Download Detection of Norwalk-like Virus in Shellfish Implicated in Illness

S360
Detection of Norwalk-like Virus in Shellfish Implicated in Illness
Y.-S. Carol Shieh,1 Stephan S. Monroe,2
R. L. Fankhauser,2,3 Gregg W. Langlois,4
William Burkhardt III,1 and Ralph S. Baric5
1
US Food and Drug Administration Gulf Coast Seafood Laboratory,
Dauphin Island, Alabama; 2Viral Gastroenteritis Section, Centers
for Disease Control and Prevention, and 3Atlanta VA Medical Center,
Atlanta, Georgia; 4California Department of Health Services,
Berkeley, California; 5Department of Epidemiology, School of Public
Health, University of North Carolina, Chapel Hill, North Carolina
In the 1990s, Norwalk-like viruses (NLVs) were identified in patient specimens as the primary
pathogen associated with shellfish-borne gastroenteritis in the United States. Identification of
these viruses from implicated shellfish has been difficult due to inefficient recovery of viruses,
natural polymerase chain reaction (PCR) inhibitors in shellfish, and low virus contamination.
Recent improvements to the method of detecting NLVs in shellfish include enhanced processing of virus and shellfish samples, application of nested PCR and nucleotide sequencing,
and increased knowledge of NLV genetic diversity. Using a newly developed and sensitive
method, an NLV G2 strain was identified in 2 oyster samples implicated in a 1998 California
outbreak involving 171 cases. NLV capsid primers demonstrated a greater specificity of PCR
detection than did polymerase primers. The 175-base viral capsid nucleotide sequences derived
from oysters were 100% identical to those derived from a patient stool sample. This finding
supports the epidemiologic associations indicating that contaminated shellfish serve as the
vehicle for NLV transmission.
US Shellfish-Borne Infectious Diseases
Infectious diseases associated with shellfish consumption
have been documented since 1894, when the first cases of shellfish-associated typhoid fever were reported in the United States
[1]. Between 1894 and 1990, 114,000 cases of infectious diseases
were associated with shellfish consumption; however, most
cases (56%) did not have documentation identifying the etiologic agent associated with clinical specimens or implicated
shellfish [2]. In those cases in which an etiologic agent was
identified, the most frequently reported causes of shellfish-borne
diseases were Salmonella typhi, hepatitis A virus (HAV), and
Norwalk-like virus (NLV). In the 1920s, thousands of typhoid
fever cases were caused by contaminated shellfish, but the number of cases gradually diminished, with the last cases occurring
in the 1950s [2]. Numerous HAV outbreaks and cases were
documented during the 1960s in the United States [3–5], but
the numbers decreased in the 1970s and 1980s [2].
Partly because of the established sanitary guidelines for shellfish-growing areas and improved waste-water treatment, a new
profile for shellfish-borne infectious diseases emerged in the
1990s [6]: Typhoid cases virtually disappeared, and the numbers
of HAV cases and idiopathic cases of unknown etiology were
greatly reduced (!1% and 7%, respectively, of the total cases)
Reprints or correspondence: Dr. Y.-S. Carol Shieh, USFDA Gulf Coast
Seafood Laboratory, PO Box 158, Dauphin Island, AL 36528 (yshieh
@cfsan.fda.gov).
The Journal of Infectious Diseases 2000; 181(Suppl 2):S360–6
q 2000 by the Infectious Diseases Society of America. All rights reserved.
0022-1899/2000/18105S-0018$02.00
(table 1). The reduction of idiopathic cases is attributed to the
development of molecular detection techniques for Norwalk
virus (NV) and NLVs after the first successful cloning and
characterization of the NV genome in 1990 [7]. Subsequently,
with increased knowledge of the genetic diversity of NLVs,
assays for detecting a wide variety of NLV variants became
feasible. Consequently, in the 1990s, NLVs have been found as
the primary etiologic agents (52%) among reported cases of
infectious diseases associated with shellfish consumption [8–13].
One factor contributing to the high number of NLV cases is
the illegal dumping of human waste directly into shellfish harvesting areas. For example, oysters harvested from Louisiana
waters from December 1996 through January 1997 were implicated in a multistate outbreak with 525 reported cases of
gastroenteritis [11, 14]. Epidemiologic investigation of this outbreak determined that the overboard discharge of untreated
waste from harvesting vessels was the probable cause [14].
In the past, when NV and NLVs were identified as the etiologic agents in the US outbreaks associated with shellfish-consumption, the viruses were detected in clinical specimens but
rarely from implicated shellfish. In one exception in 1993, an
NLV strain was found in outbreak-implicated Louisiana oysters, and the sequenced 81 nt of the oyster-derived NLV strain
differed by 7 nt from the patient-derived NLV strain [15]. In
another exception, where the virus was detected in oysters implicated in a 1996–1997 multistate outbreak, the NLV sequences
could not be obtained, because of an inadequate quantity of
polymerase chain reaction (PCR) amplicon [11]. In addition,
in two reports describing outbreaks outside the United States
where NLV was detected in implicated shellfish, the identical
JID 2000;181 (Suppl 2)
Detection of Norwalk-like Virus in Oysters
Table 1. Etiological agents and cases of shellfish-borne infectious
diseases in the United States.
S361
contaminant-impacted areas, and judge when it is appropriate
to re-open shellfish-growing areas.
No. of cases (% of total)
a
b
Agent
1894–1990
1991–1998
Norwalk and Norwalk-like viruses
Vibrio parahaemolyticus
Vibrio vulnifucus
c
Unidentified
Salmonella typhi
Hepatitis A virus
Salmonella species (other than typhi)
Shigella species
Vibrio cholera non-01
Vibrio cholera 01
d
Vibrio species (others)
e
Hepatitis
f
Other bacterial pathogens
Total
427
159
160
7978
3270
1798
130
111
143
14
49
47
63
14,349
1122
631
179
144
0
5
4
4
27
5
26
0
15
2162
(3)
(1)
(1)
(56)
(23)
(13)
(!1)
(!1)
(1)
(!1)
(!1)
(!1)
(!1)
(100)
(52)
(29)
(8)
(7)
(0)
(!1)
(!1)
(!1)
(1)
(!1)
(1)
(0)
(1)
(100)
a
Data compiled from Rippey SR [2].
Data compiled from Glatzer MB [6] and Rippey SR [2].
No agent isolated or identified in clinical specimens or in implicated shellfish.
All cases are gastroenteritis.
d
Include V. fluvialis, V. hollisae, and V. mimicus.
e
Type unspecified.
f
Includes Campylobacter and Aeromonas species, Staphlyococcus aureus, Bacillus cereus, Escherichia coli, and Plesiomonas species.
b
c
NLV sequences derived from patients were not clearly identified
[16, 17].
Despite the importance of NLVs as the major etiologic agent
of shellfish-borne diseases in the 1990s, the direct detection and
identification of viruses in shellfish have been problematic. The
difficulties involve low levels of virus contamination, inefficient
virus recovery during sample processing, and natural PCR inhibitors in shellfish. The development of rapid, sensitive, and
accurate molecular methods for virus detection in shellfish is
critical to future outbreak investigations and will enable us to
identify the pathogens, verify the transmission vehicles, locate
Development of Methods for Virus Detection in Shellfish
Background.
Enteric viruses, which are excreted in the
waste of infected persons, can persist in the environment and
are transmitted via the fecal-oral route. Transmission is primarily through person-to-person contact and contaminated water and food. Bivalve molluscan shellfish (oysters, clams, and
mussels) may become contaminated by bio-accumulating human pathogens from surrounding polluted waters, thus becoming vehicles of disease transmission to humans. There are two
stages involved in detecting enteric viruses in contaminated
shellfish: (1) separation and concentration of viruses from the
shellfish tissue components and (2) detection of viruses in the
processed concentrates, using a cell culture infectivity assay or
PCR followed by nucleic acid hybridization. Since the detection
of nonculturable viruses, such as NLVs, is critical for pathogen
detection in outbreak-implicated shellfish, molecular detection
using a rapid and sensitive PCR assay is preferred.
Successful PCR detection of viruses in shellfish depends upon
the efficient recovery of viruses and the effective removal of
PCR inhibitors naturally occurring in shellfish. These two criteria are especially critical for PCR detection of low levels of
viruses.
Conventional shellfish-processing procedures, which are useful for recovery of viruses for cell culture assay, are not always
compatible with PCR detection because of insufficient removal
of inhibitors. Following are some of the conventional processing steps that have been tested and used prior to PCR
amplification (see table 2). First, viruses can be eluted from
shellfish tissue by acid adsorption and elution [18–20] or by
direct glycine buffer elution [21–23]. Enteric viruses can be ad-
Table 2. Processing steps frequently used for recovering virus or viral RNA from oysters before polymerase chain
reaction (PCR) amplification.
Processing step
Elution
Acid adsorption and elution
Direct glycine elution
Precipitation
Polyethylene glycol precipitation
Acid precipitation or organic flocculation
Solvent extraction
Ether or freon or chloroform
Chloroform/butanol
Concentration
Ultracentrifugation
Ultrafiltration
Advanced purification and concentration
Antigen-antibody capture
Nucleic acid extraction
a
Developer or early user
a
Sobsey and colleagues, 1975 [18] and 1978 [19]; Jaykus at el., 1996 [20]
Herrmann and Cliver, 1968 [21]; Lewis and Metcalf, 1988 [22]; Lees et al., 1994 [23]
Lewis and Metcalf, 1988 [22]; Atmar et al., 1993 [24]
Sobsey et al., 1978 [19]; Chung et al., 1996 [25]
Metcalf and Stiles, 1965 [26] and 1968 [27]; Atmar et al., 1993 [24]
Atmar et al., 1995 [28]; Le Guyader et al., 1996 [15]
Metcalf and Stiles, 1965 [26] and 1968 [27]; Pina et al., 1998 [29]
Kostenbader and Cliver, 1972 [30]; Lees et al., 1994 [23]
Desenclos et al., 1991 [31]; Deng et al., 1994 [32]
Atmar et al., 1993 [24]; Lees et al., 1994 [23]
Developer is person who developed processing step (before 1988, steps mostly were developed for virus examination using tissue
culture assay). Early user is person who successfully adapted processing step for virus examination using PCR amplification.
S362
Shieh et al.
sorbed to and eluted from the particulates of homogenated
shellfish tissue by regulating the pH and ionic strength of the
homogenate. The acid adsorption and elution process was developed in 1975 by Sobsey et al. [18] to effectively separate
viruses from oyster tissue. The use of glycine buffer to directly
elute viruses from shellfish tissue was reported in 1968 [21]. The
eluant of 0.05 M glycine–10% tryptose phosphate broth, pH
9.0, was one of the better candidates that were compared for
use in recovering rotavirus from oyster tissue [22].
Second, viruses can be precipitated from eluates by polyethylene glycol (PEG) [22, 24] or acid precipitation [19, 25] (table
2). PEG 6000 effectively precipitates enteric viruses from eluates
[22], and acid-precipitation has also been widely used since the
1970s [19].
Third, the use of solvent (ethyl ether) to purify viruses from
oyster concentrates (table 2) was first described in 1965 by
Metcalf and Stiles [26]. Since then, chloroform and 1,1,2-trichloro-1,2,2-trifluoroethane (Freon) have been the most widely
used solvents. A solvent mixture of chloroform and butanol
was developed by Atmar et al. [28] in 1995 to improve virus
detection sensitivity.
Fourth, viruses can be concentrated by ultracentrifugation
[26, 27, 29] or ultrafiltration [16, 19, 23, 30] (table 2). Highspeed ultracentrifugation (1125,000 g) was used in the 1960s
to concentrate enteric viruses from oyster homogenates [26, 27].
The use of ultrafiltration to further concentrate viruses in partially processed oyster concentrates was also described in the
1970s [19, 30]. In recent years, immunocapture [31, 32] and
nucleic acid extraction [23, 24], two PCR-compatible processing
steps, were developed to further concentrate and purify virus
or viral RNA (table 2) from oysters.
While each of these processing steps purifies or concentrates
(or both) viruses from oyster tissue, they also reduce the overall
recovery of viruses. Major challenges in developing an efficient
virus-detection method are to streamline the process and to
effectively remove inhibitors while minimizing substantial loss
of viruses. Although processing and concentrating small sample
sizes may help circumvent the presence of excessive inhibitors
that interfere with PCR analysis, it may give rise to false-negative PCR results, especially with low levels of virus contamination.
With the recent application of semi-nested or nested PCR
(second-round PCR with an internal set of primers) [33, 34],
subsequent characterization of PCR amplicons derived from
shellfish has been improved significantly. Ample PCR products
from the second-round amplification facilitate the success of
cloning and sequencing of an amplicon. Nucleotide sequence
information from the amplified products can be used to confirm
the result of Southern hybridization and to genotype the virus
strains derived from contaminated shellfish.
Method employed and challenges encountered. To avoid
cross-contamination and achieve accurate PCR detection of low
levels of viruses in outbreak-implicated shellfish, the recom-
JID 2000;181 (Suppl 2)
mended sample processing procedure is to separate, process,
and analyze environmental samples independently from clinical
samples. Facilities and equipment designated for an environmental laboratory should not be used with clinical samples at
any time; rather, clinical specimens, which often harbor high
levels of viruses, should be analyzed in a different setting to
minimize risks of cross-contamination. Likewise, proper precautions should be taken always, particularly the setting up of
physical barriers between sample preparation and PCR product
examination.
We have developed a rapid and sensitive method for virus
detection in oysters that offers several advantages over some
of the other currently used methods: A smaller volume of solvent is required (12 mL for 25–50 g oysters), the processing
time is shorter than that for the virion method [20], no sophisticated instrumentation (e.g., ultracentrifugation equipment) is required, and PCR inhibitors are efficiently removed
(possibly by the initial step of adsorption and elution and the
final step of silica gel adsorption and elution of RNA [35]).
Overall, the method requires 10–12 h of sample processing,
achieves satisfactory removal of PCR inhibitors from 200-fold
sample concentrates (10-mL RNAs derived from 2 g of oyster
tissue), and has a detection sensitivity of 1 pfu/g oyster tissue
initially seeded with poliovirus type 3 Sabin strain (as determined by single PCR combined with Southern hybridization)
[35]. The seven sample processing steps are outlined in figure
1. In brief, step 1 involves homogenization of oyster tissue in
a 1 : 7 ratio of cold, sterile, deionized water; step 2 is acid
adsorption of viruses from the homogenate at pH 5.0; step 3
is elution of viruses from oyster tissue solids with 0.05 M glycine–0.15 M NaCl, pH 7.5; step 4 is the precipitation of viruses,
using 8% PEG 8000–0.3 M NaCl; step 5 is the solvent-extraction of viruses with an equal volume of Freon; step 6 is the
precipitation of viruses, again using 8% PEG–0.3 M NaCl; and
step 7 is the RNA extraction of the second PEG precipitates,
using silica gel membranes (Qiagen, Valencia, CA).
In the 150- to 200-fold concentrated final extracts, viral
RNAs are identified by reverse transcription–PCR (RT-PCR),
nested PCR, and sequencing (figure 1). As demonstrated in our
investigation of oysters implicated in a gastroenteritis outbreak
that occurred in 1998, NLV RNAs in the final oyster concentrates were examined by use of RT-PCR with both polymerase
and capsid primer sets. The primers and probes from the NLV
polymerase region [36] (table 3) permitted sensitive detection
of NLV G2 by Southern blot hybridization.
Sequencing of the nested PCR amplicons revealed that a
variety of nonspecific sequences had been amplified (the NLV
sequences likely composed a minor set of the amplicon). To
further determine whether the virus strain detected in oysters
was causally linked with human gastroenteritis, capsid primers
(table 3) derived from the sequence information of amplicons
from clinical specimens were utilized. An amplicon from oyster
RNA concentrate was obtained by first performing PCR with
JID 2000;181 (Suppl 2)
Detection of Norwalk-like Virus in Oysters
Figure 1. The method of sample processing and virus detection and
identification in oysters. RT-PCR = reverse transcription polymerase
chain reaction.
an initial set of capsid primers (Mon381/Mon383) [37] and then
performing semi-nested PCR with an internal primer (Mon382)
in addition to Mon381. Nucleotide sequences of all selected
clones of the amplicon from oysters were 100% identical to
each other. These capsid primers were believed to permit a
specific recognition of the NLV genomic RNA in an RNA pool,
which led to a rapid confirmation of virus identity and an
increased detection specificity of NLV. Unique sequences of
NLV capsid and the design of primer sets may be the main
contributors to the success of the rapid identification of NLV
in oysters.
An Outbreak Originating from NLV-Contaminated
Oysters
Outbreak background. In May of 1998, 171 cases comprising 44 clusters of gastroenteritis were reported to be associated with the consumption of raw or undercooked oysters
harvested from Tomales Bay, California [38]. Patient symptoms
included diarrhea, cramps, vomiting, low-grade fever, and chills
S363
occurring 18–48 h after oyster consumption. The bay was closed
to shellfish harvesting on 15 May by the California Department
of Health Services (CDHS), and a voluntary recall of potential
illness-linked oysters also was initiated on 15 May. On the basis
of harvesting information uncovered through tag trace-back of
the oysters consumed by 88 of the 171 patients, illnesses were
linked to harvest dates starting 29 April and to harvest areas
in the mid to outer bay. The tagging system established by the
National Shellfish Sanitation Program requires shellfish harvesters to label their products with the harvest date and growing
area prior to product distribution. Tomales Bay, located 80 km
north of San Francisco, is ∼16 km long by 2–3.2 km wide and
produces oysters, clams, and mussels from 1.95 km2 of approved growing areas. None of the surrounding sources of potential point pollution, such as waste water treatment plants
and sewage disposal facilities, are designated to discharge effluent into the bay. The management plan set by CDHS controls
the impact of non-point pollution sources from boats, wildlife,
and rainfall-related sources.
NLV identification in oysters. Three weeks after the harvesting dates, 3 samples of recalled oysters (Crassostrea gigas)
were shipped overnight in a chilled, insulated container to the
US Food and Drug Administration Gulf Coast Seafood
Laboratory, Dauphin Island, Alabama. Immediately upon arrival (29 May 1998), the samples were inspected, and viable
oysters were shucked and stored in a 2807C freezer. Samples
A1 and A2 were harvested from growing area A on 5 and 7
May, respectively; sample B1 was harvested on 5 May from
growing area B, which was geographically distant from area A
by ∼1.6 km. Growing area A occupies a 20,200 m2 sector, and
growing area B is much larger.
Each of 3 samples (25 g without liquor and adductors) was
processed individually using the method previously described.
Samples A1 and B1 were positive for NLV G2 but negative for
NLV G1 as determined by use of polymerase primer sets [36].
Positive G2 signals were demonstrated occasionally in 2 mL of
RNAs and repeatedly in the 10 mL of RNAs that were concentrated from 1.4–1.5 g of oyster tissue during two processing
trials for each sample with either polymerase or capsid primers
(table 3).
To clearly establish a causal link between patients and illnessassociated oysters, semi-nested PCR products of the NLV capsid region were subcloned into the pCR-XL-Topo II T-A cloning vector. Plasmids containing inserts were sequenced using
an automated fluorescent cycle sequencer (ABI, model 377;
Applied Biosystems, Foster City, CA). The 175-nt sequences
between two primers of the amplicons derived from 3 clones
of sample A1 and 6 clones of sample B1 were 100% identical.
Using the BLAST-search program, the Tomales strain was
found to be 100%, 99%, 95%, and 95% similar to the human
calicivirus strains of S031/94/UK (GenBank no. Z73989), S033/
94/UK, Lordsdale, and Bristol, respectively (table 4). All other
strains in table 4 that were 100% and 99% homologous to the
S364
Shieh et al.
JID 2000;181 (Suppl 2)
Table 3. Nucleotide sequences of Norwalk-like virus G2 polymerase chain
reaction (PCR) primers.
Primers
First PCR of polymerase
SR33
SR46
Nested PCR
SR33IN
SR46IN
First PCR of capsid
Mon381
Mon383
Semi-nested PCR
Mon381
Mon382
Sequences
Position no.
Amplicon
in base pair
tgtcacgatctcatcatcacc
tggaattccatcgcccactgg
4856–4876
4754–4773
123
cacgatctcatcatcacca/gta
aattccatcgcccactggc/ttc/g
4853–4873
4757–4776
117
ccagaatgtacaatggttatgc
caagagactgtgaagacatcatc
5362–5383
5661–5683
322
ccagaatgtacaatggttatgc
tgatagaaattgttcctaacatcagg
5362–5383
5559–5584
223
Tomales strain were derived and classified within the “95/96US” subset [39]. On the basis of BLAST-search analysis on the
175-nt sequences, the Tomales strain also belonged to the common “95/96-US subset.” Strains of the “95/96-US” subset were
reported to have a global distribution, although the 95/96 subset
accounted for only 26% of NLV outbreaks reported to the
Centers for Disease Control and Prevention (CDC) during the
1997–1998 season [39].
The third sample, A2 (a total of 50 g of oysters processed
through two trials), was negative for both NLV G1 and G2
genotypes as determined by use of Ando’s primers [36]. The
absence of NLV G2 in sample A2 may possibly be attributed
to the small sample size (50 g of 4–6 oysters sampled) and to
the potentially uneven distribution of virus over the 20,200-m2
growing area. Furthermore, human enterovirus was found in
sample A2 by using pan-enterovirus PCR [35]. Because enterovirus was well amplified, it was unlikely that the PCR inhibitors
remained and caused false-negative results for NLV in sample
A2.
In an independent laboratory at CDC, the 175-nt sequences
of an NLV G2 genotype were also derived from 1 of the 2
patient stool samples obtained during the outbreak. The 175nt sequence of the clinical strain was 100% identical to those
of the oyster strains. These results clearly demonstrate that 1
strain of human NLV G2 first polluted the oysters in at least
two growing areas that were ∼1.6 km apart, remained in the
oysters, persisted through harvesting and consumption, and
then caused the gastroenteritis in humans. The sequence analysis supports the epidemiologic association of oyster consumption and illness in this outbreak.
Control and Prevention of Outbreaks
Human waste contamination of shellfish-growing areas of
Tomales Bay was the cause of the virus outbreak. Such contamination is believed also to have caused two other large-scale
virus outbreaks originating from Louisiana oysters in 1993 and
December 1996 through January 1997, with 183 and 525 reported cases of gastroenteritis, respectively [8, 11]. In all three
outbreaks, the oysters were harvested from approved shellfishgrowing areas. Three possibilities have been suggested as the
reason for illnesses arising from the consumption of shellfish
harvested from growing areas that were presumed to be sanitary. First, sporadic or non-point source pollution, such as illegal waste discharge from boats or sewage-treatment systems,
might cause illnesses because it is difficult to detect such discharge by only periodic examination of fecal coliforms in water.
Second, noncontained point source pollution, such as malfunctioning sewage disposal systems, might be a source for
illness-causing contamination. Third, fecal coliform monitoring
systems may not accurately reflect the presence or absence of
viruses in shellfish and the estuarine environment [40] because
the bio-accumulation and depuration kinetics of bacteria and
viruses in shellfish are different [41, 42]. Specifically for the
Tomales oyster outbreak, the two most likely pollution sources
reported by CDHS were substandard and potentially failing
septic systems along the shoreline and overboard waste discharge from boaters [38].
Current methods for molecular detection of viruses in oysters
cannot be readily adapted for routine monitoring by local regulatory laboratories. Until means for routine monitoring become
available (e.g., viral indicators), the most effective preventative
measures are to educate the public regarding appropriate disposal of human wastes, especially near the vicinity of shellfishgrowing waters. Local authorities are encouraged to establish
means to minimize or eliminate human fecal contamination in
shellfish-growing areas, such as portable toilets in remote areas
used for recreation, routine inspection of sewage-treatment systems, mandatory requirements for boats to be equipped with
marine sanitation devices, and making waste pump-out facilities available. Many postharvest controls are not effective in
completely eliminating viruses from contaminated shellfish. For
example, enteric viruses, especially HAV or NLV, that accumulate in bivalve mollusks are relatively resistant to mild cooking [43–45]. Thus, preharvest controls (including continued
shoreline surveillance, mandatory restriction on waste dumping, improved indicators, and public education) are the main
JID 2000;181 (Suppl 2)
Detection of Norwalk-like Virus in Oysters
S365
Table 4. Percent identity between the Tomales strain and GenBank Norwalk-like viruses (NLVs), as determined by
comparision of the 175-nt capsid sequences.
% homology
(no. identical bases/
total no. compared)
100 (175/175)
99 (174/175)
95 (164/172)
GenBank NLV strains
S031/94/UK, 416/97003156/1996/LA, and 004/95M-14/1995/AU
S033/94/UK, 373/96019743/1996/SC, 366/96019554/1996/ID, 358/96015107/1996/FL, 384/96025046/1996/FL,
379/96019984/1996/AZ, 345/96002726/1996/SC, and 364/96019537/1996/AZ
Lordsdale and Bristol
NOTE. 175-nt sequences (positions 5384–5558) of selected Tomales strain clones from 2 oyster samples were 100% identical and were
also identical to those derived from patient stool.
solutions to minimize virus-induced, shellfish-borne infectious
diseases.
Future Perspectives
Timely virus identification in outbreak-associated shellfish
would greatly facilitate the confirmation of the disease-transmission vehicle and the identification of contaminated growing
areas. The information derived is valuable to assist the local
authorities in their decision making, planning of follow-up
actions, and timely implementation of interviewing strategies.
To ensure rapid and accurate identification, the most efficient
way, we believe, is first to identify the virus strains in patient
stools (presumably containing high levels of viruses) in a clinical
laboratory. Subsequently, virus detection in implicated shellfish
should be done in a separate laboratory with PCR primer designed from patient strains. If sequence information from a
patient stool is not available, numerous PCR assays employing
different primers sets will probably be necessary to detect the
diversity of NLV strains currently in circulation. The PCR detection of NLV in implicated shellfish is tedious, and detection
and identification are further complicated by the use of nested
PCR.
During our investigation, we successfully retrieved the NLV
strain from oysters, using capsid primers. It should be noted,
however, that success in finding other strain variants by use of
the same primer pairs is not guaranteed. An area for future
work would be simplification of the detection and identification
procedures. The use of broadly reactive degenerate primers [46,
47] may need to be evaluated, with the focus on the reduction
or elimination of potentially nonspecific amplifications of other
nucleic acids that are co-precipitated and concentrated with the
viral genomic RNAs.
Detection of virus in contaminated shellfish will be useful for
studying related issues and developing interventions that will
result in improved outbreak prevention and control. The virus
levels in contaminated shellfish are believed to be low, but the
variation within an outbreak situation is unknown. Further
development of existing methods may allow quantitation of
NLV levels and correlation with human infectious dosages. The
method can also be used in field studies to enhance our understanding of virus spread and contamination patterns when spo-
radic non-point source pollution occurs, to investigate the depuration kinetics of low-level virus in shellfish in the marine
environment and the stability of virus in shellfish, and to pursue
alternative indicators that closely correlate with NLV levels in
shellfish and marine environments.
Acknowledgments
We thank US Food and Drug Administration (FDA) shellfish specialists in the Pacific Region for providing the illness reports associated
with recalled shellfish and D. W. Cook, R. M. McPhearson, P. S.
Schwartz, and G. P. Hoskin (Office of Seafood, FDA) for valuable
critiques during the preparation of this manuscript.
References
1. Fisher LM. Shellfish sanitation. Public Health Rep 1927; 1178:2291–300.
2. Rippey SR. Infectious diseases associated with molluscan shellfish consumption. Clin Microbiol Rev 1994; 7:419–25.
3. Dougherty WJ, Altman R. Viral hepatitis in New Jersey 1960–1961. Am J
Med 1962; 32:704–16.
4. Mason JO, McLean WR. Infectious hepatitis traced to the consumption of
raw oysters. Am J Hyg 1962; 75:90–111.
5. Ruddy SJ, Johnson RF, Mosley JW, Atwater JB, Rossetti MA, Hart JC. An
epidemic of clam-associated hepatitis. JAMA 1969; 208:649–55.
6. Glatzer MB. Internal reports on shellfish-borne disease outbreaks, 1992–1998.
Atlanta: US Food and Drug Administration, Southeast Regional Office,
1998.
7. Jiang X, Graham DY, Wang K, Estes MK. Norwalk virus genome cloning
and characterization. Science 1990; 250:1580–3.
8. Centers for Disease Control and Prevention. Multistate outbreak of viral
gastroenteritis related to consumption of oysters—Louisiana, Maryland,
Mississippi and North Carolina, 1993. MMWR Morb Mortal Wkly Rep
1993; 42:945–8.
9. Centers for Disease Control and Prevention. Viral gastroenteritis associated
with consumption of raw oysters—Florida, 1993. MMWR Morb Mortal
Wkly Rep 1994; 43:446–9.
10. Centers for Disease Control and Prevention. Multistate outbreak of viral
gastroenteritis associated with consumption of oysters—Apalachicola Bay,
Florida, December 1994–January 1995. MMWR Morb Mortal Wkly Rep
1995; 44:37–9.
11. Centers for Disease Control and Prevention. Viral gastroenteritis associated
with eating oysters—Louisiana, December 1996–January 1997. MMWR
Morb Mortal Wkly Rep 1997; 46:1109–12.
12. Dowell SF, Groves C, Kirkland KB, et al. A multistate outbreak of oysterassociated gastroenteritis: implications for interstate tracing of contaminated shellfish. J Infect Dis 1995; 171:1497–503.
S366
Shieh et al.
13. Kohn MA, Farley T, Ando T, et al. An outbreak of Norwalk virus gastroenteritis associated with eating raw oysters. JAMA 1995; 273:466–71.
14. Veazey J. Interagency assessment of factors contributing to occurrence of
recent viral outbreaks attributed to consumption of Gulf Coast oysters.
Atlanta: US Food and Drug Administration, Southeast Regional Office,
1998.
15. Le Guyader F, Neill FH, Estes MK, Monroe SS, Ando T, Atmar RL. Detection and analysis of a small round-structured virus strain in oysters
implicated in an outbreak of acute gastroenteritis. Appl Environ Microbiol
1996; 62:4268–72.
16. Lees DN, Henshilwood K, Green J, Gallimore CI, Brown DW. Detection of
small round structured viruses in shellfish by reverse transcription–PCR.
Appl Environ Microbiol 1995; 61:4418–24.
17. Sugieda M, Nakajima K, Nakajima S. Outbreaks of Norwalk-like
virus–associated gastroenteritis traced to shellfish: coexistence of two
genotypes in one specimen. Epidemiol Infect 1996; 116:339–46.
18. Sobsey MD, Wallis C, Melnick JL. Development of a simple method for
concentrating enteroviruses from oysters. Appl Microbiol 1975; 29:21–6.
19. Sobsey MD, Carrick RJ, Jensen HR. Improved methods for detecting enteric
viruses in oysters. Appl Environ Microbiol 1978; 36:121–8.
20. Jaykus L, DeLeon R, Sobsey MD. A virion concentration method for detection of human enteric viruses in oysters by PCR and oligoprobe hybridization. Appl Environ Microbiol 1996; 62:2074–80.
21. Herrmann JE, Cliver DO. Methods for detecting food-borne enteroviruses.
Appl Microbiol 1968; 16:1564–9.
22. Lewis GD, Metcalf TG. Polyethylene glycol precipitation for recovery of
pathogenic viruses, including hepatitis A and human rotavirus, from oyster, water, and sediment samples. Appl Environ Microbiol 1988; 54:1983–8.
23. Lees DN, Henshilwood K, Dore WJ. Development of a method for detection
of enteroviruses in shellfish by PCR with poliovirus as a model. Appl
Environ Microbiol 1994; 60:2999–3005.
24. Atmar RL, Metcalf TG, Neill FH, Estes MK. Detection of enteric viruses
in oysters by using the polymerase chain reaction. Appl Environ Microbiol
1993; 59:631–5.
25. Chung H, Jaykus LA, Sobsey MD. Detection of human enteric viruses in
oysters by in vivo and in vitro amplification of nucleic acids. Appl Environ
Microbiol 1996; 62:3772–8.
26. Metcalf TG, Stiles WC. The accumulation of enteric viruses by the oysters,
Crassostrea virginica. J Infect Dis 1965; 115:68–76.
27. Metcalf TG, Stiles WC. Enteroviruses within an estuarine environment. Am
J Epidemiol 1968; 88:379–91.
28. Atmar RL, Neill FH, Romalde JL, et al. Detection of Norwalk virus and
hepatitis A virus in shellfish tissues with the PCR. Appl Environ Microbiol
1995; 61:3014–8.
29. Pina S, Puig M, Lucena F, Jofre J, Girones R. Viral pollution in the environment and in shellfish: human adenovirus detection by PCR as an index
of human viruses. Appl Environ Microbiol 1998; 64:3376–82.
30. Kostenbader KD, Cliver DO. Polyelectrolyte flocculation as an aid to recovery of enteroviruses from oysters. Appl Microbiol 1972; 24:540–3.
31. Desenclos JCA, Klontz KC, Wilder MH, Nainan OV, Margolis HS, Gunn
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
42.
43.
44.
45.
46.
47.
JID 2000;181 (Suppl 2)
RA. A multistate outbreak of hepatitis A caused by the consumption of
raw oysters. Am J Public Health 1991; 81:1268–72.
Deng MY, Day SP, Cliver DO. Detection of hepatitis A virus in environmental
samples by antigen-capture PCR. Appl Environ Microbiol 1994; 60:
1927–33.
Hafliger D, Gilgen M, Luthy J, Hubner P. Seminested RT-PCR systems for
small round structured viruses and detection of enteric viruses in seafood.
Int J Food Microbiol 1997; 37:27–36.
Green J, Henshilwood K, Gallimore C, Brown D, Lees DN. A nested reverse
transcriptase PCR assay for detection of small round-structured viruses
in environmentally contaminated molluscan shellfish. Appl Environ Microbiol 1998; 64:858–63.
Shieh YSC, Calci KR, Baric RS. A method to detect low levels of enteric
viruses in contaminated oysters. Appl Environ Microbiol 1999; 65:
4709–14.
Ando T, Monroe SS, Gentsch JR, Jin Q, Lewis DC, Glass RI. Detection
and differentiation of antigenically distinct small round-structured viruses
(Norwalk-like viruses) by reverse transcription–PCR and Southern hybridization. J Clin Microbiol 1995; 33:64–71.
Noel JS, Ando T, Leite JP, et al. Correlation of patient immune responses
with genetically characterized small round-structured viruses involved in
outbreaks of nonbacterial acute gastroenteritis in the United States,
1990–1995. J Med Virol 1997; 53:372–83.
California Department of Health Services. Gastroenteritis associated with
Tomales Bay oysters: investigation, prevention, and control. California
Morbidity 1998;.
Noel JS, Fankhauser RL, Ando T, Monroe SS, Glass RI. Identification of
a distinct common strain of “Norwalk-like viruses” having a global distribution. J Infect Dis 1999; 179:1334–44.
Wait DA, Hackney CR, Carrick RJ, Lovelace G, Sobsey MD. Enteric bacterial and viral pathogens and indicator bacteria in hard shell clams. J
Food Prot 1983; 46:493–6.
Gerber CP, Goyal SM. Detection and occurrence of enteric viruses in shellfish:
a review. J Food Prot 1978; 41:743–54.
Richards GP. Microbial purification of shellfish: a review of depuration and
relaying. J Food Prot 1988; 51:218–51.
Dolin R, Blacklow NR, DuPont H, et al. Biological properties of Norwalk
agent of acute infectious nonbacterial gastroenteritis. Proc Soc Exp Biol
Med 1972; 140:578–83.
Millard J, Appleton H, Parry JV. Studies on heat inactivation of hepatitis A
virus with special reference to shellfish. Epidemiol Infect 1987; 98:397–414.
McDonnell S, Kirkland KB, Hlady WG, et al. Failure of cooking to prevent
shellfish-associated viral gastroenteritis. Arch Intern Med 1997; 157:111–6.
Le Guyader F, Estes MK, Hardy ME, et al. Evaluation of a degenerate
primer for the PCR detection of human caliciviruses. Arch Virol 1996;
141:2225–35.
Green SM, Lambden PR, Caul EO, Clarke IN. Capsid sequence diversity in
small round structured viruses from recent UK outbreaks of gastroenteritis. J Med Virol 1997; 52:14–9.