR engagement, SLP-76 is
phosphorylated by ␨-associated protein 70 (zap-70) and is recruited
to the membrane-associated adaptor protein linker for activation of
T cells (LAT) through the binding of Gads. Together, LAT and
SLP-76 nucleate a large signaling complex, which couples TCRproximal signaling to downstream biochemical events, such as
calcium flux and mitogen-activated protein kinase (MAPK)
activation.
SLP-76 is essential for the pre-TCR signaling that drives
thymocyte development through the double-negative (DN)3 checkpoint. SLP-76⫺/⫺ mice suffer from a profound block of thymocyte
development at the DN3 stage, and completely lack doublepositive (DP) thymocytes and mature T cells.1,2 Recent studies on
CD4Cre/SLP-76 conditional knockout mice show that SLP-76 also
plays an important role in mature TCR-mediated thymic selections,
because absence of SLP-76 in DP thymocytes prevents them from
further differentiating into single-positive (SP) thymocytes.19 The
function of SLP-76 in mature TCR signaling was studied primarily
in cell lines. Jurkat T cells deficient in SLP-76 (J14 cells) are
defective in TCR-dependent calcium flux and extracellular signalregulated kinase (ERK) activation, and are unable to activate the
interleukin (IL)–2 nuclear factor of activated T cells (NFAT)/
activator protein-1 (AP-1) promoter.3
The structural requirement of the SLP-76 domains for mediating thymopoiesis was studied using transgenic mice expressing
various forms of mutant SLP-76 on a SLP-76⫺/⫺ background. The
SLP-76 Y3F mutant harboring Y112F, Y128F, and Y145F point
mutations can partially rescue thymocyte development, as indicated by the accumulation of DN cells and the markedly reduced
number of DP and SP cells.20 The SLP-76 ⌬224-244 mutant, which
fails to interact with Gads, is able to restore thymopoiesis in
SLP-76⫺/⫺ mice relatively better than the Y3F mutant, but not to
wild-type levels.20,21 SLP-76 with a R448K point mutation in the
SH2 domain, which prevents it from binding to ADAP, is able to
efficiently reconstitute thymocyte development, suggesting that the
SLP-76/ADAP association is largely dispensable for thymopoiesis.20 However, in the absence of the SH2 domain, the mutant
SLP-76 can only partially rescue T-cell development.21 TCR
signaling, including calcium flux and ERK activation, is impaired
to various degrees in SLP-76⫺/⫺ mice reconstituted with Y3F,
⌬224-244, or ⌬SH2 SLP-76 mutants. T-cell proliferation and IL-2
production are markedly defective as well.20,21 Consistent with the
transgenic data, J14 Jurkat T cells expressing these SLP-76 mutants
exhibit a partial reconstitution of TCR signaling by each mutant.13
Despite the extensive structure-function analysis of SLP-76,
little is known about the role of the sterile-␣ motif (SAM) domain
in the N terminus of SLP-76. SAM domains were identified more
than a decade ago based on a conserved ⬃70-amino-acid domain in
Submitted September 5, 2008; accepted April 18, 2009. Prepublished online as
Blood First Edition paper, April 28, 2009; DOI 10.1182/blood-2008-09-177832.
payment. Therefore, and solely to indicate this fact, this article is hereby
marked ‘‘advertisement’’ in accordance with 18 USC section 1734.
The publication costs of this article were defrayed in part by page charge
© 2009 by The American Society of Hematology
74
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
14 eukaryotic proteins.22 They were predicted to feature a high
content of ␣-helices and to participate in protein-protein interactions.22,23 Since then, more than 1300 SAM-containing proteins
have been identified in various organisms, ranging from yeast to
humans. SAM domains can be found in all subcellular compartments and participate in a wide variety of cellular processes, from
signal transduction to transcriptional/translational regulation.24
Most of the SAM domains studied to date are involved in protein
interaction with different binding properties. Some SAM domains
can interact with themselves25-27 or with other SAM domaincontaining proteins26,28 to form oligomers. Others can interact with
non-SAM–containing proteins.29 In addition to their role in mediating protein association, certain SAM domains also exhibit RNAbinding properties.30,31 Given such versatility, understanding the
function of SAM domains relies heavily upon extensive experimental characterization in individual proteins.
The SAM domain of SLP-76 spans from amino acids 12 to 78 at
the N terminus. Its requirement for SLP-76 function in mediating
thymocyte development and TCR signaling has yet to be explored.
Interestingly, transgenic expression of the ⌬2-156 SLP-76 mutant,
in which the entire N terminus, including both the SAM domain
and 3 phosphotyrosine motifs, is deleted, fails to restore thymopoiesis in SLP-76⫺/⫺ mice, as indicated by the complete block in
thymocyte development at the DN3 stage.21 However, in SLP76⫺/⫺ mice reconstituted with the SLP-76 Y3F mutant, all subsets
of thymocytes could be found, albeit reduced.20 These data
suggested a potential role for the SAM domain in mediating
SLP-76 functions. In this study, we generated SLP-76 knockin
mice in which the SAM domain was successfully deleted. Our data
showed for the first time that the SAM domain of SLP-76 plays a
critical role in both thymic selection and TCR signaling.
ROLE OF SAM DOMAIN IN SLP-76 FUNCTION
75
FACS analysis and antibodies
Fluorescence-conjugated antibodies used in flow cytometry, such as anti-CD4,
CD8, CD25, CD44, CD62L, CD5, CD69, heat-stable antigen (HSA), TCR-␤,
and TCR-␥␦, were all purchased from eBioscience. For cell surface marker
staining, single-cell suspensions were prepared from mouse thymi, lymph nodes,
or spleens, and were incubated with the 2.4G2 antibody (anti-Fc␥ receptor)
before staining with different antibody mixtures. For intracellular staining of
SLP-76, cells were fixed, permeabilized, and then stained with anti-SLP-76 (Cell
Signaling Technology; no. 4958), followed by Alexa Fluor 488 goat anti–rabbit
immunoglobulin (Ig)G (Molecular Probes). Fluorescence-activated cell sorter
(FACS) data were acquired on FACSDiva (BD Biosciences) and analyzed with
the Flowjo software.
Cell separation
CD4⫹CD8⫹ DP thymocytes and CD4⫹CD44low T cells were sorted on
FACSDiva (BD Biosciences). The postsort purity was greater than 99%.
CD4⫹ T cells were purified using the EasySep Mouse CD4⫹ T Cell
Enrichment Kit (StemCell Technologies). The purity was greater than 90%.
Western blotting and immunoprecipitation
Methods
Sorted DP thymocytes or purified CD4⫹ T cells before or after stimulation
via CD3 were lysed in radioimmunoprecipitation assay buffer. For coimmunoprecipitation, thymocytes were lysed in 1% Brij lysis buffer; the lysates
were then incubated with sheep anti–SLP-76 polyclonal antibody as well as
protein G-coupled Sepharose beads for 1 hour. The protein lysates or
immunoprecipitates were resolved on sodium dodecyl sulfate–polyacrylamide
gel electrophoresis and transferred onto nitrocellulose membranes (BioRad). The membranes were then blotted with different primary antibodies.
The anti-pERK, pPLC-␥1, PLC-␥1, and SLP-76 antibodies were purchased
from Cell Signaling Technology. Anti-pSLP-76 (Y128) was purchased from
BD Biosciences. Anti-ERK2 was purchased from Santa Cruz Biotechnology. Anti-phosphotyrosine (4G10) and anti-Gads were purchased from
Upstate Biotechnology. For secondary antibodies, Alexa Fluor 680 anti–
mouse IgG (Molecular Probes) or IRDye 800 anti–rabbit IgG (Rockland)
was used accordingly. The membranes were scanned by the LI-COR
Odyssey infrared imaging system.
Generation of ⌬SAM–SLP-76 knockin mice
Cell proliferation and IL-2 production
The slp-76 genomic fragments were amplified from embryonic stem (ES)
cells by polymerase chain reaction (PCR), sequenced, and cloned into the
targeting plasmid (Figure 1). The short arm contains a 1.5-kb sequence
upstream of the slp-76 start codon and a modified exon 1 with the sequence,
ATGGCCTTGAAGAATTCAAG, at its 3⬘ end. The long arm comprises a
5-kb sequence in the intron between exons 3 and 4. G418-resistant ES cells
were screened by PCR and further confirmed by Southern blotting analysis
of the genomic DNA (digested with XbaI). The genomic probe used in the
Southern was amplified from ES cells using the following primers: 5⬘-CTC
CCT GGT GAT TTA TCT GAG G-3⬘ and 5⬘-ACC AGG ACA ATG ACA
ATG AAC A-3⬘. The correctly targeted ES cells were injected into
blastocysts to generate chimeric mice. To delete the PGK-Neo fragment,
chimeric mice were crossed with the ␤-actin Cre transgenic mice to
generate SLP-76m/⫹ mice. SLP-76m/⫹ mice were subsequently backcrossed
with C57BL/6 mice for at least 6 generations before analysis. Genotyping
of littermates was done by PCR using 3 primers, as follows: 5⬘-GAA TCA
GAA GAG CCA AGG ACA C-3⬘, 5⬘-ACA GTG GGT TGT GTC TGA
CAA G-3⬘, and 5⬘-GGT CTC TCC CAT CCC TTT ATT T-3⬘. To confirm
deletion of the sequence encoding the SAM domain, the slp-76 RNA was
amplified by reverse transcription (RT)-PCR using the following 2 primers:
5⬘-AGA GCA TCT GGG AAT CAG AAG A-3⬘ and 5⬘-GGC TTT CTG
TCT CCT CAA GAA-3⬘. C57BL/6 mice and ␤-actin Cre transgenic mice
were purchased from The Jackson Laboratory. HY-TCR transgenic mice
were purchased from Taconic Farms. Gads⫺/⫺ mice were provided by A.
Cheng. Mice were housed in specific pathogen-free conditions. All mice
were used in accordance with National Institutes of Health guidelines. The
experiments described in this study were reviewed and approved by the
Duke University Institutional Animal Care Committee.
Purified CD4⫹ T cells (for IL-2 production) or sorted CD4⫹CD44low
T cells (for proliferation) were seeded in U-bottom 96-well plates
(2 ⫻ 105 cells/150 ␮L) with the indicated concentration of plate-coated
anti-CD3 plus soluble anti-CD28 (1 ␮g/mL), or with phorbol myristate
acetate (PMA; 20 ng/mL) plus ionomycin (0.5 ␮g/mL). Triplicates were
performed in each assay. For IL-2 production, after 8 hours, 50 ␮L of
supernatant was collected from each well and subjected to IL-2 enzymelinked immunosorbent assay (ELISA). For cell proliferation, after 36 hours,
cells were pulsed with 1 ␮Ci of [3H]-thymidine for an additional 6 hours,
and were then harvested for scintillation counting. Cell proliferation was
represented by the counted radioactivity (counts per minute [CPM]). For
the IL-2 ELISA, anti–IL-2 capture antibody, biotinylated anti–IL-2 detection antibody, horseradish peroxidase–conjugated avidin, and recombinant
mouse IL-2 standard were all purchased from eBioscience. The tetramethylbenzidine peroxidase substrate kit was purchased from Bio-Rad. The
ELISA was performed according to the recommended protocol from
eBioscience.
Calcium flux
Total thymocytes or splenocytes were first loaded with Indo-1 (Molecular
Probes) in loading buffer (1⫻ Hanks balanced salt solution [HBSS] with
10 mM HEPES [N-2-hydroxyethylpiperazine-N⬘-2-ethanesulfonic acid]
and 1% fetal bovine serum [FBS]) for 30 minutes and then stained with
phycoerythrin anti-CD4 and fluorescein isothiocyanate anti-CD8 antibodies. Cells were then resuspended in loading buffer (107 cells/mL). Calcium
flux was initiated by the addition of biotinylated anti-CD3 (5 ␮g/mL) and
anti-CD4 (1 ␮g/mL) or anti-CD8 (1 ␮g/mL), followed by cross-linking
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
76
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
SHEN et al
Figure 1. Generation of ⌬SAM–SLP-76 knockin mice. (A) Illustration of the ⌬SAM–SLP-76 knockin targeting strategy. The first 6 slp-76 exons are indicated. The initiation
codon (*) is at exon 1. The SAM domain spans from exons 1 to 4. Part of exon 1, along with exons 2 and 3, is replaced by PGK-Neo, which is later deleted upon crossing with
␤-actin Cre transgenic mice. Œ, Represent the Loxp sites. P1 and P2 represent PCR primers used for ES clone screening. P⬘ represents a probe used in Southern blotting
analysis to confirm correctly targeted ES clones. X ⫽ Xba⌱, the restriction endonuclease used to digest genomic DNA of ES cells for Southern blotting. (B) Southern blotting
analysis of genomic DNA from 5 ES cell clones (lanes 1-5) and wild-type ES cells (lane 6). (C) RT-PCR products from SLP-76m/⫹ and SLP-76m/m thymocytes using 2 primers
flanking the deleted region. (D) SLP-76 protein expression. DP thymocytes from SLP-76⫹/⫹, SLP-76m/⫹, and SLP-76m/m littermates were FACS sorted and subsequently lysed.
Postnuclear lysates were subjected to Western blotting with anti-SLP-76. Anti-PLC-␥1 blot is used as a loading control. (E) Intracellular staining of SLP-76 in CD4⫹ splenic
T cells from SLP-76m/⫹ (solid line) and SLP-76m/m (dotted line) littermates. The gray area represents staining control using B220⫹ lymphocytes.
with streptavidin (25 ␮g/mL; Sigma-Aldrich). Ionomycin (2 ␮g/mL; SigmaAldrich) was used to induce TCR-independent calcium flux. Calcium flux
was assayed by monitoring the fluorescence emission ratio at 405/510 nm
with FACStar (BD Biosciences) and analyzed using the Flowjo software.
For the intracellular calcium release assay, a modified loading buffer
(Ca2⫹-free 1 ⫻ HBSS with 10 mM HEPES, 1% FBS, and 5 mM ethyleneglycoltetraacetic acid [EGTA]) was used.
Inositol 1,4,5-triphosphate assay
Total thymocytes or purified CD4⫹ T cells were either left untreated or
stimulated by CD3 cross-linking at 37°C for 2 minutes. The incubation was
terminated with an equal volume of ice-cold 20% (wt/vol) trichloroacetic
acid (Sigma-Aldrich). The soluble fraction was then washed 3 times with
10 volumes of water-saturated diethyl ether to eliminate the acid. Inositol
1,4,5-triphosphate (IP3) levels were measured using a GE Healthcare IP3
assay kit (TRK1000). The procedures are described in the manual provided
by the manufacturer.
20 seconds after the cells made contact with the coverslip. Alternatively,
cells were added into the chamber, centrifuged onto the coverslips, and
incubated at 37°C for 10 more minutes to allow maximal activation. The
live cell imaging was performed on a Zeiss Observer D1 station equipped
with a CoolSNAPHQ charge-coupled device camera (Roper Scientific) and a
high-speed automatic objective stage for multiple Z stack recording. The
images were collected with 40⫻ objective lens and 2.5⫻ camera zoom.
For each cell at each time point, GFP data were collected over
21 continuous vertical Z positions bracketing the cell/coverslip interface.
Images corresponding to the interface were then identified within the
stacks. To calculate the average intensity of the clusters, the Z stack data
were first processed by 3D deconvolution using the AutoQuant X software
(Media Cybernetics). Average fluorescence of the 2 Z positions immediately before and after the interface was subtracted from the image
corresponding to the interface. The brightness of the clusters was represented as the average intensity per pixel. Unless otherwise indicated, all
imaging manipulation and analysis were done using the MetaMorph
software suite (Molecular Probes).
SLP-76 clustering and cellular imaging
The cDNA sequences encoding human wild-type SLP-76 or ⌬SAM–
SLP-76 (with amino acids 12-78 deleted) were cloned into pEGFP-N3
vector to express SLP with green fluorescent protein (GFP) fused at the
C terminus. J14 cells were transfected with the pEGFP–SLP-76 or
pEGFP–⌬SAM–SLP-76 plasmids by electroporation. GFP⫹ cells with
comparable fluorescence intensity were sorted by FACS. The T-cell
spreading assay was performed, as previously described,32 with some
modifications. Coverslips were sequentially coated with biotinylated poly(Llysine), streptavidin, and biotin anti–human CD3⑀ antibody (UCHT1).
Such treated coverslips were then mounted onto a holder so that the
stimulatory side served as the bottom of a chamber. Sorted GFP⫹ J14 cells
were loaded into the chamber, and imaging data were collected every
Results
Generation of SLP-76 knockin mice
To understand the role of the SAM domain in SLP-76–mediated
signaling, we generated knockin mice that express a SAM-domain–
truncated form of SLP-76. The targeting strategy is illustrated in
Figure 1A. The SAM domain of SLP-76 spans from amino acids
12 to 78, and its corresponding genomic sequence covers part of
both exons 1 and 4, and the entirety of exons 2 and 3. The intron
between exons 3 and 4 is approximately 14 kb long, making
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
ROLE OF SAM DOMAIN IN SLP-76 FUNCTION
77
Figure 2. Thymocyte development in ⌬SAM–SLP-76 knockin mice. (A) Total numbers of different thymocyte populations from 4-week-old SLP-76m/⫹ and SLP-76m/m
littermates. Five mice for each genotype were analyzed. Statistical analysis was performed using 2-tailed Student t test. *P ⬍ .05; **P ⬍ .01. (B-D) Thymocytes from
4-week-old SLP-76m/⫹ and SLP-76m/m littermates (5 mice for each genotype) were analyzed by flow cytometry. FACS plots shown are from 1 representative of each genotype.
(B) Surface expression of CD4 versus CD8 on total thymocytes. (C) Expression of CD25 versus CD44 on CD4⫺CD8⫺ DN thymocytes. (D) Expression of TCR-␤ versus HSA on
CD4⫺CD8⫹ thymocytes. The numbers in each panel represent the average percentages of the gated populations.
homologous recombination potentially difficult. We replaced the
exons encoding the SLP-76 amino acids 6-63 with PGK-Neo and
left exon 4 (encoding the remaining 15 amino acids of the SAM
domain) intact. To avoid the reading frameshift after the deletion,
the 3⬘ end of exon 1 was modified, resulting in the addition of
2 amino acids (Ser-Arg). We reason that deletion of most (51 of
66 amino acids) of the SAM domain should render it nonfunctional.
Successful targeting was confirmed by Southern blotting (Figure 1B), and the positive ES clones were used to generate chimeric
mice, which were subsequently crossed with ␤-actin Cre transgenic
mice to generate SLP-76m/⫹ mice. These heterozygous mice were
backcrossed onto a B6 background for at least 6 generations.
SLP-76m/m mice were generated from SLP-76m/⫹ breeding at an
expected frequency. In contrast to SLP-76⫺/⫺ mice, which frequently succumb to prenatal systemic hemorrhage, SLP-76m/m pups
had no obvious signs of bleeding and appeared grossly healthy.
To confirm correct gene targeting and successful deletion of the
sequence encoding the SAM domain, total RNAs were prepared from
thymocytes from SLP-76m/⫹ and SLP-76m/m mice and were used in
RT-PCR with 2 primers flanking the deleted region. As predicted, the
PCR product amplified from the mutant sequence was approximately
150 base pairs shorter than that from the wild type (Figure 1C).
Successful mRNA splicing between exon 1 (modified) and exon 4 was
confirmed by sequencing the PCR products (data not shown). We also
examined the expression of SLP-76 protein in sorted DP thymocytes
from SLP-76⫹/⫹, SLP-76m/⫹, and SLP-76m/m littermates by Western
blotting with polyclonal anti-SLP antisera. As expected, a truncated
form of the protein was detected in SLP-76m/m cells (Figure 1D), and its
expression level was comparable with that of the wild-type protein in
SLP-76⫹/⫹ cells. Interestingly, SLP-76m/⫹ DP cells preferentially expressed the wild-type form of SLP-76 protein. Moreover, intracellular
staining followed by FACS analysis revealed comparable expression
levels of SLP-76 protein in peripheral T cells from SLP-76m/⫹ and
SLP-76m/m littermates (Figure 1E). These data showed that the ⌬SAM–
SLP-76 protein is expressed in SLP-76m/m T cells at a level similar to
that of wild-type SLP-76 in SLP-76⫹/⫹ cells.
Defective thymocyte development in SLP-76 knockin mice
Next, we analyzed thymocyte development in SLP-76⫹/⫹, SLP-76m/⫹,
and SLP-76m/m mice. T-cell development appeared normal in SLP76m/⫹ mice. Both percentages and total numbers of different thymocyte
and mature T-cell subsets in SLP-76m/⫹ mice were similar to those
observed in SLP-76⫹/⫹ littermates (data not shown).
Thymi from the 4-week-old SLP-76m/m mice appeared slightly
smaller than those from SLP-76m/⫹ littermates (data not shown),
and the total number of thymocytes was decreased (Figure 2A).
The percentage of DN thymocytes in SLP-76m/m mice was slightly
increased (Figure 2B), whereas the overall DN thymocyte
numbers appeared relatively normal (Figure 2A). As shown by
the CD25 versus CD44 profile in Figure 2C, the percentage of
DN3 SLP-76m/m thymocytes increased moderately from 46.6% to
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
78
SHEN et al
59.0%, accompanied by a mild decrease in the percentage of the
DN4 subset (from 33.5%-23.5%). Yet the differences in the
absolute numbers of the DN subsets between the mutant and
control mice did not appear to be statistically significant (Figure
2A). Data obtained from a 5-bromo-2⬘-deoxyuridine incorporation
assay showed that all 4 DN subsets in the SLP-76m/m mice
proliferated at similar rates as their counterparts from control
SLP-76m/⫹ mice (data not shown), suggesting that the relatively
normal number of mutant DN thymocytes was not caused by any
compensatory proliferation effect. We also found that the absolute
number of CD4⫺CD8⫹HSAhighTCRlow intermediate SP (ISP) cells,
which are immature precursors of DP thymocytes, remained
relatively normal (Figure 2A). Altogether, these data suggested that
the deletion of the SAM domain slightly impaired SLP-76 function
in pre-TCR signaling, resulting in a minor developmental block at
the DN3 to DN4 checkpoint.
We also examined the thymic production of ␥␦TCR⫹ cells in
SLP-76m/m mice. SLP-76 has been shown to play a critical role in
␥␦ T-cell development because the number of ␥␦TCR⫹ thymocytes
is greatly decreased in SLP-76⫺/⫺ mice.1 In contrast, the SLP-76m/m
mice contained approximately the same number of ␥␦TCR⫹
thymocytes as the heterozygous controls (Figure 2A), suggesting
that the SAM domain is not required for SLP-76–mediated
␥␦ T-cell development.
In contrast to SLP-76⫺/⫺ mice, which completely lack DP and
SP thymocytes, SLP-76m/m mice contained a slightly higher
percentage of DP thymocytes than the heterozygous controls
(Figure 2B). The total number of SLP-76m/m DP thymocytes was
moderately decreased compared with SLP-76m/⫹ controls (Figure
2A). However, despite a largely normal DP subset, the percentage
of CD4⫹SP thymocytes was significantly reduced (from 8.8% to
4.5%) in SLP-76m/m mice (Figure 2B), and their total number was
decreased by more than 60% (Figure 2A). The relatively small
decrease observed in the percentage of SLP-76m/m CD4⫺CD8⫹
thymocytes (from 3.6% to 3.1%; Figure 2B) was caused by an
enrichment of ISP cells (Figure 2D). Therefore, the absolute
number of mature CD8⫹ SP thymocytes was still reduced by
approximately 50% in SLP-76m/m mice (Figure 2A). Together, our
data suggested that deletion of the SAM domain in SLP-76
partially impaired the maturation of SP thymocytes, particularly the
CD4⫹SP cells.
Defective positive and negative selection in SLP-76 knockin
mice
To study the function of the SAM domain of SLP-76 in thymic
selection, we crossed these knockin mice with HY-TCR transgenic
mice, which carry an ␣␤TCR specific for the male antigen HY. The
results are shown in Figure 3A. In the male HY-TCR⫹SLP-76m/⫹
mice, the HY-TCR⫹ thymocytes underwent extensive negative
selection, resulting in a severe loss of DP thymocytes. In contrast, a
substantial population of HY-TCR⫹ DP thymocytes persisted in the
male HY-TCR⫹SLP-76m/m mice, indicating that thymic negative
selection was severely impaired. We also examined positive
selection in female HY-TCR transgenic mice, which lack the HY
antigen. In female HY-TCR⫹SLP-76m/⫹ mice, the HY-TCR⫹ DP
thymocytes underwent successful positive selection and matured
into SP thymocytes (predominantly CD8⫹). On the contrary,
despite a normal HY-TCR⫹ DP subset, the percentages of SP
thymocytes were significantly reduced in the female HY-TCR⫹SLP76m/m mice, suggesting that these mutant DP thymocytes have a
defect in positive selection. These data showed that the deletion of
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
Figure 3. Defective positive and negative thymic selections in ⌬SAM–SLP-76
knockin mice. (A) ⌬SAM–SLP-76 knockin mice were crossed with HY-TCR
transgenic mice. HY-TCR⫹ gated thymocytes from 4-week-old male (top) and female
(bottom) HY-TCR⫹SLP-76m/⫹ and HY-TCR⫹SLP-76m/m littermates were analyzed for
their surface expression of CD4 and CD8. The numbers represent the average
percentages of the gated populations. (B) Surface expression of TCR-␤, CD69, and
CD5 on DP thymocytes from 4-week-old SLP-76m/⫹ and SLP-76m/m littermates.
the SAM domain from SLP-76 severely disrupted both positive and
negative thymic selection in the HY-TCR transgenic mice.
We further examined the cell surface expression of TCR-␤,
CD5, and CD69, all of which are known markers for positive
selection, on the DP thymocytes from SLP-76m/⫹ and SLP-76m/m
mice. As shown in Figure 3B, CD5 expression on the SLP-76m/m
DP cells was significantly decreased. Meanwhile, the percentages
of TCR-␤⫹ cells and CD69⫹ cells also declined among the
SLP-76m/m DP thymocytes. Altogether, our data showed that the
deletion of the SAM domain of SLP-76 affected both positive and
negative thymic selection, resulting in a partial block during the DP
to SP transition.
Fewer mature T cells in the periphery of the SLP-76 knockin
mice
We next examined the peripheral lymphoid compartment of the
SLP-76 knockin mice. The spleens in SLP-76m/m mice appeared
grossly normal, and the total number of splenocytes did not appear
significantly different from that of control mice (Figure 4A).
However, consistent with the thymocyte data, TCR-␤⫹ cells
constituted a lower percentage of splenocytes in SLP-76m/m mice
(Figure 4B); correspondingly, the numbers of both CD4⫹ and
CD8⫹ splenic T cells were decreased by approximately 50%
(Figure 4A). In contrast to the spleens, the percentage of TCR-␤⫹
cells was only slightly decreased in the peripheral lymph nodes in
SLP-76m/m mice (Figure 4B). However, the total number of
peripheral lymph node cells in SLP-76m/m mice was significantly
reduced, resulting in a markedly decreased amount of T cells
(Figure 4A). The CD4:CD8 ratio in both spleen and peripheral
lymph nodes of SLP-76m/m mice remained similar to that of the
control mice (Figure 4C). Furthermore, despite their low numbers,
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
ROLE OF SAM DOMAIN IN SLP-76 FUNCTION
79
Figure 4. Peripheral T cells in ⌬SAM–SLP-76 knockin mice. Splenocytes and peripheral lymph node cells from 5-week-old SLP-76m/⫹ and SLP-76m/m littermates were
analyzed by flow cytometry. (A) Total numbers of splenocytes, lymph node cells, and CD4⫹ and CD8⫹ T cells. Five mice for each genotype were analyzed. Statistical analysis
was performed using 2-tailed Student t test. *P ⬍ .05; **P ⬍ .01. (B) The percentages of TCR-␤⫹ cells in spleens and lymph nodes. (C) Expression of CD4 versus CD8 on
splenocytes and lymph node cells. (D) Expression of CD44 versus CD62L on CD4⫹ gated cells in spleens and lymph nodes. (E) Expression of CD25 versus CD69 on CD4⫹
gated cells in spleens. FACS plots shown are from 1 representative of 5 mice analyzed. The numbers represent the average percentages of the gated populations.
the mutant T cells expressed normal levels of surface TCR on a
single-cell basis (Figure 4B).
Analysis of surface activation markers showed that the frequency of effector-like CD44highCD62LlowCD4⫹ T cells increased
in SLP-76m/m spleens, with a simultaneous reduction in the
percentage of naive CD44lowCD62Lhigh CD4⫹ T cells (Figure 4D).
A similar phenomenon was observed in splenic CD8⫹ T cells (data
not shown), but not in lymph node T cells (Figure 4D). However,
neither CD4⫹ nor CD8⫹ SLP-76m/m splenic T cells up-regulated
surface expression of CD25 or CD69 (Figure 4E and data not
shown), suggesting that basal activation of the mutant T cells was
not disturbed. We reason that the SLP-76m/m splenic T cells might
have undergone homeostatic proliferation upon entering the partially lymphopenic environment, which has been known to result in
a similar CD44highCD62Llow phenotype.
Defective TCR-induced proliferation and IL-2 production by
SLP-76m/m T cells
Next, we examined the role of the SLP-76 SAM domain in T-cell
activation. Up-regulation of early activation markers, CD25 and
CD69, upon anti-CD3 stimulation appeared normal in the SLP76m/m T cells (Figure 5A). Proliferation of SLP-76m/m CD4⫹CD44low
naive T cells in response to stimulation by various concentrations
of plate-bound anti-CD3 and 1 ␮g/mL soluble anti-CD28 was
significantly reduced compared with SLP-76m/⫹ CD4⫹CD44low
T cells (Figure 5B). However, the mutant T cells proliferated at a
comparable rate to the control T cells upon PMA plus ionomycin
stimulation, which bypasses TCR engagement (Figure 5B). IL-2
production by SLP-76m/m CD4⫹ T cells was also diminished upon
anti-CD3/CD28 stimulation (Figure 5C). In contrast, PMA plus
ionomycin stimulation induced efficient production of IL-2 from
the SLP-76m/m CD4⫹ T cells as well as the SLP-76m/⫹ controls
(Figure 5C). These data demonstrated that the SAM domain is
required for optimal T-cell proliferation and IL-2 production.
Impaired TCR signaling in SLP-76 knockin mice
To further understand the TCR signaling events that led to impaired
activation of SLP-76m/m T cells, we examined 2 major signaling
pathways downstream of TCR engagement: ERK activation and
calcium mobilization. In Figure 6A, purified CD4⫹ T cells from
SLP-76m/m and SLP-76m/⫹ mice were stimulated by CD3 crosslinking. Total tyrosine phosphorylation of proteins in SLP-76m/m
CD4⫹ T cells was comparable with that of control cells, and LAT
phosphorylation was normal. It appears that deletion of the SAM
domain does not affect TCR-proximal signaling events upstream of
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
80
SHEN et al
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
Ca2⫹ response in both the mutant and control thymocytes, suggesting that the calcium mobilization machinery was intact in mutant
cells and that the dye loading was equal in both samples (data not
shown). The same phenomenon was also observed in both CD4⫹
(Figure 6B) and CD8⫹ (data not shown) peripheral T cells. The
absence of the SAM domain most likely impaired the initial
calcium release from endoplasmic reticulum (ER) stores, because
the calcium flux in SLP-76m/m T cells appeared to be kinetically
normal despite a lower peak concentration. To separate the
intracellular calcium release from extracellular influx, EGTA was
used to chelate free Ca2⫹ in the assay buffer. As shown in Figure
6C, in the presence of EGTA, CD3 cross-linking induced a weaker
increase in Ca2⫹ levels in SLP-76m/⫹ T cells, reflecting calcium
depletion from intracellular stores. Such elevation was much less
noticeable in the SLP-76m/m T cells. Ionomycin, however, triggered
a similar Ca2⫹ increase in both the mutant and control cells,
suggesting comparable ER Ca2⫹ stores in these cells (data not
shown). Furthermore, we assayed TCR-mediated production of the
secondary messenger IP3. IP3 is generated from cleavage of
4,5-bis-phosphate by activated PLC-␥1 and subsequently interacts
with IP3 receptors to trigger intracellular calcium release. As shown
in Figure 6D, IP3 production was considerably lower in SLP-76m/m
thymocytes as well as CD4⫹ T cells. Altogether, our data showed
that deletion of the SLP-76 SAM domain caused defective
TCR-induced IP3 generation, which subsequently led to impaired
calcium flux and IL-2 production.
SAM domain in TCR-mediated formation of SLP-76
microclusters
Figure 5. Defective T-cell activation in ⌬SAM–SLP-76 knockin mice. (A) Splenocytes from SLP-76m/⫹ and SLP-76m/m littermates were either left untreated (gray
area), stimulated with 3 ␮g/mL plate-bound anti-CD3 (solid line), or stimulated with
20 ng/mL PMA plus 0.5 ␮g/mL ionomycin (dotted line) for 6 hours and subsequently
analyzed by flow cytometry. Surface expression of CD25 and CD69 on CD4⫹ gated
cells is shown. (B) Purified SLP-76m/⫹ and SLP-76m/m CD4⫹CD44low T cells were
either stimulated with various concentrations of plate-bound anti-CD3 plus 1 ␮g/mL
soluble anti-CD28 (left), or with PMA plus ionomycin (right). After 36 hours, cells were
pulsed with [3H]thymidine for an additional 6 hours before being harvested for
scintillation counting. Cell proliferation is represented by the counted radioactivity
(CPM). (C) Purified SLP-76m/⫹ and SLP-76m/m CD4⫹ T cells were stimulated the
same as in panel B. Supernatants were harvested after 8 hours, and the IL-2
concentrations were determined by ELISA.
SLP-76. Phosphorylation of SLP-76 was also normal, suggesting
that it is independent of the SAM domain. Phosphorylation of
ERK1/2 was dramatically decreased, as shown in Figure 6A, but
PLC-␥1 phosphorylation was surprisingly undisturbed. Similar
results were observed in purified SLP-76m/m DP thymocytes (data
not shown). These data showed that the SAM domain plays an
essential role in SLP-76–mediated ERK-MAPK activation, but is
dispensable for PLC-␥1 phosphorylation.
We next examined TCR-induced calcium mobilization in SLP76m/m T cells. Upon CD3 cross-linking, SLP-76m/m DP thymocytes
(Figure 6B), as well as SP thymocytes (data not shown), mounted a
considerably weaker calcium flux compared with SLP-76m/⫹
controls. However, ionomycin treatment induced an equally strong
Previous studies have analyzed SLP-76⫺/⫺ mice reconstituted with
SLP-76 Y3F, ⌬224-244, ⌬SH2, or R448K mutants.20,21 Among
these mice, mice expressing the ⌬224-244 mutant exhibited
strikingly similar phenotypes to our SLP-76 ⌬SAM knockin mice.
The deletion of amino acids 224-244 of SLP-76 abolishes its
interaction with Gads, through which SLP-76 can be recruited to
LAT and lipid rafts upon TCR ligation. Accordingly, Gads⫺/⫺ mice
also share many gross similarities with SLP-76m/m mice.33 It is
possible that, similar to the Gads-binding motif, the SAM domain
plays a role in the recruitment of SLP-76 to the plasma membrane.
To investigate the subcellular localization of the ⌬SAM-SLP-76
mutant after TCR stimulation, we reconstituted SLP-76–deficient
J14 Jurkat cells with GFP-tagged wild-type or ⌬SAM SLP-76
proteins at their C termini. These cells were then stimulated by
anti-CD3⑀ antibody (UCHT1) coated onto coverslips. The cellular
distribution of the GFP fluorescence was visualized every 20 seconds by live imaging. As previously reported,14,34 SLP-76–GFP
began to form bright clusters and translocate to the plasma
membrane within 20 seconds of TCR stimulation (Figure 7A).
Such clusters were observed at the plane where the cells made
contact with the coverslip. Very few, if any, clusters could be found
in the interior of the cells or other areas of the plasma membrane
that was not in contact with the coverslip (data not shown). These
clusters were maintained at the interface over time and could still
be observed after at least 15 minutes (Figure 7C and data not
shown). In contrast, whereas the ⌬SAM–SLP-76–GFP protein was
capable of forming clusters at the coverslip surface, such clustering
appeared much weaker in intensity and disappeared much faster
(Figure 7B).
To quantitate the microcluster formation, we spun the GFP⫹ J14
cells onto anti-CD3–coated coverslips and incubated them at 37°C
for 10 minutes before collecting imaging data. This procedure
allowed these cells to be stimulated simultaneously. For each cell
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
ROLE OF SAM DOMAIN IN SLP-76 FUNCTION
81
Figure 6. Defective TCR-mediated signaling in ⌬SAM–SLP-76 T cells. (A) Purified SLP-76m/⫹ and SLP-76m/m CD4⫹ T cells were stimulated for 2 minutes by anti-CD3
cross-linking. Postnuclear lysates were analyzed by Western blotting with anti-pTyr, pSLP-76, pPLC-␥1, and pERK1/2 antibodies. SLP-76, PLC-␥, and ERK2 blots are shown
as loading controls. (B-C) DP thymocytes and CD4⫹ splenic T cells from SLP-76m/⫹ and SLP-76m/m mice were loaded with Indo-1 and then stimulated by anti-CD3 cross-linking
without (B) or with (C) the presence of 5 mM EGTA. Calcium concentration was monitored by flow cytometry and represented as the ratio of fluorescence at 405 nm and
510 nm. (D) Total thymocytes (left) and purified CD4⫹ T cells (right) from SLP-76m/⫹ and SLP-76m/m mice were stimulated for 2 minutes by anti-CD3 cross-linking. IP3 was
extracted, and IP3 levels were measured.
analyzed, the average intensity of microclusters was calculated by
MetaMorph software, and the numbers of clusters within various
ranges of intensity were also counted. As shown in Figure 7B, the
number of clusters with high fluorescence intensity decreased
dramatically in J14 cells expressing the ⌬SAM–SLP-76–GFP
compared with those cells expressing SLP-76–GFP.
Altogether, these data suggested that the SAM domain plays an
important role in mediating or stabilizing the TCR-mediated
membrane association of SLP-76, through mechanisms yet to be
understood. The similarity between the ⌬SAM knockin mice and
the SLP-76⫺/⫺ mice expressing the ⌬224-244 mutant prompted us
to speculate whether the SAM domain functions through Gadsdependent mechanisms. We first examined the interaction between
⌬SAM–SLP-76 and Gads. Comparable amount of Gads protein
was coimmunoprecipitated with wild-type or mutant SLP-76 from
thymocyte lysates, suggesting that the constitutive interaction
between SLP-76 and Gads was not affected by the deletion of the
SAM domain (Figure 7C). Similar data were also obtained using
J14 cells reconstituted with wild-type or mutant SLP-76 (data not
shown). In addition, there were no obvious differences in the
tyrosine-phosphorylated proteins that were coimmunoprecipitated
with SLP-76, suggesting that SLP-76 association with Vav and
PLC-␥1 is most likely normal (data not shown).
To further understand the relationship between the SAM domain and
Gads in SLP-76 function, we generated SLP-76m/mGads⫺/⫺ double-
mutant mice and compared them with both SLP-76m/m and Gads⫺/⫺
single-mutant littermates. Strikingly, the T-cell developmental defects
observed in the SLP-76m/mGads⫺/⫺ mice were much more severe than
in either of the single-mutant mice. The combined effects of the SLP-76
SAM domain and Gads deletions caused a nearly complete arrest of
thymocyte development at the DN3 stage. Only a few DN thymocytes
managed to mature into DP cells, evidenced by the fact that only
approximately 18% of total thymocytes were CD4⫹CD8⫹ in the
double-mutant mice. Very few mature T cells could be detected in the
periphery of the SLP-76m/mGads⫺/⫺ mice (Figure 7D). These data
suggested that the SAM domain most likely exerts its function in a
Gads-independent fashion, and that both the SAM domain and the
Gads–SLP-76 interaction are important in SLP-76 function.
Discussion
Upon TCR engagement, TCR-proximal signals are translated into
distal biochemical events via the orchestration of a variety of
adaptor proteins. Adaptor proteins are signaling molecules that lack
intrinsic enzymatic activity, but act as protein scaffolds, nucleating
multiprotein signaling complexes. They usually contain multiple
domains that are capable of interacting with other signaling
proteins either constitutively or inducibly. Therefore, to fully
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
82
SHEN et al
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
Figure 7. Deletion of the SAM domain inhibits TCR-mediated SLP-76 clustering. (A) J14 cells expressing SLP-76–GFP or ⌬SAM–SLP-76–GFP fusion proteins were
dropped onto coverslips coated with anti–human CD3⑀ antibody. Time point 0 represents the moment the cells made contact with the coverslip. GFP clustering at the
cell/coverslip interface at indicated time points is shown. (B) Cells in panel A were activated on anti-CD3⑀–coated coverslips for 10 minutes. Average intensity of the GFP
clustering formed at the cell/coverslip interface was measured. The numbers of clusters within indicated intensity ranges were counted. Each line represents 1 analyzed cell.
(C) Total thymocytes from SLP-76⫹/⫹, SLP-76m/⫹, and SLP-76m/m littermates were either stimulated with anti-CD3⑀ cross-linking or left untreated. Cell lysates were subjected to
immunoprecipitation with anti-SLP-76 polyclonal antibody, followed by Western blotting with anti–SLP-76 and anti-Gads antibodies. (D) Thymocytes and splenocytes from
4-week-old SLP-76m/⫹, SLP-76m/m, Gads⫺/⫺, and SLP-76m/mGads⫺/⫺ mice were analyzed by flow cytometry. (Top) Expression of CD4 versus CD8 on total thymocytes. (Middle)
Expression of CD25 versus CD44 on CD4⫺CD8⫺ DN thymocytes. (Bottom) Expression of CD4 versus CD8 on splenocytes.
understand the functions of adaptor proteins, it is crucial to explore
their protein interaction motifs and corresponding binding partners.
SLP-76 is a hematopoietic cell-specific adaptor protein critical
for thymocyte development and mature TCR signaling. Extensive
effort has been aimed at identifying the binding partners of SLP-76
and exploring the domain structures involved in such associations.
Most structure-function analysis of SLP-76 has been focused on
3 motifs: the 3 N-terminal phosphotyrosines, the Gads-binding
sequence in the central proline-rich region, and the C-terminal SH2
domain. Yet, more protein-binding motifs have been identified in
SLP-76 over the years. A P1 domain within the proline-rich region
of SLP-76 was found to mediate constitutive association with the
SH3 domain of PLC-␥1.13,14 In fact, it was later found that at least
3 distinct sites within this proline-rich region of SLP-76 could bind
to PLC-␥1.35 Moreover, the SH3 domain of the protein tyrosine
kinase p56lck can associate with a 10-amino-acid–long sequence
(amino acids 185-194) within SLP-76.36,37 SLP-76⫺/⫺ mice reconstituted with the ⌬185-194 mutant exhibited defects in thymocyte
development as well as mature TCR responses.37 In addition, the
phosphorylation of serine 376 of SLP-76 induces direct association
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
with 14-3-3 proteins, which play a role in down-modulating T-cell
activation.38,39 It is reasonable to believe that more protein-binding
motifs of SLP-76 and their respective binding partners will be
identified in the future.
In this study, we demonstrated that a SAM domain, which is
generally considered a protein interaction motif, plays an important
role in SLP-76 function in thymopoiesis. Deletion of the SAM
domain in SLP-76 slightly affected the DN3 to DN4 transition
mediated by pre-TCR signaling. The more obvious developmental
block in the ⌬SAM SLP-76 knockin mice occurred at the DP to SP
transition, causing defective generation of SP thymocytes and
mature T cells. We also used the HY-TCR transgenic system to
examine positive and negative thymic selection in SLPm/m mice.
Although this system is widely used as a model for negative
selection, some studies argue that the lack of DP thymocytes in
male HY-TCR transgenic mice is a consequence of the conversion
of DN thymocytes into ␥␦-like cells due to signals delivered by
premature TCR-␣␤ expression on DN thymocytes.40-42 However,
other lines of evidence indicate that this argument cannot be the
sole explanation, because HY-TCR⫹ DP thymocytes can indeed be
found in the male mice and their deletion can be rescued by CD8␤
deficiency.43 Therefore, we cautiously concluded that that the
disruption of the SAM domain inhibited negative thymic selection.
Our data showed that the SAM domain of SLP-76 is indispensable for optimal mature TCR signaling. The peripheral T cells in
SLP-76m/m mice exhibited defective TCR-mediated calcium mobilization and ERK activation, leading to decreased IL-2 production
and cell proliferation. Previous studies have shown that SLP-76
interacts with PLC-␥1 in both constitutive and TCR-inducible
fashions. The constitutive binding occurs between the SH3 domain
of PLC-␥1 and specific sequences within the SLP-76 proline-rich
region.13,14,35 Abolishment of such basal association in Jurkat cells
greatly reduces TCR-dependent PLC-␥1 phosphorylation, resulting
in defective calcium flux and NFAT promoter activity.13,14 In
contrast, upon TCR engagement, phosphorylated LAT recruits both
PLC-␥1 and Gads, the latter of which constitutively binds SLP-76.
In this manner, SLP-76 also associates with PLC-␥1 indirectly.
Although SLP-76 is not required for LAT recruitment of PLC-␥1,3
its inducible interaction with LAT and PLC-␥1 appears to stabilize
the PLC-␥1–LAT association and is essential for optimal activation
of PLC-␥1. Mutation of the Gads-binding site of LAT significantly
reduces the binding of PLC-␥1 with LAT, leading to reduced
activation of PLC-␥1.44 Similarly, when the Gads-binding site of
SLP-76 or Gads itself is deleted, phosphorylation of PLC-␥1 is
markedly decreased.20,21,33 These studies suggest that the complicated interactions between LAT, SLP-76, and PLC-␥1 are necessary for the full activation of PLC-␥1, and any disturbance between
them could lead to defective TCR-dependent calcium flux. The
constitutive and inducible interaction with SLP-76 may help
maintain and stabilize PLC-␥1 in a conformation that allows it to
be phosphorylated and thus catalytically active.13 Furthermore,
recent studies have shown that SLP-76 may additionally contribute
to the activation of PLC-␥1 by recruiting Vav and Itk, which have
been implicated in direct or indirect phosphorylation of PLC␥1.45-47 These studies demonstrate that SLP-76 regulates the
activity of PLC-␥1 by affecting its phosphorylation. Intriguingly, in
our study, the TCR-induced phosphorylation of PLC-␥1 appeared
unaffected in SLP-76m/m T cells, despite impaired production of IP3
and defective calcium flux. These data suggested that, apart from
regulating the phosphorylation of PLC-␥1, SLP-76 might also
directly regulate the catalytic activity of PLC-␥1 through novel
mechanisms yet to be determined.
ROLE OF SAM DOMAIN IN SLP-76 FUNCTION
83
Previous studies using live imaging of Jurkat cells have shown
that cross-linking the TCR by immobilized antibodies induces
rapid formation of signaling microclusters, which contain tyrosine
kinases, LAT, Gads, and SLP-76, at the contact site.34,48-50 The
persistence of SLP-76 clustering appeared to be dependent on its
multiple domain structures, including the N-terminal phosphotyrosine motif, the Gads-binding motif, the proline-rich P1 domain,
and the C-terminal SH2 domain. Cluster formation in cells
expressing the aforementioned SLP-76 mutants was rapidly terminated.50 Our data clearly indicated that the deletion of the SAM
domain significantly weakened the intensity and stability of the
SLP-76 clusters, suggesting that the SAM domain is also critical in
the formation of stable and persistent SLP-76 clusters. Whereas the
biologic relevance of the microcluster assembly is still not clear,
the impaired recruitment of SLP-76 to these structures most likely
affects the activity of PLC-␥1 and causes the signaling defects in
the SLP-76m/m T cells.
The defects in thymocyte development in Gads⫺/⫺ mice, in
which the LAT-dependent membrane recruitment of SLP-76 is
abolished, are much less severe than those in SLP-76⫺/⫺ mice. The
residual signaling seen in Gads⫺/⫺ mice might result from the
membrane recruitment of SLP-76 through Grb2–SLP-76 interaction, PLC-␥1–SLP-76 interaction, or LAT-independent mechanisms, one of which is through the SAM domain. Our data showed
that, by further disrupting the SLP-76 SAM domain in the absence
of Gads, such residual signaling was markedly decreased. These
data suggested that the SAM domain and Gads play synergistic
roles in SLP-76 function. How the SLP-76 SAM domain functions
in TCR-mediated signaling remains to be determined. It is very
possible that this domain interacts with other proteins to stabilize
the LAT–Gads–SLP-76–PLC-␥1 signaling complex. Our data
presented in this study clearly demonstrate that this domain is
critical for SLP-76 function during thymocyte development and
T-cell activation.
Acknowledgments
We thank the Duke University Cancer Center Flow Cytometry,
DNA Sequencing, and Transgenic Mouse facilities for their
excellent services.
This work was supported by National Institutes of Heath
(Bethesda, MD) grants AI048674 and AI056156. J.L. is supported
by a National Science Scholarship from A*STAR, Singapore.
W.Z. is a scholar of the Leukemia & Lymphoma Society (White
Plains, NY).
Authorship
Contribution: S.S. designed and performed experiments, analyzed
and interpreted data, performed statistical analysis, and wrote the
paper; J.L., M.Z., J.Z., and D.F. performed research and analyzed
data; Q.-j.L. assisted imaging experiments and analyzed and
interpreted data from imaging studies; and W.Z. designed research,
analyzed and interpreted data, and wrote the paper.
Conflict-of-interest disclosure: The authors declare no competing financial interests.
Correspondence: Weiguo Zhang, Box 3010, Dept of Immunology, Duke University Medical Center, 1 Research Dr, Durham, NC
27710; e-mail: [email protected].
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
84
BLOOD, 2 JULY 2009 䡠 VOLUME 114, NUMBER 1
SHEN et al
References
1. Pivniouk V, Tsitsikov E, Swinton P, Rathbun G, Alt
FW, Geha RS. Impaired viability and profound
block in thymocyte development in mice lacking
the adaptor protein SLP-76. Cell. 1998;94:229238.
2. Clements JL, Yang B, Ross-Barta SE, et al. Requirement for the leukocyte-specific adapter protein SLP-76 for normal T cell development.
Science. 1998;281:416-419.
3. Yablonski D, Kuhne MR, Kadlecek T, Weiss A.
Uncoupling of nonreceptor tyrosine kinases from
PLC-␥1 in an SLP-76-deficient T cell. Science.
1998;281:413-416.
4. Bubeck Wardenburg J, Fu C, Jackman JK, et al.
Phosphorylation of SLP-76 by the ZAP-70 protein-tyrosine kinase is required for T-cell receptor
function. J Biol Chem. 1996;271:19641-19644.
5. Raab M, da Silva AJ, Findell PR, Rudd CE. Regulation of Vav-SLP-76 binding by ZAP-70 and its
relevance to TCR␨/CD3 induction of interleukin-2.
Immunity. 1997;6:155-164.
6. Su YW, Zhang Y, Schweikert J, Koretzky GA,
Reth M, Wienands J. Interaction of SLP adaptors
with the SH2 domain of Tec family kinases. Eur
J Immunol. 1999;29:3702-3711.
7. Bunnell SC, Diehn M, Yaffe MB, Findell PR,
Cantley LC, Berg LJ. Biochemical interactions
integrating Itk with the T cell receptor-initiated
signaling cascade. J Biol Chem. 2000;275:22192230.
8. Bogin Y, Ainey C, Beach D, Yablonski D. SLP-76
mediates and maintains activation of the Tec family kinase ITK via the T cell antigen receptor-induced association between SLP-76 and ITK.
Proc Natl Acad Sci U S A. 2007;104:6638-6643.
9. Bubeck Wardenburg J, Pappu R, Bu JY, et al.
Regulation of PAK activation and the T cell cytoskeleton by the linker protein SLP-76. Immunity.
1998;9:607-616.
10. Liu SK, Fang N, Koretzky GA, McGlade CJ. The
hematopoietic-specific adaptor protein Gads
functions in T-cell signaling via interactions with
the SLP-76 and LAT adaptors. Curr Biol. 1999;9:
67-75.
11. Law CL, Ewings MK, Chaudhary PM, et al. GrpL,
a Grb2-related adaptor protein, interacts with
SLP-76 to regulate nuclear factor of activated
T cell activation. J Exp Med. 1999;189:12431253.
12. Asada H, Ishii N, Sasaki Y, et al. Grf40, a novel
Grb2 family member, is involved in T cell signaling through interaction with SLP-76 and LAT.
J Exp Med. 1999;189:1383-1390.
13. Yablonski D, Kadlecek T, Weiss A. Identification
of a phospholipase C-␥1 (PLC-␥1) SH3 domainbinding site in SLP-76 required for T-cell receptormediated activation of PLC-␥1 and NFAT. Mol
Cell Biol. 2001;21:4208-4218.
14. Singer AL, Bunnell SC, Obstfeld AE, et al. Roles
of the proline-rich domain in SLP-76 subcellular
localization and T cell function. J Biol Chem.
2004;279:15481-15490.
15. Musci MA, Hendricks-Taylor LR, Motto DG, et al.
Molecular cloning of SLAP-130, an SLP-76associated substrate of the T cell antigen
receptor-stimulated protein tyrosine kinases.
J Biol Chem. 1997;272:11674-11677.
16. da Silva AJ, Li Z, de Vera C, Canto E, Findell P,
Rudd CE. Cloning of a novel T-cell protein FYB
that binds FYN and SH2-domain-containing leukocyte protein 76 and modulates interleukin 2
production. Proc Natl Acad Sci U S A. 1997;94:
7493-7498.
17. Sauer K, Liou J, Singh SB, Yablonski D, Weiss A,
Perlmutter RM. Hematopoietic progenitor kinase
1 associates physically and functionally with the
adaptor proteins B cell linker protein and SLP-76
in lymphocytes. J Biol Chem. 2001;276:4520745216.
18. Liou J, Kiefer F, Dang A, et al. HPK1 is activated
by lymphocyte antigen receptors and negatively
regulates AP-1. Immunity. 2000;12:399-408.
19. Maltzman JS, Kovoor L, Clements JL, Koretzky
GA. Conditional deletion reveals a cellautonomous requirement of SLP-76 for thymocyte selection. J Exp Med. 2005;202:893-900.
20. Myung PS, Derimanov GS, Jordan MS, et al. Differential requirement for SLP-76 domains in T cell
development and function. Immunity. 2001;15:
1011-1026.
21. Kumar L, Pivniouk V, de la Fuente MA, Laouini D,
Geha RS. Differential role of SLP-76 domains in
T cell development and function. Proc Natl Acad
Sci U S A. 2002;99:884-889.
22. Ponting CP. SAM: a novel motif in yeast sterile
and Drosophila polyhomeotic proteins. Protein
Sci. 1995;4:1928-1930.
23. Schultz J, Ponting CP, Hofmann K, Bork P. SAM
as a protein interaction domain involved in developmental regulation. Protein Sci. 1997;6:249253.
24. Qiao F, Bowie JU. The many faces of SAM. Sci
STKE. 2005;2005:re7.
25. Kim CA, Gingery M, Pilpa RM, Bowie JU. The
SAM domain of polyhomeotic forms a helical
polymer. Nat Struct Biol. 2002;9:453-457.
26. Qiao F, Song H, Kim CA, et al. Derepression by
depolymerization; structural insights into the
regulation of Yan by Mae. Cell. 2004;118:163173.
27. Kim CA, Phillips ML, Kim W, et al. Polymerization
of the SAM domain of TEL in leukemogenesis
and transcriptional repression. EMBO J. 2001;20:
4173-4182.
28. Ramachander R, Kim CA, Phillips ML, et al. Oligomerization-dependent association of the SAM
domains from Schizosaccharomyces pombe Byr2
and Ste4. J Biol Chem. 2002;277:39585-39593.
29. Zhang H, Xu Q, Krajewski S, et al. BAR: an apoptosis regulator at the intersection of caspases
and Bcl-2 family proteins. Proc Natl Acad Sci
U S A. 2000;97:2597-2602.
30. Aviv T, Lin Z, Lau S, Rendl LM, Sicheri F, Smibert
CA. The RNA-binding SAM domain of Smaug
defines a new family of post-transcriptional regulators. Nat Struct Biol. 2003;10:614-621.
31. Green JB, Gardner CD, Wharton RP, Aggarwal
AK. RNA recognition via the SAM domain of
Smaug. Mol Cell. 2003;11:1537-1548.
32. Bunnell SC, Barr VA, Fuller CL, Samelson LE.
High-resolution multicolor imaging of dynamic
signaling complexes in T cells stimulated by planar substrates. Sci STKE. 2003;2003:pl8.
33. Yoder J, Pham C, Iizuka YM, et al. Requirement
for the SLP-76 adaptor GADS in T cell development. Science. 2001;291:1987-1991.
34. Bunnell SC, Hong DI, Kardon JR, et al. T cell receptor ligation induces the formation of dynamically regulated signaling assemblies. J Cell Biol.
2002;158:1263-1275.
35. Jia CY, Nie J, Wu C, Li C, Li SS. Novel Src homol-
ogy 3 domain-binding motifs identified from proteomic screen of a Pro-rich region. Mol Cell Proteomics. 2005;4:1155-1166.
36. Sanzenbacher R, Kabelitz D, Janssen O. SLP-76
binding to p56lck: a role for SLP-76 in CD4induced desensitization of the TCR/CD3 signaling
complex. J Immunol. 1999;163:3143-3152.
37. Kumar L, Feske S, Rao A, Geha RS. A 10-aalong sequence in SLP-76 upstream of the Gads
binding site is essential for T cell development
and function. Proc Natl Acad Sci U S A. 2005;
102:19063-19068.
38. Shui JW, Boomer JS, Han J, et al. Hematopoietic
progenitor kinase 1 negatively regulates T cell
receptor signaling and T cell-mediated immune
responses. Nat Immunol. 2007;8:84-91.
39. Di Bartolo V, Montagne B, Salek M, et al. A novel
pathway down-modulating T cell activation involves HPK-1-dependent recruitment of 14-3-3
proteins on SLP-76. J Exp Med. 2007;204:681691.
40. Baldwin TA, Sandau MM, Jameson SC, Hogquist
KA. The timing of TCR␣ expression critically influences T cell development and selection. J Exp
Med. 2005;202:111-121.
41. Takahama Y, Shores EW, Singer A. Negative selection of precursor thymocytes before their differentiation into CD4⫹CD8⫹ cells. Science. 1992;
258:653-656.
42. Terrence K, Pavlovich CP, Matechak EO,
Fowlkes BJ. Premature expression of T cell receptor (TCR)␣␤ suppresses TCR␥␦ gene rearrangement but permits development of ␥␦ lineage
T cells. J Exp Med. 2000;192:537-548.
43. Killeen N, Moriarty A, Teh HS, Littman DR. Requirement for CD8-major histocompatibility complex class I interaction in positive and negative
selection of developing T cells. J Exp Med. 1992;
176:89-97.
44. Zhang W, Trible RP, Zhu M, Liu SK, McGlade CJ,
Samelson LE. Association of Grb2, Gads, and
phospholipase C-␥1 with phosphorylated LAT
tyrosine residues: effect of LAT tyrosine mutations on T cell antigen receptor-mediated signaling. J Biol Chem. 2000;275:23355-23361.
45. Reynolds LF, Smyth LA, Norton T, et al. Vav1
transduces T cell receptor signals to the activation of phospholipase C-␥1 via phosphoinositide
3-kinase-dependent and -independent pathways.
J Exp Med. 2002;195:1103-1114.
46. Beach D, Gonen R, Bogin Y, Reischl IG,
Yablonski D. Dual role of SLP-76 in mediating
T cell receptor-induced activation of phospholipase C-␥1. J Biol Chem. 2007;282:2937-2946.
47. Liu KQ, Bunnell SC, Gurniak CB, Berg LJ. T cell
receptor-initiated calcium release is uncoupled
from capacitative calcium entry in Itk-deficient
T cells. J Exp Med. 1998;187:1721-1727.
48. Barda-Saad M, Braiman A, Titerence R, Bunnell
SC, Barr VA, Samelson LE. Dynamic molecular
interactions linking the T cell antigen receptor to
the actin cytoskeleton. Nat Immunol. 2005;6:8089.
49. Braiman A, Barda-Saad M, Sommers CL,
Samelson LE. Recruitment and activation of
PLC␥1 in T cells: a new insight into old domains.
EMBO J. 2006;25:774-784.
50. Bunnell SC, Singer AL, Hong DI, et al. Persistence of cooperatively stabilized signaling clusters drives T-cell activation. Mol Cell Biol. 2006;
26:7155-7166.
From www.bloodjournal.org by guest on September 12, 2016. For personal use only.
2009 114: 74-84
doi:10.1182/blood-2008-09-177832 originally published
online April 28, 2009
The importance of Src homology 2 domain-containing leukocyte
phosphoprotein of 76 kilodaltons sterile- α motif domain in thymic
selection and T-cell activation
Shudan Shen, Jasmine Lau, Minghua Zhu, Jianwei Zou, Deirdre Fuller, Qi-jing Li and Weiguo Zhang
Updated information and services can be found at:
http://www.bloodjournal.org/content/114/1/74.full.html
Articles on similar topics can be found in the following Blood collections
Immunobiology (5415 articles)
Information about reproducing this article in parts or in its entirety may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#repub_requests
Information about ordering reprints may be found online at:
http://www.bloodjournal.org/site/misc/rights.xhtml#reprints
Information about subscriptions and ASH membership may be found online at:
http://www.bloodjournal.org/site/subscriptions/index.xhtml
Blood (print ISSN 0006-4971, online ISSN 1528-0020), is published weekly by the American Society
of Hematology, 2021 L St, NW, Suite 900, Washington DC 20036.
Copyright 2011 by The American Society of Hematology; all rights reserved.