Download Characterization of a heat-active archaeal β

Enzyme and Microbial Technology 57 (2014) 48–54
Contents lists available at ScienceDirect
Enzyme and Microbial Technology
journal homepage: www.elsevier.com/locate/emt
Characterization of a heat-active archaeal ␤-glucosidase from a
hydrothermal spring metagenome
Carola Schröder, Skander Elleuche, Saskia Blank, Garabed Antranikian ∗
Institute of Technical Microbiology, Hamburg University of Technology, 21073 Hamburg, Germany
a r t i c l e
i n f o
Article history:
Received 4 November 2013
Received in revised form 14 January 2014
Accepted 27 January 2014
Available online 3 February 2014
Keywords:
Metagenomic library
Pressure
Thermostability
Aluminum chloride
Hyperthermophile
a b s t r a c t
Thermostable enzymes are required for application in a wide range of harsh industrial processes. High
stability and activity at elevated temperatures, as well as high tolerances toward various reagents and
solvents, are needed. In this work, a glycoside hydrolase family 1 ␤-glucosidase (Bgl1) of archaeal origin
was isolated from a hydrothermal spring metagenome. The enzyme showed a broad substrate spectrum
with activity toward cellobiose, cellotriose and lactose. Compared to most enzymes, extremely high
specific activity with 3195 U/mg was observed at 90 ◦ C and pH 6.5. Bgl1 was completely stable at pH
4.5–9.5 for 48 h at 4 ◦ C. More than 40% of activity was measured at 105 ◦ C. A thermal activation was
observed at 90 ◦ C after 30 min. Enzyme stability was enhanced (5- and 7-fold) after applying pressure
of 100 and 200 bar at 90 ◦ C for 2 h, respectively. The affinity of the ␤-glucosidase to its substrate was
significantly increased in the presence of AlCl3 . The Ki value for glucose was 150 mM. These distinctive
characteristics distinguish Bgl1 from other enzymes described so far and make this enzyme suitable for
application in numerous processes that run at high temperatures.
© 2014 Elsevier Inc. All rights reserved.
1. Introduction
Microorganisms exhibiting high growth temperature are
considered as producer of extreme thermostable enzymes
(extremozymes). The majority of these enzymes are more resistant
to chemical denaturation compared to their counterparts produced
from mesophiles [1]. Of special interest for industrial application
are hypertherophilic Archaea since they grow optimally between
80 and 110 ◦ C and produce unique thermostable enzymes [2].
Industrial processes that run at elevated thermal conditions have
many advantages. The solubility of complex substrates increases
due to lower viscosity and higher diffusion rate of the substrate.
Furthermore, the risk of contamination is significantly reduced
[3].
In the last decades, many biocatalysts from Archaea exhibiting
remarkable characteristics, such as optimal function at 100–110 ◦ C,
were discovered [4]. Especially glycoside hydrolases are suitable
for a wide range of biotechnological applications. For the efficient
bioconversion of lignocellulose to biofuels and chemicals novel glycoside hydrolases that act synergistically are needed [5]. This will
lead to the development of biorefinery of the 2nd generation that
is competitive to the petroleum-based plants [6]. Endoglucanases
(EC 3.2.1.4) cleave within the amorphous regions of long glucose
∗ Corresponding author. Tel.: +49 040 428783117.
E-mail address: [email protected] (G. Antranikian).
0141-0229/$ – see front matter © 2014 Elsevier Inc. All rights reserved.
http://dx.doi.org/10.1016/j.enzmictec.2014.01.010
chains. Cellobiohydrolases (EC 3.2.1.91) act on reducing or nonreducing ends of accessible polysaccharides. Cellobiose, cellotriose
or longer oligosaccharides that are produced from this reaction
represent the substrates for ␤-glucosidases (EC 3.2.1.21). These
enzymes hydrolyze terminal, non-reducing ␤-d-glucose residues
and produce glucose monomers [7]. The limiting factor in the conversion of cellulose to glucose is the inhibition of endoglucanase
activity by oligosaccharides [8].
Other applications of ␤-glucosidases include the cleavage of
phenolic and phytoestrogen glucosides from fruits and vegetables
for medical purposes or to enhance the quality of beverages. Furthermore, the enzyme is used to hydrolyze naringin resulting in
the reduction of fruit bitterness or gellan hydrolysis resulting in
the reduction of viscosity [8,9].
Since most microorganisms, particularly extremophiles, are not
cultivable under laboratory conditions, the metagenomic approach
was introduced. Metagenomic libraries from high temperature
habitats offer a great potential for the identification of novel
heat-stable enzymes [10]. Using function-based or sequence-based
methods putative genes, e.g. ␤-glucosidase-encoding genes can be
identified [11,12]. A number of novel biocatalysts with remarkable
properties have been already detected from unknown microorganisms in such metagenomes [13].
In this work, a metagenome was recovered from a hot spring
at the island São Miguel (Azores, Portugal). The prevalent elevated
temperatures of up to 70 ◦ C favored the presence of thermophilic
Bacteria and Archaea. A novel ␤-glucosidase was purified and characterized.
C. Schröder et al. / Enzyme and Microbial Technology 57 (2014) 48–54
2. Materials and methods
2.1. Starting material
Samples were collected at Furnas Valley from different locations of a hot spring
named Caldeirão on the island São Miguel (Azores, Portugal, 37◦ 46 N, −25◦ 18 E) in
September 2010 [14]. Environmental samples included water, mud and sediment
and were taken at locations with temperatures ranging from 60 to 70 ◦ C. The pH
varied from pH 6 to 7. The collected material was transported and stored at 4 ◦ C
under anoxic conditions by adding Na2 S (2.5%, w/v, pH 7, final concentration 0.01%,
w/v).
2.2. DNA isolation and amplification
The DNA was isolated through direct lysis [15]. Due to low amounts of recovered
DNA, the entire genetic information was amplified by multiple displacement procedure. Therefore, 1 ␮L of the template DNA was denatured for 3 min at 94 ◦ C with
1 ␮L random hexamer primer (500 pmol), 2.5 ␮L phi29 buffer (10×) and 1 ␮L DTT.
Subsequently, isothermal amplification was performed by addition of 2 ␮L phi29
buffer (10×), 2 ␮L dNTPs (25 mM each), 10 U phi29 DNA polymerase (Thermo Scientific, Schwerte, Germany) in a volume of 15 ␮L filled up with deionized water
for 12–16 h at 30 ◦ C. The resulting hyperbranched structures were dissolved [16].
Subsequently, single-stranded overhangs were digested, emerging gaps were filled
with nucleotides and the DNA was finally dephosphorylated. After each step the
amplicon was purified using SureClean solution (Bioline, Luckenwalde, Germany).
2.3. Metagenomic library construction and screening
Fragments with sizes in the range 4–10 kb were purified from an agarose gel
(1%) using the GeneJET Gel Extraction kit (Thermo Scientific, Schwerte, Germany).
The addition of a single 3 -deoxyadenosine overhang enabled the ligation into the
pCR-XL-TOPO vector. E. coli Top10 cells were transformed with ligation mixture
according to the manufacturer‘s instructions (Invitrogen, Karlsruhe, Germany). The
cells were plated as recommended. After sweeping off the cells, the plasmids were
isolated employing the Qiagen Plasmid Plus Midi Kit (Hilden, Germany). Screening
for activity-conferring genes took place by using clones derived from transformation of E. coli DH5␣ cells with 1 ␮L of metagenomic plasmid library. The cells were
grown on LB agarplates with 50 ␮g/mL kanamycin. The colonies were replicated
by stamping on velvet with a subsequent transfer on a new plate. After growth of
colonies, screening top-agarose (50 mM sodium acetate, 2.5 mM calcium chloride x
2 H2 O, 170 mM NaCl, 2.5 mM esculin hydrate, 0.4 mM ammonium ferric citrat, 1.2%
agarose) was used to overlay cells. Clones were incubated at 70 ◦ C over night.
2.4. Analysis of activity-conferring clones
Plasmids were isolated employing the GeneJET Plasmid Miniprep Kit
(Thermo Scientific, Schwerte, Germany). Inserts of pCR-XL-TOPO were
sequenced by Eurofins MWG Operon (Ebersberg, Germany). Potential activityconferring open reading frames (ORFs) were identified with frameplot 4.0 beta
(http://nocardia.nih.go.jp/fp4/). BLAST (Basic Local Alignment Search Tool) analyses
were done to determine protein sequence identities employing GenBank (National
Center for Biotechnology Information, http://www.ncbi.nlm.nih.gov/). A hypothetical model was constructed on the basis of the deduced amino acid sequence using
the SWISS-MODEL workspace (http://swissmodel.expasy.org/) [17].
49
The identified potential catalytic glutamate residues were mutated by PCR
using degenerated primers exhibiting one exchanged base (E209 to G209 – for:
GCACAATGAATGGACCAAATGTAAC, rev: GTTACATTTGGTCCATTCATTGTGC; E395
to G395 – for: GATAACTGGAAATGGAGTAGC, rev: GCTACTCCATTTCCAGTTATC;
exchanged base is underlined). The constructs were fused using the flanking primers
of the gene and the purified fragments as template.
2.6. Biochemical characterization of Bgl1
Unless otherwise noted, the standard activity assay was carried out with 2 mM
4-NP-␤-d-glucopyranoside, 20 mM maleate buffer (pH 6.5) in a volume of 1 mL (with
deionized water) at 90 ◦ C in a heating block. After 10 min, the assay was stopped by
addition of 100 ␮L 0.1 M Na2 CO3 . The optical density was determined at ␭ = 410 nm.
One unit of ␤-glucosidase activity is defined as the amount of protein required to
release 1 ␮mol of 4-nitrophenol per min at 90 ◦ C and pH 6.5. Protein concentration
was determined using the Bradford assay [19]. When influence of pH values was
tested, Britton–Robinson buffer (20 mM) was used for a pH range between 3.0 and
10.0 [20]. Temperatures above 95 ◦ C were adjusted using heated oil.
Influence of pressure was directly tested by performing the activity assay
at 90 ◦ C in batch reactors [21]. Diluted enzyme was incubated at 90 ◦ C in a
reactor to investigate the influence of 100 and 200 bar on enzyme stability. Subsequently, after slow release of pressure, the activity assay was carried out at
90 ◦ C. Influence of metal ions at a final concentration of 1 or 5 mM (AgNO3 , AlCl3
(0.001–3 mM), CaCl2 , CoCl2 , CrCl3 , CuCl2 , FeCl2 , FeCl3 , KCl, MgCl2 , MnCl2 , NaCl,
NiCl2 , RbCl, SrCl2 and ZnCl2 ) was measured in 50 mM maleate buffer. Detergents (CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate),
CTAB (cetyltrimethyl-ammonium bromide), SDS, Triton X-100, Tween 20 and Tween
80), additives (␤-mercaptoethanol, DTT (dithiothreitol), EDTA (ethylenediaminetetraacetic acid), guanidine hydrochloride, urea, iodoacetic acid, sodium azide and
Pefabloc SC® ) were added to the assay to a final concentration of 5 mM and
organic solvents (acetone, acetonitrile, DMF (dimethylformamide), DMSO (dimethyl
sulfoxide), ethanol, methanol, 1,2-propanediol, 1-propanol and 2-propanol) were
supplemented to 10%. Substrates, such as 4-NP-␤-d-glucopyranoside, 4-NP-␣d-glucopyranoside, 4-NP-␤-d-galactopyranoside, 4-NP-␣-d-galactopyranoside, 2NP-␤-d-galacto-pyranoside, 4-NP-␤-d-fucopyranoside, 4-NP-␤-d-xylopyranoside,
4-NP-␤-d-manno-pyranoside, 4-NP-␤-d-cellobioside, 4-NP-␣-l-arabinopyranoside
and 4-NP-␤-d-glucuronide were tested in a final concentration of 2 mM. Cellobiose
(1%, w/v), cellotriose (0.1%, w/v) and lactose (1%, w/v) were analyzed by HPLC
(high-performance liquid chromatography) after incubation at 70 ◦ C for 3 h using
a HPX42A column (Bio-Rad, München, Germany). High purity water was filtrated
and flushed (helium, 10 min) before being employed as running solvent with a flow
rate of 0.6 mL/min. Enzyme stability was investigated by pre-incubation of pure
enzyme supplemented with 0.1 mg/mL BSA (bovine serum albumin) followed by an
activity assay at 90 ◦ C.
Kinetic parameters were determined by plotting reaction rates against substrate
concentrations followed by nonlinear regression analysis to determine Km and Vmax
[22]. The inhibition constant Ki was investigated by plotting the inverse reaction
rate using different substrate concentrations against inhibitor concentration [23].
2.7. Nucleotide sequence accession number
DNA sequence of bgl1 including flanking regions was deposited in GenBank
(HG326254).
3. Results
2.5. Gene expression and purification
3.1. Identification and analysis of the ORF bgl1
The gene bgl1 was amplified (for: GGATCCGTAAAGTTCCCTAAAGG, BamHI recognition site is underlined, rev: GTCGACCTAAGTAAGAACGTTTGG, SalI recognition site
is underlined) and ligated into subcloning vector pJET (Thermo Scientific, Schwerte, Germany) prior to transformation of E. coli NovaBlue. The plasmids were
isolated and bgl1 was recovered by restriction excision. The linear gene bgl1 was
ligated into BamHI/SalI linearized pQE-80L resulting in plasmid pQE-80L::bgl1. Subsequently, E. coli C43 cells were transformed. 1 L of E. coli C43 pQE-80L::bgl1 culture
was grown to an optical density ( = 600 nm) of 0.6. Gene expression was induced
with 0.1 mM IPTG. After 12 h of growth, cells were harvested by centrifugation
(7000 × g, 4 ◦ C, 10 min). Resuspension of sedimented cells was achieved with 15 mL
lysis buffer (50 mM NaH2 PO4 , 300 mM NaCl, 10 mM imidazole, pH 8). For cell disruption, pressure of 1000 psi was applied five times using a French Pressure Cell
Press (SLM-Aminco, Maryland, USA). After centrifugation (13,000 × g, 4 ◦ C, 15 min),
Ni-NTA-affinity chromatography was conducted with 4 mL of supernatant using NiNTA Agarose and Ni-NTA Spin Columns according to the manufacturer’s instructions
(Qiagen, Hilden, Germany). Pure elution fractions were dialyzed (Visking® dialysis
tubing, Serva, Heidelberg, Germany) in 20 mM maleate buffer, pH 6.5 (20 mM maleic
acid, 20 mM NaOH). Protein was visualized and the molecular mass was surveyed by
SDS-PAGE (12%, sodium dodecyl sulphate-polyacrylamide gel electrophoresis) [18].
The quaternary structure was investigated by native PAGE using the Pro Gel Tris
Glycin gel (4–20%) as recommended by the manufacturer (Anamed Elektrophorese,
Groß-Bieberau/Rodau, Germany).
The putative activity-conferring open reading frame (ORF) bgl1
(1488 bp) was identified in a metagenome derived from a hot spring
in the Azores (Portugal) by activity-based screening of the respective E. coli DH5␣ library using esculin as substrate. The deduced
protein sequence exhibited an identity of 53% (98% sequence overlap) to a putative ␤-galactosidase from Thermoproteus uzoniensis
(YP 004338090). The insert of the plasmid pCR-XL-TOPO comprised 3755 bp (Fig. 1). Besides bgl1, two further ORFs (glnS1
complete and xylA incomplete) were identified on different reading
frames but the insert of the gene library clone E. coli DH5␣ pCRXL-TOPO::bgl1 did not show an operon-like organization of ORFs.
The deduced amino acid sequence of glnS1 (1428 bp) exhibited 63%
identity in a 98% amino acid overlap to a putative glutamine synthetase from Caldiarchaeum subterraneum (BAJ49060). The deduced
protein sequence of the incomplete ORF xylA (276 bp) exhibited
51% identity to a section of a xylose-isomerase from Sphingobacterium sp. (YP 004318167). ORF bgl1 contained a GC content
50
C. Schröder et al. / Enzyme and Microbial Technology 57 (2014) 48–54
aa 4-477: GH1 superfamily
Bgl1: 495 aa
Insert: 3,755 bp
glnS: 1,428 bp
bgl1: 1,488 bp
xylA: 276 bp
Fig. 1. Insert organization of E. coli pCR-XL-TOPO::bgl1. The insert of pCR-XL-TOPO::bgl1 contained two complete and one incomplete ORF. The deduced protein sequence of
glnS exhibited 63% identity to a putative glutamine synthetase from Caldiarchaeum subterraneum (BAJ49060), bgl1 exhibited 53% identity to a putative ␤-galactosidase from
Thermoproteus uzoniensis (YP 004338090) and xylA is 51% identical to a partial putative xylose isomerase from Sphingobacterium sp. (YP 004318167). A conserved domain
characteristic for GH1 was detected (pfam00232: GH1 superfamily) within the deduced protein sequence of Bgl1.
of 36.6%. The GC content at the third base position in each triplicate (GC3 content) was shown to be 26.7%. The proportion of
purines accounted for 60%. Noticeably, out of six synonymous
arginine codons 19 codons were composed of AGA, three of
AGG and none of the remaining four. Additionally, 22 isoleucine
codons of ATA, four of ATC and eight of ATT were observed in
the nucleotide pattern. The deduced 495 amino acid comprising
sequence of Bgl1 exhibited a molecular mass of 57.2 kDa and a
theoretical pI of 6.3. Similarities to the glycoside hydrolase family 1 (GH1, cl01046) were detected. Conserved domains of GH1
(carbohydrate transport and mechanism, COG2723) and of GH1
superfamily (pfam00232) were detected ranging from amino acid
1 to 484 and from 4 to 477, respectively. A hypothetical tertiary model was constructed on the basis of sequence information
using the automated mode of the SWISS-MODEL workspace (data
not shown). A characteristic TIM-barrel structure was predicted,
wherein the conserved motifs asparagine–glutamate–proline and
threonine–glutamate–asparagine–glycine were detected. The glutamate residues (E209 and E395) were identified as potential
catalytic residues. Accordingly, the hypothetical model showed
these amino acids to be arranged in the center of the protein. To
confirm the catalytic function, mutants were constructed by single
base substitution resulting in glycine (G) replacing either E209 or
E395. The respective mutated E. coli strains exhibited no activity
toward esculin (Fig. 2).
The putative protein Bgl1 exhibited 50–53% identity to
putative glycoside hydrolases from species belonging to the
class Thermoprotei of the phylum Crenarchaeota, such as Thermoproteus uzoniensis (YP 004338090), Acidilobus saccharovorans
(YP 003816826), Caldivirga maquilingensis (YP 001540243) and
Vulcanisaeta moutnovskia (YP 004243760).
The transcription initiation motif was found to be typical for
archaeal genes with a TATA box-like region, just as described for
Fig. 3. SDS- and native PAGE analysis of purified Bgl1. Purified Bgl1 was verified by SDS PAGE (200 V, 50 min, M: Unstained Protein Molecular Weight Marker,
Fermentas and native PAGE (Pro Gel Tris Glycin 4–20%, 12 h, 80 V, 4 ◦ C, M: High
Molecular Weight marker, GE Healthcare) was employed for quaternary structure
investigation.
eukaryotes, between position −41 and −32 (TTATTAATT). Additionally, two upstream-located adenines at positions −47 and −46
(transcription factor B recognition site) were detected.
3.2. Enzyme purification
The ORF bgl1 was cloned into plasmid pQE-80L and overexpressed in E. coli C43. The protein Bgl1 was purified by Ni-NTA
affinity chromatography. A purification factor of 2.0 was determined with a yield of 6.2% (Table 1). The predicted monomeric
calculated molecular weight of 57.2 kDa was confirmed by SDSPAGE analysis (Fig. 3). The quaternary structure of Bgl1 was
predicted to be tetrameric by the program SWISS-MODEL (data not
shown). This was confirmed by detection of a single band at 230 kDa
by native PAGE analysis (Fig. 3).
3.3. Substrate specificity
Fig. 2. Plate activity test of point-mutated strains. Plated cells of E. coli C43
pQE-80L::bgl1 with single-base mutation in the E209-encoding triplet (G209), the
unmutated strain and with single-base mutation in the E395-encoding triplet
(G395). The respective glutamates were previously identified as catalytic residues
due to sequence comparisons. Activity was verified using esculin-agarose overlay.
The enzyme Bgl1 accepted a broad range of substrates and
preferred 4-NP-␤-d-fucopyranoside with a specific activity of
3529.7 U/mg (Table 2). The specific activity toward 4-NP-␤-dglucopyranoside was calculated to be 3194.7 U/mg and toward
4-NP-␤-d-galactopyranoside 2137.7 U/mg. Specific activities of
971.3 U/mg and 288.6 U/mg were obtained using 2-NP-␤-dgalacto-pyranoside and 4-NP-␤-d-xylopyranoside as substrate.
Lactose, cellobiose (Fig. 4) and cellotriose (data not shown)
C. Schröder et al. / Enzyme and Microbial Technology 57 (2014) 48–54
51
Table 1
Purification of Bgl1.
Crude extract
Ni-NTA
Protein [mg/mL]
Volume activity [U/mL]
43.0
0.1
4625.7
287.5
Total activity [U]
13,877.0
862.6
Specific activity [U/mg]
Purification factor
Yield [%]
1613.9
3194.7
1.0
2.0
100.0
6.2
Fig. 4. HPLC analyses of lactose and cellobiose degradation. The degradation of lactose and cellobiose by Bgl1 was investigated by conducting the activity assay at 70 ◦ C for
3 h in 20 mM maleate buffer (pH 6.5) using 1% (w/v) of substrate. Subsequently, the samples were subjected to HPLC analyses using a HPX42A column with a flow rate of
0.6 ml/min using high purity water.
Table 2
Substrate specificity of Bgl1.
3.5. Influence of temperature and pH
Substrate (2 mM)
Specific activity [U/mg]
4-NP-␤-d-fucopyranoside
4-NP-␤-d-glucopyranoside
4-NP-␤-d-galactopyranoside
2-NP-␤-d-galactopyranoside
4-NP-␤-d-xylopyranoside
3529.7
3194.7
2137.7
971.3
288.6
conversion was shown by HPLC analysis. After incubation for
3 h at 70 ◦ C, lactose was partially converted to form glucose and
galactose. Cellobiose was partially hydrolyzed to glucose.
3.4. Influence of hydrolysis products on Bgl1
The partial degradation of lactose, cellotriose and cellobiose
indicated an inhibitory effect of the hydrolysis products. The
activity of Bgl1 was measured at different concentrations of 4-NP␤-d-gluco-pyranoside (1, 2 and 3 mM) in the presence of glucose
(0.5, 1 and 1.5 M). The resulting point of intersection of the plotted results reflected the inhibition constant (Ki ) at 150 mM glucose
(data not shown). Moreover, the intersection point indicated a competitive type of inhibition.
Bgl1 was active over a broad temperature (55–115 ◦ C) and
pH (4.5–8.5) range using 4-NP-␤-d-glucopyranoside as substrate.
Highest activity was detected at 90 ◦ C and at pH 6.5 (Fig. 5). A residual activity of 62% ± 3 and 40% ± 3 was measured at 100 ◦ C and
105 ◦ C, respectively. To analyze the thermostability, the enzyme
was incubated separately at different temperatures. Subsequently,
the activity assay was performed at 90 ◦ C (Fig. 6). A heat activation
of Bgl1 was measured after 30 min at 90 ◦ C (185% ± 10). Incubation for 1.5 h at 90 ◦ C resulted in a residual activity of 67% ± 9. After
an incubation time of 24 h at 50 and 60 ◦ C the residual activity
was 78% ± 6 and 68% ± 7, respectively. The enzyme was completely
stable at 4 ◦ C and pH 4.5–9.5 for at least two days (data not shown).
3.6. Influence of pressure
Activity assays were performed at 1, 100 and 200 bar at 90 ◦ C to
investigate the influence of pressure on the activity of Bgl1. Pressure
(1–200 bar) did not directly influence the enzymatic activity. However, the preincubation of the enzyme at various pressures had a
significant effect on the catalytic performance. After pretreatment
at 100 and 200 bar for 60 min at 90 ◦ C, the activity was raised to
Fig. 5. Effect of temperature and pH on activity of Bgl1. (A) The ␤-glucosidase activity of Bgl1 was measured at different temperatures (35–115 ◦ C) in 20 mM maleate buffer
(pH 6.5) and (B) at different pH values (3–10) at 90 ◦ C with 2 mM 4-NP-␤-d-glucopyranoside. Temperatures above 95 ◦ C were measured in heated oil (discontinuous line).
52
C. Schröder et al. / Enzyme and Microbial Technology 57 (2014) 48–54
Table 3
Effects of metal ions on the activity of Bgl1.
Fig. 6. Effect of temperature on stability of Bgl1. The ␤-glucosidase activity of Bgl1
was measured at 90 ◦ C in 20 mM maleate buffer (pH 6.5) with 2 mM 4-NP-␤-dglucopyranoside after incubation of enzyme separately at different temperatures
(50–90 ◦ C). The starting activities were set to 100%.
Reagent
Relative activity [%] (1 mM)
Relative activity [%] (5 mM)
None
AgNO3
AlCl3
CaCl2
CoCl2
CrCl3
CuCl2
FeCl2
FeCl3
KCl
MgCl2
MnCl2
NaCl
NiCl2
RbCl
SrCl2
ZnCl2
100 ±
–
168 ±
105 ±
101 ±
126 ±
–
101 ±
112 ±
102 ±
104 ±
72 ±
100 ±
88 ±
102 ±
98 ±
–
100 ±
–
49 ±
69 ±
90 ±
55 ±
–
45 ±
31 ±
101 ±
108 ±
84 ±
99 ±
83 ±
103 ±
93 ±
–
5
1
4
5
3
3
5
2
4
6
2
3
1
3
5
5
4
2
7
12
7
2
1
4
1
10
3
2
Table 4
Effects of chemical reagents on the activity of Bgl1.
Reagent (5 mM)
Relative activity [%]
None
␤-Mercaptoethanol
CHAPS
CTAB
DTT
EDTA
Guanine hydrochloride
Pefabloc
SDS
Triton X-100
Tween 20
Tween 80
100
113
81
6
119
126
28
44
46
118
52
41
±
±
±
±
±
±
±
±
±
±
±
±
5
3
6
2
2
8
6
4
7
5
5
4
3.7. Influence of various additives
Fig. 7. Effect of pressure on stability of Bgl1. Bgl1 was incubated at atmospheric pressure (1 bar), 100 bar and 200 bar for one and 2 h at 90 ◦ C. Subsequently, the residual
activity was measured with 4-NP-␤-d-glucopyranoside (2 mM) and maleate buffer
(20 mM, pH 6.5) at 90 ◦ C and 1 bar.
246% ± 11 and 224% ± 17, respectively (Fig. 7). When the enzyme
was subjected to 100 and 200 bar at 90 ◦ C for a longer period (2 h),
the activity measured subsequently was raised to 255% ± 7 and
330% ± 7, respectively. Under standard condition (1 bar) a decrease
of activity to 45% ± 6 was observed.
180
relative activity [%]
160
140
Addition of 1 mM CaCl2 , FeCl2 and FeCl3 and 1 or 5 mM of CoCl2 ,
KCl, MgCl, MnCl2 , NaCl, NiCl2 , RbCl and SrCl2 did not significantly
influence the activity (Table 3). AgNO3 , CuCl2 and ZnCl2 (1 mM)
completely inhibited the enzyme. The presence of 1 mM CrCl3 and
AlCl3 led to an increase of activity of up to 126% ± 3 and 168% ± 1,
whereas a concentration of 5 mM reduced the activity. To further investigate the influence of aluminum ions on the activity of
Bgl1, different concentrations between 0.001 and 3.0 mM of AlCl3
were tested. The enzymatic action was enhanced in presence of
0.1–2 mM (Fig. 8).
The addition of the detergents CTAB, guanine hydrochloride,
Pefabloc, SDS, Tween 20 and Tween 80 (5 mM) reduced the activity
of Bgl1 significantly (Table 4). The disulfide bond reducing agents
␤-mercaptoethanol and DTT increased the activity of Bgl1. The
presence of urea, iodacetic acid and sodium azide had no influence
(data not shown), whereas EDTA enhanced the activity (Table 4).
120
100
Table 5
Effects of solvents on the activity of Bgl1.
80
60
40
20
0
0
0.001
0.01
0.1
0.2
0.5
1
2
3
aluminum chloride [mM]
Fig. 8. Effect of aluminum chloride on activity of Bgl1. The ␤-glucosidase activity
of Bgl1 was measured in the presence of different aluminum ion concentrations
(0–3 mM) in 50 mM maleate buffer (pH 6.5) and 90 ◦ C with 2 mM 4-NP-␤-dglucopyranoside.
Reagent (10%)
Relative activity [%]
None
Acetone
Acetonitrile
DMF
DMSO
Ethanol
Methanol
1-Propanol
1,2-Propanediol
2-Propanol
100 ±
67 ±
16 ±
41 ±
63 ±
63 ±
81 ±
–
52 ±
31 ±
5
23
13
5
2
13
17
1
18
C. Schröder et al. / Enzyme and Microbial Technology 57 (2014) 48–54
53
Table 6
Kinetic parameters of Bgl1.
Substrate (2 mM)
Salt (1 mM)
Vmax [␮mol/min]
Km [mM]
kcat [s−1 ]
kcat /Km [mM/s]
4-NP-␤-d-glucopyranoside
4-NP-␤-d-glucopyranoside
4-NP-␤-d-galactopyranoside
4-NP-␤-d-galactopyranoside
–
AlCl3
–
AlCl3
0.022
0.021
0.027
0.026
0.8
0.4
6.5
3.8
19,922
19,081
24,451
23,546
26,213
54,517
3779
6262
The addition of solvents (10%), such as acetone, acetonitrile,
DMF, DMSO, ethanol, methanol, 2-propanol and 1,2-propanediol
resulted in the reduction of activity, while 1-propanol completely
inhibited Bgl1 (Table 5).
3.8. Enzyme kinetics
The kinetic parameters were determined using 4-NP-␤-d-glucopyranoside and 4-NP-␤-d-galactopyranoside as substrate. Since
the addition of 1 mM AlCl3 led to an increase of enzyme activity,
kinetic experiments were performed in the presence and absence
of Al3+ simultaneously (Table 6). Km amounted to 0.8 mM 4-NP␤-d-glucopyranoside and 6.5 mM 4-NP-␤-d-galactopyranoside. In
the presence of aluminum ions the Km values decreased to 0.4 mM
and 3.8 mM, respectively, while no change in the maximum
reaction rate (Vmax ) was observed. The catalytic efficiency (kcat /Km )
was hence higher in the presence of the inorganic salt (Table 6).
Values of 54,517 mM 4-NP-␤-d-glucopyranoside and 6262 mM
4-NP-␤-d-galactopyranoside per second were calculated.
4. Discussion
Thermostable ␤-glucosidases are required for various biotechnological applications including food and beverage industry and
lignocellulose-utilizing biorefineries. The finding of a novel heatactive ␤-glucosidase will contribute to the exploration of the divers
genetic potential of extreme habitats. Several typical characteristics
indicate that the gene encoding Bgl1 is of archaeal origin. The open
reading frame exhibited transcription initiation regions typical for
Archaea. Furthermore, the arginine codon AGA and the isoleucine
codon ATA were reported to occur most frequently in archaeal
genes [24,25]. Accordingly, a preference for these codons was
detected within the codon usage pattern of bgl1. A codon preference
within synonymous codons was reported to result from selective
pressure within evolution of populations. A specific pattern may
help to identify phylogenetic relationships [26]. In addition, the
deduced protein Bgl1 exhibited structural similarities (50 to 53%)
to annotated, uncharacterized enzymes from the archaeal families Thermoprotacea and Acidilobacea. Recently, the diversity of
prokaryotes isolated from a hot spring at Furnas Valley (Azores,
Portugal) was investigated by 16S rRNA gene sequence analysis.
About 25% of Crenarchaeota in this sample were described to be
representatives of Thermoproteacea [14]. Since the gene bgl1 was
isolated from the same sampling site, an uncultured crenarchaeon
is assumed as originating host.
Potential characteristics of nucleotide sequences from thermophiles, such as the presence of a high GC content, a high GC3
content or a high purine proportion were not detected for bgl1
[27,28]. Crenarchaeal genes encoding thermostable proteins were
reported to differ from corresponding bacterial genes, especially by
their low content of guanine and cytosine [29].
Homology modeling predicted the protein Bgl1 to display typical GH1 characteristics with a compact TIM-barrel structure and
two potential catalytic glutamate residues (E209 and E395). The
catalytic requirement was confirmed by single base mutations
resulting in proteins with G209 or G395 that did not show ␤glucosidase activity toward esculin. Similar mutants constructed
by other authors also reflected the functional importance of the
previously sequence-based identified catalytic glutamate residues
[30,31]. The probable homotetrameric complex consisted of four
57.2 kDa monomeric units, which is in good agreement to prior
reported ␤-glucosidases affiliated to GH family 1 [9]. Several
short chain sugar components were degraded, such as lactose,
cellobiose and cellotriose. Notable high specific activities (more
than 3190 U/mg) were calculated for the conversion of 4-NP␤-d-fucopyranoside and 4-NP-␤-d-glucopyranoside. The majority
of characterized ␤-glucosidases were reported to exhibit specific activities below 100 U/mg (http://www.brenda-enzymes.org).
Moreover, Bgl1 showed a tolerance against glucose with Ki for competitive inhibition amounting to 150 mM, which is comparable to
other enzymes, such as the thermostable ␤-glucosidase from Fervidobacterium islandicum with a Ki value of 211 mM glucose [32].
The thermostability of the enzyme at 90 ◦ C was enhanced 5- or
7-fold after 2 h when pressure (100 and 200 bar) was applied. Activities higher than 300% were observed. Usually, heat causes enzymes
to unfold and aggregate [33]. It can be assumed that pressure counteracts denaturation of Bgl1 at 90 ◦ C by promoting the compact
structure with an increase in packing [34]. Especially enzymes from
thermophiles, particularly archaeal proteins, were described to be
stabilized at high temperatures and simultaneous application of
pressure [35,36]. For instance, the thermostability of a protease
produced by Methanococcus jannaschii increased almost 3-fold at
125 ◦ C and 500 bar [37].
Noticeably, aluminum chloride influenced the enzyme affinity
rather than the maximum reaction rate. An enhanced activity in the
presence of Al3+ was recently described for the ␤-glucosidase from
Thermotoga thermarum [38]. Crystal structures might shed light on
the interaction of aluminum with the enzyme.
The good performance of the ␤-glucosidase Bgl1 at temperatures up to 105 ◦ C and under moderate pressure as well as the
good tolerance toward hydrolysis products, various reagents and
solvents make this enzyme an ideal candidate for application in
such processes.
Acknowledgments
This work was supported by the German Federal Ministry of
Education and Research (BMBF) in the funding cluster “Biorefinery2021”. Thanks are also due to CLARIANT, formerly Süd-Chemie,
for financial support and interest. Further thanks are due to Vera
Haye, Milton da Costa, Christian Kirsch and Irina Smirnova for support, advice and supply of equipment.
References
[1] Egorova K, Antranikian G. Industrial relevance of thermophilic Archaea. Curr
Opin Microbiol 2005;8:649–55.
[2] Adams MW. Enzymes and proteins from organisms that grow near and above
100 degrees C. Annu Rev Microbiol 1993;47:627–58.
[3] Krahe M, Antranikian G, Markl H. Fermentation of extremophilic microorganisms. FEMS Microbiol Rev 1996;18:271–85.
[4] Eichler J. Biotechnological uses of archaeal extremozymes. Biotechnol Adv
2001;19:261–78.
[5] Rizk M, Antranikian G, Elleuche S. End-to-end gene fusions and their impact
on the production of multifunctional biomass degrading enzymes. Biochem
Biophys Res Commun 2012;428:1–5.
54
C. Schröder et al. / Enzyme and Microbial Technology 57 (2014) 48–54
[6] Kirsch C, Zetzl C, Smirnova I. Development of an integrated thermal and
enzymatic hydrolysis for lignocellulosic biomass in fixed-bed reactors. Holzforschung 2011;65:483–9.
[7] Lynd LR, Weimer PJ, van Zyl WH, Pretorius IS. Microbial cellulose utilization:
fundamentals and biotechnology. Microbiol Mol Biol Rev 2002;66:506–77.
[8] Ketudat Cairns JR, Esen A. beta-Glucosidases. Cell Mol Life Sci 2010;67:
3389–405.
[9] Bhatia Y, Mishra S, Bisaria VS. Microbial beta-glucosidases: cloning, properties,
and applications. Crit Rev Biotechnol 2002;22:375–407.
[10] Rondon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR,
et al. Cloning the soil metagenome: a strategy for accessing the genetic and
functional diversity of uncultured microorganisms. Appl Environ Microbiol
2000;66:2541–7.
[11] Steele HL, Streit WR. Metagenomics: advances in ecology and biotechnology.
FEMS Microbiol Lett 2005;247:105–11.
[12] Daniel R. The metagenomics of soil. Nat Rev Microbiol 2005;3:470–8.
[13] Antranikian G, Vorgias CE, Bertoldo C. Extreme environments as a resource
for microorganisms and novel biocatalysts. Adv Biochem Eng Biotechnol
2005;96:219–62.
[14] Sahm K, John P, Nacke H, Wemheuer B, Grote R, Daniel R, et al. High abundance of heterotrophic prokaryotes in hydrothermal springs of the Azores
as revealed by a network of 16S rRNA gene-based methods. Extremophiles
2013;17:649–62.
[15] Zhou JZ, Bruns MA, Tiedje JM. DNA recovery from soils of diverse composition.
Appl Environ Microbiol 1996;62:316–22.
[16] Zhang K, Martiny AC, Reppas NB, Barry KW, Malek J, Chisholm SW, et al.
Sequencing genomes from single cells by polymerase cloning. Nat Biotechnol
2006;24:680–6.
[17] Arnold K, Bordoli L, Kopp J, Schwede T. The SWISS-MODEL workspace: a webbased environment for protein structure homology modelling. Bioinformatics
2006;22:195–201.
[18] Laemmli UK. Cleavage of structural proteins during the assembly of the head
of bacteriophage T4. Nature 1970;227:680–5.
[19] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein–dye binding. Anal
Biochem 1976;72:248–54.
[20] Britton HTS, Robinson RA. Universal buffer solutions and the dissociation comstant of veronal. J Chem Soc 1931:1456–73.
[21] Kirsch C, Wörmeyer K, Zetzl C, Smirnova I. Enzymatic hydrolysis of lignocellulose in a fixed bed reactor. Chem Ing Tech 2011;83:867–73.
[22] Michaelis L, Menten ML. Die Kinetik der Invertinwirkung. Biochem Z
1913;49:333–69.
[23] Dixon M. The determination of enzyme inhibitor constants. Biochem J
1953;55:170–1.
[24] Noguchi H. MetaGene: prediction of prokaryotic and phage genes in metagenomic sequences. Handbook of molecular microbial ecology I: Metagenomics
and complementary approaches, vol. 1. Hoboken, NJ: John Wiley & Sons, Inc.;
2011. p. 433.
[25] Brown JW, Daniels CJ, Reeve JN. Gene structure, organization, and expression
in Archaebacteria. CRC Crit Rev Microbiol 1989;16:287–338.
[26] Andersson SGE, Kurland CG. Codon preferences in free-living microorganisms.
Microbiol Rev 1990;54:198–210.
[27] Lao PJ, Forsdyke DR. Thermophilic bacteria strictly obey Szybalski’s transcription direction rule and politely purine-load RNAs with both adenine and
guanine. Genome Res 2000;10:228–36.
[28] Hurst LD, Merchant AR. High guanine-cytosine content is not an adaptation to
high temperature: a comparative analysis amongst prokaryotes. Proc Biol Sci
2001;268:493–7.
[29] Schleper C, Jurgens G, Jonuscheit M. Genomic studies of uncultivated archaea.
Nat Rev Microbiol 2005;3:479–88.
[30] Cupples CG, Miller JH. Effects of amino acid substitutions at the active site in
Escherichia coli beta-galactosidase. Genetics 1988;120:637–44.
[31] Vallmitjana M, Ferrer-Navarro M, Planell R, Abel M, Ausin C, Querol E, et al.
Mechanism of the family 1 beta-glucosidase from Streptomyces sp: catalytic
residues and kinetic studies. Biochemistry 2001;40:5975–82.
[32] Jabbour D, Klippel B, Antranikian G. A novel thermostable and glucose-tolerant
beta-glucosidase from Fervidobacterium islandicum. Appl Microbiol Biotechnol
2012;93:1947–56.
[33] Winter R, Dzwolak W. Exploring the temperature-pressure configurational
landscape of biomolecules: from lipid membranes to proteins. Philos Trans A
Math Phys Eng Sci 2005;363:537–62.
[34] Kirsch C, Dahms J, Kostko AF, McHugh MA, Smirnova I. Pressure assisted stabilization of biocatalysts at elevated temperatures: characterization by dynamic
light scattering. Biotechnol Bioeng 2012.
[35] Hei DJ, Clark DS. Pressure stabilization of proteins from extreme thermophiles.
Appl Environ Microbiol 1994;60:932–9.
[36] Danson MJ, Hough DW. Structure, function and stability of enzymes from the
Archaea. Trends Microbiol 1998;6:307–14.
[37] Michels PC, Clark DS. Pressure-enhanced activity and stability of a hyperthermophilic protease from a deep-sea methanogen. Appl Environ Microbiol
1997;63:3985–91.
[38] Zhao L, Xiea J, Zhanga X, Caob F, Pei J. Overexpression and characterization of a
glucose-tolerant ␤-glucosidase from Thermotoga thermarum DSM 5069T with
high catalytic efficiency of ginsenoside Rb1 to Rd. J Mol Catal 2013;95:62–9.