Download Ischemic dysfunction in transgenic mice expressing - AJP

Am J Physiol Heart Circ Physiol
280: H835–H843, 2001.
Ischemic dysfunction in transgenic mice expressing
troponin I lacking protein kinase C phosphorylation sites
Received 1 March 2000; accepted in final form 13 September 2000
MacGowan, Guy A., Congwu Du, Douglas B. Cowan,
Christof Stamm, Francis X. McGowan, R. John Solaro,
Alan P. Koretsky, and Pedro J. Del Nido. Ischemic dysfunction in transgenic mice expressing troponin I lacking
protein kinase C phosphorylation sites. Am J Physiol Heart
Circ Physiol 280: H835–H843, 2001.—To determine the in
vivo functional significance of troponin I (TnI) protein kinase
C (PKC) phosphorylation sites, we created a transgenic
mouse expressing mutant TnI, in which PKC phosphorylation sites at serines-43 and -45 were replaced by alanine.
When we used high-perfusate calcium as a PKC activator,
developed pressures in transgenic (TG) perfused hearts were
similar to wild-type (WT) hearts (P ⫽ not significant, NS),
though there was a 35% and 32% decrease in peak-systolic
intracellular calcium (P ⬍ 0.01) and diastolic calcium (P ⬍
0.005), respectively. The calcium transient duration was prolonged in the TG mice also (12–27%, ANOVA, P ⬍ 0.01).
During global ischemia, TG hearts developed ischemic contracture to a greater extent than WT hearts (41 ⫾ 18 vs. 69 ⫾
10 mmHg, perfusate calcium 3.5 mM, P ⬍ 0.01). In conclusion, expression of mutant TnI lacking PKC phosphorylation
sites results in a marked alteration in the calcium-pressure
relationship, and thus susceptibility to ischemic contracture.
The reduced intracellular calcium and prolonged calcium
transients suggests that a potent feedback mechanism exists
between the myofilament and the processes controlling calcium homeostasis.
PROTEIN KINASE C (PKC) may have multiple and varied
effects on myocyte function through phosphorylation
of several intracellular sites, including L-type calcium channels (23), ATP-sensitive K⫹ (KATP) channels (14), and several myofilament proteins, including troponin I (TnI) (19, 29). Noland et al. (19) have
shown in reconstituted myofilaments that PKC may
mediate a reduction in the maximal calcium-stimulated ATPase rate of reconstituted actomyosin S-1,
and apparent affinity of myosin S-1 for the thin
filament. These effects are largely mediated through
phosphorylation of serines-43 and -45 of TnI, and
replacement of these with alanine results in nearcomplete preservation in ATPase activity in response
to PKC. Also, Takeishi et al. (27) have demonstrated
that in vivo phosphorylation of TnI by PKC decreases
myofilament responsiveness to calcium and contractility.
In hearts, in which the PKC sites are phosphorylated, it would be expected that the force generated
(developed pressure) for a given level of intracellular
calcium is reduced. Alteration in the force-calcium
relationship may have several functional consequences. During ischemia there is a gradual increase
in intracellular calcium and reduction in ATP, with
ultimate development of ischemic contracture (25).
PKC is activated during ischemia (1), and its effects
on the force-calcium relationship mediated through
TnI may protect against the development of contracture during states of high intracellular calcium. Another consequence of alteration in the force-calcium
relationship may be an increase in energy utilization. When these PKC sites are phosphorylated, the
maintenance of high calcium levels with reduced
force would be expected to adversely effect the relationship between developed pressure and oxygen
consumption, because cycling of calcium may use a
significant proportion of ATP consumption and thus
oxygen consumption (10).
The present study examined the functional and energetic effects of PKC phosphorylation of serine residues 43 and 45 by generating a transgenic mouse
Address for reprint requests and other correspondence: G. A.
MacGowan, Cardiovascular Institute of the Univ. of Pittsburgh Medical Center, S550 Scaife Hall, 200 Lothrop St., Pittsburgh, PA 15213
(E-mail: [email protected]).
The costs of publication of this article were defrayed in part by the
payment of page charges. The article must therefore be hereby
marked ‘‘advertisement’’ in accordance with 18 U.S.C. Section 1734
solely to indicate this fact.
calcium; ischemia
http://www.ajpheart.org
H835
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
GUY A. MACGOWAN,1,4 CONGWU DU,3 DOUGLAS B. COWAN,7 CHRISTOF STAMM,7
FRANCIS X. MCGOWAN,7 R. JOHN SOLARO,6 ALAN P. KORETSKY,1,2,5
AND PEDRO J. DEL NIDO7
1
Pittsburgh Nuclear Magnetic Resonance Center for Biomedical Research, 2Department of Biological
Sciences, and 3Center for Light Microscope Imaging and Biotechnology, Carnegie Mellon University,
Pittsburgh 15213; 4Cardiovascular Institute of the University of Pittsburgh Medical Center,
Pittsburgh, Pennsylvania 15261; 5National Institute of Neurological Disease and Stroke,
Bethesda, Maryland 20814; 6Department of Physiology and Biophysics, College of Medicine,
University of Illinois, Chicago, Illinois 60612; and 7Harvard Medical School,
Boston, Massachusetts 02115
H836
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
expressing mutant TnI, in which these phosphorylation sites are replaced with alanine.
METHODS
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
Generation of transgenic mice. All of the studies were
performed in accordance with institutional guidelines. cDNA
for mutant TnI, in which the PKC phosphorylation sites
(serines-43 and -45) were replaced with alanine (19), was
placed under the control of the cardiac-specific ␣-myosin
heavy chain promoter (26). To generate transgenic mice, the
transgene was microinjected into FVB zygotes with the use of
standard methods (12). Microinjected embryos were reimplanted into pseudopregnant FVB female mice. By using the
polymerase chain reaction (PCR) with the following primer
sequences: CCG AGA TTT CTC CAT CCC AAG 5⬘ and GCA
TCG CTG CTT TCA TCA GCC 3⬘, we detected the presence
of mutant cardiac TnI transgene, making use of the heterologous junction between the myosin heavy chain promoter
and TnI cDNA.
RNA isolation and RT-PCR. Total RNA was isolated from
mouse hearts using standard procedures, then digested with
RQ1 RNase-free DNase (Promega) to remove any contaminating DNA. Spectrophotometric quantitation of purified
RNA was confirmed visually by agarose-formaldehyde electrophoresis of RNA. RT-PCR was performed with the use of
an Access System (Promega) with primer pairs designed to
the cDNA sequences of mus musculus CD-1 cardiac TnI
(Genbank Accession, U09181) and mouse G3PDH (Clontech).
The CD-1 primers correspond to the 3⬘ end (⫹627 to ⫹607:
AAACTTTTTCTTGCGGCCTTC) and the wild-type (AAGTCTAAGATCTCCGCCT) or mutant (AAGTCTAAGATCGCCGCCG) ⫹115 to ⫹133 region. We used 100 ng of purified
total RNA for the reactions. The primer sets produced predicted product sizes of 512 bp for CD-1 and 452 bp for
G3PDH. A linear range of amplification profile for each
primer set was established on the basis of the following
cycling parameters: reverse transcription step (1 cycle of
48°C for 45 min and 94°C for 2 min), PCR step (up to 40 cycles
of 94°C for 30 s, 60°C for 60 s, and 68°C for 120 s), and
extension step (1 cycle of 68°C for 7 min; 4°C soak). A
midpoint of the linear amplification range was determined
for CD-1 and G3PDH RT-PCR products to be at cycles 30 and
24, respectively. Negative controls included tubes that lacked
RNA, avian myeloblastosis virus (AMV) reverse transcriptase, or Tfl DNA polymerase. The identity of each PCR
product was confirmed by ligating the DNA fragments into
the PCRII vector (Invitrogen) and sequencing these by using
standard molecular biology techniques. Equal volumes of
amplified products were loaded in each lane of a 1% Tris,
acetic acid, and EDTA (TAE)-buffered agarose gel and electrophoresed with the 100-bp ladder (Life Technologies). The
results are not strictly semiquantitative; however, care was
taken to assure that starting total RNA amounts were the
same for each sample and the cycling parameters were adjusted for each primer pair to ensure PCR was stopped
during the linear segment of the amplification profile. All
samples contained an equal amount of G3PDH amplification
product (not shown).
Immunoblot analyses. Hearts were snap-frozen in liquid
nitrogen and stored at ⫺80°C. To determine total cardiac TnI
levels, proteins were isolated from the frozen hearts by
Dounce homogenization in a small volume of ice-cold lysis
solution, consisting of 150 mM NaCl, 20 mM Tris 䡠 HCl pH
7.6, 1 mM EDTA, 0.5% sodium deoxycholate, 70 mM NaF, 1%
Nonidet P-40, a protease inhibitor cocktail (Complete; Boehringer Mannheim), 200 ␮M sodium orthovanadate, and 2 ␮M
phenylmethylsulfonyl fluoride (PMSF). Debris was pelleted
and the supernatants were stored at ⫺80°C. Protein concentrations were established using the Pierce BCA protein determination kit. SDS-PAGE and transfer to nitrocellulose
were performed by using standard procedures, and identical
gels were stained with Coomassie brilliant blue R250 to
confirm equal protein loading. Nitrocellulose membranes
were rinsed in Tris-buffered saline pH 7.4 containing 0.1%
Tween 20 (TBS-T) and blocked in 5% nonfat milk; TBS-T for
1 h at 22°C on a rocking platform. Membranes were rinsed
four times in TBS-T then incubated overnight at 4°C on an
orbital shaker with primary antibodies diluted in TBS-T. The
anti-human cardiac-specific TnI monoclonal antibodies (either 3314 11E1.3 or 3350 2F6.6, a gift from Dr. Jack Ladenson, Washington University, St. Louis, MO) were used at a
final concentration of 1 ␮g/ml and found to react equally well.
The primary antibody was detected with horseradish peroxidase-conjugated anti-mouse secondary antibody and the
ECL kit (Amersham) according to the manufacturer’s directions before exposure to X-Omat AR film (Kodak).
Experimental design and isolated perfused mouse heart
studies. Because calcium-induced inotropy is partly mediated
by PKC (15, 17), high calcium was used as an activator of
protein kinase C. In other studies, global ischemia, which is
also associated with high calcium (25) and PKC activation
(1), was used.
Anesthesia was induced with 1.5–3.0 mg of intraperitoneal pentobarbital sodium, and the animal was anticoagulated with 100 units of heparin sodium. Hearts were gravity
perfused with a perfusion pressure of 55 mmHg and stimulated at the physiological mouse heart rate of 8 Hz. Left
ventricular pressure was measured with a balloon within the
left ventricle. The left ventricular diastolic pressure was set
at 0–10 mmHg with the use of a microsyringe. The modified
Krebs solution used consisted of 113 mM NaCl, 4.7 mM KCl,
1.2 mM MgSO4, 0.5 mM Na-EDTA, 28.0 mM NaHCO3, 5.5
mM glucose, 5.0 mM pyruvate, 2.5 mM CaCl2, and 50 ␮M
octanoate. The solution was oxygenated with 95% O2-5% CO2
and pH adjusted to 7.4. In some studies, perfusate calcium
was increased to 3.5 mM, and therefore the concentration of
NaCl was adjusted accordingly to maintain osmolarity. To
eliminate the effects of cathecholamine release by pacing, 0.1
␮M esmolol (DuPont; Wilmington, DE) was added to the
perfusate. In a subgroup of experiments myocardial oxygen
consumption was measured. The perfused mouse heart was
placed in a glass, water-jacketed chamber, which was sealed
at the top. Myocardial oxygen consumption was determined
from influent and effluent oxygen content measured by a
blood gas analyzer (model 30; ABL, Copenhagen, Denmark)
and flow rate.
Ischemia experiments. In another group of experiments,
hearts were perfused as described above for a baseline period
of 10 min and then underwent 15 min of global no-flow
ischemia, followed by 20 min of reperfusion. To determine
that PKC-⑀ translocated during ischemia, hearts were exposed to the same ischemic conditions and time as above and
then flash frozen in liquid nitrogen and compared with control hearts not exposed to ischemia. Left ventricular tissue
was homogenized in ice-cold buffer containing 20 mM
Tris 䡠 HCl, 2 mM EDTA, 0.5 mM EGTA, 1 mM PMSF, 25
␮g/ml leupeptin, 0.3 mM sucrose at pH 7.4 and centrifuged at
1,000 g for 5 min to remove tissue debris. Cytosolic and
particulate fractions were separated by ultracentrifugation
of the supernatant (100,000 g for 60 min). The resulting
supernatant (cytosolic fraction) was collected, and the pellet
(particulate fraction) was resuspended in sucrose-free buffer
containing 1% Triton X, incubated for 60 min at 4°C, and
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
RESULTS
Description of mice. All studies were performed in
isolated perfused mouse hearts from transgenic mice
and FVB age-matched controls. Mice were aged between 8 and 40 wk. All experiments were done in
males, except for three females in the wild-type group,
and one female in the transgenic group. Founders 2, 7,
and 9 were identified as the highest expressers by
mRNA levels. In founders 2 and 7 amounts of wild-type
and mutant mRNA were approximately equal, and in
Fig. 1. Agarose gel of RT-PCR products from wild-type (WT) and
transgenic (TG) mice. Lanes 2–5 are from 2 WT controls, lanes 6 and
7 from founder 2 (m2), lanes 8 and 9 from founder 7 (m7), and 10 and
11 from founder 9 (m9). ⫹, WT mRNA and ⫺, mutant mRNA. In
founders 2 and 7 amounts of mutant and WT mRNA are approximately equal, and in founder 9 mutant mRNA is less than in WT
mice. cTnI, cardiac troponin I; bp, base pair.
Fig. 2. A representative immunoblot of total cTnI levels from WT
and TG mice. Lanes 1 and 2 are from 2 WT controls, lane 3 from m2,
lane 4 from m7, and lane 5 from m9.
founder 9 the amount of mutant mRNA was less than
wild-type mRNA (Fig. 1). In preliminary studies no
functional differences were noted between these
founders in terms of developed pressures, heart-tobody weight ratios, ischemic contracture pressure,
myocardial oxygen consumption, or intracellular calcium (data not shown). All of the founders were used in
the ischemia experiments, and founder 7 was used for
the myocardial oxygen consumption and founder 9 for
the intracellular calcium experiments. TnI antibodies
did not selectively identify the mutant protein from
wild-type mice, though total immunoreactive TnI was
similar in wild-type and transgenic mice (Fig. 2), suggesting that the total amount of TnI was closely regulated, and that any excess protein was degraded. Mice
expressing mutant TnI appeared normal, and there
was no significant difference in heart-to-body weight
ratios (Table 1). Also, systolic and diastolic pressures
were not significantly different between transgenic and
wild-type mice (Table 1), and histology revealed no
abnormalities in transgenic mouse hearts (Fig. 3).
Intracellular calcium. Systolic and diastolic intracellular calcium was significantly lower in transgenic mice
(ANOVA, P ⱕ 0.001). Levels of intracellular calcium were
reduced by 35% and 32% at peak systole and diastole,
respectively, at perfusate calcium of 3.5 mM (Table 2, and
Fig. 4). Developed pressure was not significantly different between wild-type and controls, indicating that the
pressure-calcium relationship in the transgenic mice was
significantly altered compared with controls. The duration of the calcium transient (measured from the initial
increase in intracellular calcium to 90% of return to
baseline) was increased by 27% in the transgenic mice at
perfusate calcium 2.5 mM, and 12% at perfusate calcium
3.5 mM (ANOVA, P ⬍ 0.01). Further information regarding the pressure-calcium relationship was obtained from
pressure-calcium plots (Fig. 4). These were created from
simultaneous pressure and calcium (derived from fluorescence) measurements, averaged over five to seven
cardiac cycles. Consistent with the altered pressure-calcium relationship, pressure at the peak of the calcium
transient was increased in the transgenic mice despite
the prolongation of the calcium transient. The subsequent slope of calcium decay versus pressure (taken from
peak calcium to peak pressure) was decreased in the
transgenic mice reflecting both the prolonged calcium
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
centrifuged at 40,000 g for 15 min. SDS-PAGE and transfer
to nitrocellulose was performed as described above. The
membranes were incubated with a rabbit polyclonal antibody
raised against murine PKC-⑀ (Upstate) at 1 ␮g/ml and detected with a horseradish peroxidase-conjugated anti-rabbit
secondary antibody and the ECL kit (Amersham). After exposure to film, quantitative protein analysis was performed
by laser densitometry.
Measurement of intracellular calcium in whole perfused
mouse hearts with rhod 2. The methods used to measure
intracellular calcium with rhod 2 (Molecular Probes, Eugene,
OR) in perfused hearts have been previously extensively
described (7, 8). Excitation at 524 nm and emission at 589 nm
was used for fluorescence measurements. We quantified the
relative amount of rhod 2 in the heart with the use of
absorbance measurements, by taking the ratio of absorbance
at 524 nm (rhod-2 sensitive) to 589 nm (rhod-2 insensitive).
This procedure eliminated the effect of motion and scattering
changes because both are equally affected by motion and
concentration, though only 524 reflects the concentration of
rhod 2 (7, 8). Rhod 2 (100 ␮g) was dissolved with 4 ␮l of
DMSO and 200 ␮l of H2O and loaded through the coronary
perfusate. At the end of the perfusion protocol, maximal
fluorescence, used in the calculation of intracellular calcium
concentration, was determined by tetanizing the heart with a
20 mM bolus of calcium chloride and 10 ␮M of cyclopiazonic
acid (Sigma Chemical), which is a potent inhibitor of Ca2⫹ATPase (3).
Statistical analysis. Unpaired comparisons were performed using Student’s t-test, and when multiple comparisons were made, we used ANOVA with the Scheffé’s test for
subgroup analysis. Data are expressed as means ⫾ SD.
H837
H838
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
Table 1. Heart and body weights, systolic and diastolic pressures, peak positive and negative dP/dt,
coronary flow and myocardial oxygen consumption in all hearts from wild-type and transgenic mice
Perfusate Calcium, mM
WT (n ⫽ 32)
TG (n ⫽ 30)
2.5
Body weight, g
Heart weight, g
Heart-to-body weight ratio
Systolic pressure, mmHg
Diastolic pressure, mmHg
⫹dP/dt, mmHg/s
⫺dP/dt, mmHg/s
Coronary flow, ml/min
MV̇O2, ␮mol 䡠 min⫺1 䡠 g dry wt⫺1
Developed pressure/MV̇O2
58 ⫾ 6
4⫾3
2,296 ⫾ 280
1,600 ⫾ 306
2.2 ⫾ 0.2
42.2 ⫾ 4.3†
1.27 ⫾ 0.13
3.5
30.7 ⫾ 3.2
0.161 ⫾ 0.020
0.0049 ⫾ 0.0003
66 ⫾ 7
3⫾3
2,764 ⫾ 315
1,836 ⫾ 403
2.2 ⫾ 0.4
48.9 ⫾ 6.1†
1.28 ⫾ 0.11
2.5
3.5
31.7 ⫾ 3.1
0.156 ⫾ 0.017
0.0050 ⫾ 0.0003
58 ⫾ 6
69 ⫾ 7
4⫾4
4⫾3
2,322 ⫾ 287
2,879 ⫾ 234
1,609 ⫾ 154
1,905 ⫾ 191
2.3 ⫾ 0.4
2.2 ⫾ 0.5
38.4 ⫾ 3.6†
44.1 ⫾ 4.4†
1.41 ⫾ 0.14
1.47 ⫾ 0.15*
transient and altered pressure-calcium relationship (Table 2, Fig. 4).
Myocardial oxygen consumption. Myocardial oxygen
consumption was measured as a decrease in calcium
Fig. 3. Histology (hematoxylin and eosin) of WT (A) and TG (B) at
⫻40 magnification. Normal histology is seen in the TG mice.
cycling that may result in a decrease in myocardial
oxygen consumption. There was a significant reduction
in myocardial oxygen consumption in transgenic mice
compared with wild-type mice (ANOVA, P ⬍ 0.01;
Table 1). Developed pressures were not significantly
different between the two groups, though the ratio of
developed pressure to myocardial oxygen consumption
[in mmHg/(␮mol 䡠 min⫺1 䡠 g dry wt⫺1)], an index of energetic efficiency, was significantly higher in the transgenic mice at perfusate calcium of 3.5 mM (P ⬍ 0.05).
Ischemia and reperfusion. Figure 5A shows representative Western immunoblots with translocation of
PKC-⑀ to the particulate fraction after 15 min of ischemia in both wild-type and transgenic mice, and Fig.
5B demonstrates the laser densitometry quantification
of PKC-⑀ content in fractionated tissue with significant
(P ⬍ 0.05, n ⫽ 6 measurements per group) increase in
the particulate fraction after 15 min of ischemia in
both wild-type and transgenic mice.
Examples of pressure tracings during the development of ischemic contracture are shown in Fig. 6, and
mean values are shown in Fig. 7 (perfusate calcium 2.5
mM) and Fig. 8 (perfusate calcium 3.5 mM), which
demonstrate the more marked development of ischemic contracture in the transgenic mice and elevation
of diastolic pressures in the early reperfusion period. In
addition to the data presented in Figs. 7 and 8, at
perfusate calcium of 2.5 mM the time to development of
ischemic contracture (increase in diastolic pressure 5
mmHg over baseline) was not significantly different
between the two groups (wild type, 603 ⫾ 200 vs.
transgenic, 491 ⫾ 137 s; P ⫽ not significant, NS),
though at perfusate calcium 3.5 mM ischemic contracture pressure developed earlier (wild-type, 635 ⫾ 86 vs.
transgenic, 425 ⫾ 84 s; P ⬍ 0.005) in the transgenic
mice. During reperfusion at perfusate calcium 2.5 mM,
diastolic pressures rose to a maximum of 30 ⫾ 13
mmHg at 308 ⫾ 92 s postreperfusion in transgenic
mice compared with 14 ⫾ 7 mmHg (P ⬍ 0.001) at 271 ⫾
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
Values are means ⫾ SD; n ⫽ no. of hearts. MV̇O2, myocardial oxygen consumption; WT, wild type; TG, transgenic. Heart and body weight
ratios were not obtained in the fluorescence experiments because the tetanization procedure distorts heart weight, and the first derivative
of pressure (dP/dt) was determined in a subgroup of 10 WT and 8 TG perfused hearts. MV̇O2 was determined in a subgroup of WT (n ⫽ 9)
and TG (n ⫽ 9) hearts. Functional data were obtained at perfusate calcium 2.5 and 3.5 mM. * P ⬍ 0.05 vs. WT; † P ⬍ 0.01 ANOVA: WT vs.
TG combining perfusate 2.5 and 3.5 mM data.
H839
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
Table 2. Developed pressure, intracellular calcium, calcium transient duration, and calcium-pressure relations
at perfusate calcium 2.5 and 3.5 mM from wild type and transgenic mice
Perfusate Calcium, mM
WT
Developed pressure, mmHg
Peak [Ca2⫹]i, nM
Diastolic [Ca2⫹]i, nM
⌬[Ca2⫹]i, nM
t90%, ms
Pressure at peak [Ca2⫹]i, mmHg
[Ca2⫹]i decay/pressure slope, nM/mmHg
TG
2.5 (n ⫽ 5)
3.5 (n ⫽ 4)
2.5 (n ⫽ 5)
3.5 (n ⫽ 5)
56 ⫾ 8
800 ⫾ 97
508 ⫾ 49
292 ⫾ 71
65 ⫾ 10d
9 ⫾ 2d
⫺5.0 ⫾ 1.7
62 ⫾ 7
1,155 ⫾ 274
634 ⫾ 111
521 ⫾ 177
70 ⫾ 10d
10 ⫾ 4d
⫺6.6 ⫾ 1.4
53 ⫾ 3
610 ⫾ 85
391 ⫾ 36
218 ⫾ 58
85 ⫾ 15d
15 ⫾ 3d
⫺3.1 ⫾ 1.0
60 ⫾ 5
749 ⫾ 106a
427 ⫾ 64b
321 ⫾ 56c
80 ⫾ 5d
17 ⫾ 5d
⫺4.0 ⫾ 0.4e
71 s (P ⫽ NS) in controls. At perfusate calcium of 3.5
mM there was marked elevation of diastolic pressures
in both wild-type and transgenic mice at 5 of min
postreperfusion, although this was not significantly
different between wild-type and transgenic mice.
DISCUSSION
In transgenic mice that express mutant TnI lacking
functional PKC phosphorylation sites, there is a
marked reduction in both systolic and diastolic levels of
intracellular calcium at similar developed pressures
indicating an altered pressure-calcium relation in the
transgenic hearts. There is also significant prolongation of the duration of the calcium transient. These
transgenic mice are susceptible to global ischemia with
more rapid and extensive development of ischemic contracture and postischemic dysfunction, most likely because of the inability of PKC to phosphorylate TnI and
decrease the force-calcium relation. Finally, these mice
have a significantly elevated ratio of developed pressure to myocardial oxygen consumption at high-perfusate calcium, which may signify an energetic benefit of
decreased calcium cycling. These findings are from
perfused hearts at high-perfusate calcium (3.5 mM)
(17) or during global ischemia (1), which have been
used to activate PKC. We have previously demonstrated in this perfused mouse heart model that the
selective PKC antagonist chelerythrine can inhibit calcium-induced inotropy, suggesting that PKC is activated by high-perfusate calcium (15).
Altered pressure-calcium relationship in the perfused
mouse heart. On the basis of in vitro studies demonstrating a reduction in maximal calcium-stimulated
ATPase activity produced by PKC phosphorylation of
TnI (19), an alteration in the pressure-calcium relationship is predicted in these mice. Though this prediction is clearly demonstrated, the surprising finding is
that developed pressure is not increased but normal in
Fig. 4. Intracellular calcium and calcium-pressure relations from WT (A and
B) and TG (C and D) mice. Reduced
levels of intracellular calcium at perfusate calcium 3.5 mM and prolonged
calcium transients are seen in the TG
mice.
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
Values are means ⫾ SD; n, no. of mice in each group. ⌬[Ca2⫹]i, change in intracellular Ca2⫹ concentration. t90%, duration of Ca2⫹ transient
(measured from initial increase in intracellular Ca2⫹ to 90% return to baseline. a P ⬍ 0.01 vs. WT 3.5 mM; b P ⬍ 0.005 vs. WT 3.5 mM; c P ⫽
0.05 vs. WT 3.5 mM; d P ⬍ 0.01 ANOVA: WT vs. TG combining perfusate 2.5 and 3.5 mM data, and e P ⬍ 0.05 vs. WT 3.5 mM.
H840
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
Fig. 5. A: representative Western immunoblots demonstrating
translocation of protein kinase C (PKC-⑀) to the particulate fraction
during 15-min ischemia in WT and TnI mutant mice. B: laser
densitometry quantification of PKC-⑀ content in fractionated tissue
samples. Bars represent means ⫾ SD of 6 measurements per group.
Solid bars, WT mice. Open bars, TnI mutant mice. *P ⬍ 0.05 vs. no
ischemia.
these mice. The markedly reduced intracellular calcium levels indicate that the transgenic heart has
adapted to the increased calcium sensitivity by decreasing the calcium transient, suggesting there is
direct feedback from the myofilament to the processes
controlling calcium homeostasis. This is further suggested by the prolongation of the calcium transient
duration, which is seen at both levels of perfusate
calcium. A precedent for such an effect may be seen in
congestive heart failure. It has been well described
that in heart muscle from patients with congestive
heart failure there are alterations in calcium handling,
with prolongation in calcium transients and increased
diastolic levels of intracellular calcium with higher
levels of perfusate calcium (11). However, Perez et al.
(20) have recently studied the role of calcium cycling
versus myofilament dysfunction in the spontaneous
hypertension and heart failure rat model. They also
demonstrated slowing of calcium cycling, but a much
greater reduction in maximal calcium activated force.
Their analysis revealed that the slowing of calcium
cycling prolonged the time available for calcium to
activate the contractile apparatus, as a compensatory
response to reduced myofilament function. Thus myofilament function may be able to effect calcium cycling,
a possible explanation for the reduced calcium levels
and prolonged transients seen in the present study.
The mechanism for the feedback from myofilament
dysfunction to altered calcium cycling is not known.
Minamisawa et al. (18) have recently shown that phospholamban ablation reverses the dilated cardiomyopathy phenotype of the mouse deficient in the Lin-11,
Isl-1, and Mec-3 (LIM) cytoskeletal protein. It would be
Fig. 7. Systolic and diastolic pressures at baseline, ischemia, and
during reperfusion for WT and TG mice at perfusate calcium 2.5 mM.
WT, n ⫽ 7; TG, n ⫽ 8; *P ⬍ 0.05 WT vs. TG.
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
Fig. 6. Examples of pressure tracings (slow time based) during
development of ischemic contracture in WT (A) and TG (B) mice;
perfusate calcium 3.5 mM. Arrows indicate time to development of
ischemic contracture, an increase in diastolic pressure of 5 mmHg
above baseline, which was earlier in TG mice at perfusate calcium
3.5 mM. In the early reperfusion period, diastolic pressures increase
to a greater extent in the TG mice.
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
interesting to study sarcoplasmic reticulum regulatory
proteins in these transgenic mice.
An alternative explanation may relate to levels of
intracellular calcium during altered calcium sensitivity. The magnitude of the measured calcium transient
is dependent on the amount of calcium released and
taken up from the sarcoplasmic reticulum and the
amount of calcium that binds to cytosolic proteins,
including troponin C. An increase in the calcium sensitivity of troponin C to calcium would decrease the
amount of calcium available for binding to the calciumsensitive probe rhod 2, resulting in a reduced calcium
transient. This assumes that troponin C is the only
major calcium sequestering site in the myocyte. Such
effects have been demonstrated in experiments studying the effects of muscle length, which alters the binding constant for troponin C for calcium (2, 13). Whether
this applies to alterations in maximal actomyosin ATPase activity is unclear, and furthermore a reduction
in diastolic values as seen in the present study may not
be consistent with this effect.
Ischemia-reperfusion. Ischemia is associated with a
progressive rise in intracellular calcium (25) and activation of PKC (1), which we have confirmed in this
perfused mouse heart model. The resulting phosphorylation of PKC sites on TnI is expected to reduce
maximal ATPase activity, which may protect against
the development of ischemic contracture. Thus we predicted that these transgenic mice would be susceptible
to development of ischemic contracture, and that this
effect would be greater with higher levels of perfusate
calcium. The effects of PKC on actomyosin ATPase
activity are greater during acidosis (as is expected in
global ischemia), and this may explain why marked
differences were seen at 2.5 mM perfusate calcium in
the ischemia experiments, though differences were less
marked in the intracellular calcium or myocardial oxygen consumption experiments at the same perfusate
calcium. Importantly, this effect is not a nonspecific
effect of overexpression of TnI, because total TnI levels
in wild-type and transgenic mice are similar. Whereas
the experiments studying intracellular calcium levels
were performed during normoxia, the altered pressurecalcium relationship is a plausible explanation of the
predisposition to ischemic contracture.
The resulting profound postischemic dysfunction in
the transgenic mice is partly related to the preceding
ischemic contracture, so the contribution of the mutant
protein to the postischemic dysfunction is not clear.
Also, ischemia-reperfusion injury may result in TnI
degradation (9, 16), although it is not known if there is
increased selective breakdown of the mutant TnI that
might also predispose the transgenic mice to reperfusion injury.
Energetic effects of mutant TnI. Recent studies have
demonstrated that calcium cycling may account for a
significant proportion of the energy consumption (thus
oxygen consumption) of the heart. For instance, in the
perfused rat heart, Grandis et al. (10) have compared
the inotropic and energetic effects of the calcium-sensitizing agent EMD-57033, and the ␤-adrenergic agonist dobutamine. Whereas dobutamine produces a positive inotropic effect by increasing the amplitude of the
calcium transient (22), EMD-57033 does not increase
calcium cycling (24). At doses chosen to result in equal
increases in developed pressure, there was a marked
increase in myocardial oxygen consumption with dobutamine, though only a small increase in myocardial
oxygen consumption with EMD-57033, not significantly different from control. Similar results have also
been obtained in isolated myocyte studies (21). Thus
we predicted that in these transgenic mice with reduced calcium cycling that myocardial oxygen consumption would be also reduced. Consistent with this,
the reduced calcium transient and energetic advantage
(developed pressure/myocardial oxygen consumption,
Table 1) are both seen only with high-perfusate calcium. Recently, Brandes and Bers (4) have analyzed
the contribution of mechanical work and calcium cycling to total mitochondrial ATP hydrolysis as measured by NADH levels by using fluorescent spectroscopy of rat cardiac trabeculas. They concluded that
there was an equal contribution of mechanical work
and calcium cycling to total ATP hydrolysis. Thus,
given a 35% reduction in peak systolic calcium in the
present study of transgenic mice, a 17.5% reduction in
ATP hydrolysis would be expected, which compares
favorably to the measured 15% reduction in the ratio of
developed pressure to myocardial oxygen consumption.
Limitations. We do not know the wild-type-to-mutant protein ratio in transgenic mice because the TnI
antibodies did not selectively recognize mutant protein. This uncertainty makes it difficult to assess
whether the phenotype demonstrated is a result of the
mutant protein, or whether it is also an effect of the
mutant protein on wild-type protein function. However, we do know that in two of the three transgenic
lines used in these experiments that the ratio of mutant to wild-type mRNA is ⬃50:50. Nevertheless,
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
Fig. 8. Systolic and diastolic pressures at baseline, ischemia, and
during reperfusion for WT and TG mice at perfusate calcium 3.5 mM.
WT, n ⫽ 6; TG, n ⫽ 6; **P ⬍ 0.01 WT vs. TG.
H841
H842
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
This work was supported by American Heart Association (Pennsylvania Affiliate) Grant-in-Aid Beginning (B98452P) and National
Heart, Lung, and Blood Institute Grants HL-03826 (to G. A.
MacGowan), HL-40354 (to A. P. Koretsky), HL-46207 (to P. J. del
Nido), HL-52589 (to F. X. McGowan), and R37 HL-22231 (to R. J.
Solaro). The Pittsburgh NMR Center for Biomedical Research was
awarded National Institutes of Health Grant RR-03631.
REFERENCES
1. Albert CJ and Ford DA. Protein kinase C translocation and
PKC-dependent protein phosphorylation during myocardial ischemia. Am J Physiol Heart Circ Physiol 276: H642–H650, 1999.
2. Allen DG and Kurihara S. The effects of muscle length on
intracellular calcium transients in mammalian cardiac muscle.
J Physiol (Lond) 327: 79–94, 1982.
3. Backx PH, Gao WD, Azan-Backx M, and Marban E. The
relationship between contractile force and intracellular [Ca2⫹] in
intact rat cardiac trabeculae. J Gen Physiol 105: 1–19, 1998.
4. Brandes R and Bers DM. Analysis of mechanisms of mitochondrial NADH regulation in cardiac trabeculae. Biophys J 77:
1666–1682, 1999.
5. Brooks WW and Apstein CS. Effect of Treppe on isovolumic
function in the isolated blood-perfused mouse heart. J Mol Cell
Cardiol 28: 1817–1822, 1996.
6. Chomczynski P and Sacchi N. Single-step method of RNA
isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 162: 156–159, 1987.
7. Del Nido PJ, Glynn P, Buenaventura P, and Koretsky AP.
Fluorescence measurement of calcium transients in perfused
rabbit heart using rhod 2. Am J Physiol Heart Circ Physiol 274:
H728–H741, 1998.
8. Du C, MacGowan GA, Farkas DL, and Koretsky AP. Quantitative measurement of calcium transients in perfused mouse
hearts using rhod-2 fluorometry. Proc SPIE 3602: 214–219,
1999.
9. Gao WD, Atar D, Liu Y, Perez NG, Murphy AM, and Marban E. Role of troponin I proteolysis in the pathogenesis of
stunned myocardium. Circ Res 80: 393–399, 1997.
10. Grandis DJ, del Nido PJ, and Koretsky AP. Functional and
energetic effects of the inotropic agents EMD-57033 and BAPTA
on the isolated rat heart. Am J Physiol Cell Physiol 269: C472–
C479, 1995.
11. Gwathmey JK, Copelas L, MacKinnon R, Schoen FJ, Feldman MD, Grossman W, and Morgan JP. Abnormal intracellular calcium handling from patients with end-stage heart failure. Circ Res 61: 70–76, 1987.
12. Hogan B, Constantini F, and Lacy L. Manipulating The
Mouse Embryo: A Laboratory Manual. Plainview, NY: Cold
Spring Harbor Lab, 1986.
13. Lab MJ, Allen DG, and Orchard CH. The effects of shortening
on myoplasmic calcium concentration and on the action potential
in mammalian ventricular muscle. Circ Res 55: 825–829, 1984.
14. Light PE, Sabir AA, Allen BG, Walsh MP, and French RJ.
Protein kinase C-induced changes in the stoichiometry of ATP
binding activate cardiac ATP-sensitive K⫹ channels. Circ Res 79:
399–406, 1996.
15. MacGowan GA and Koretsky AP. Effects of protein kinase C
inhibition during calcium induced inotropy in the isolated perfused mouse heart (Abstract). J Am Coll Cardiol 31: 288A, 1998.
16. McDonough JL, Arrell D, and Van Eyk JE. Troponin I
degradation and covalent complex formation accompanies myocardial ischemia/reperfusion injury. Circ Res 84: 9–20, 1999.
17. Meldrum DR, Cleveland JC, Rowland RT, Banerjee A, and
Harken AH. Calcium-induced inotropy is in part mediated by
protein kinase C. J Surg Res 63: 400–405, 1996.
18. Minamisawa S, Hoshijima M, Chu G, Ward CA, Frank K,
Gu Y, Martone ME, Wang Y, Ross J Jr, Kranias EG, Giles
WR, and Chien KR. Chronic phospholamban-sarcoplasmic reticulum calcium ATPase interaction is the critical calcium cycling defect in dilated cardiomyopathy. Cell 99:313–322, 1999.
19. Noland TA, Guo X, Raynor RL, Jideama NM, AveryhartFullard V, Solaro RJ, and Kuo JF. Cardiac troponin I mutants. Phosphorylation by protein kinases C and A and regulation of Ca2⫹-stimulated MgATPase of reconstituted actomyosin
S-1. J Biol Chem 270: 25445–25454, 1995.
20. Perez NG, Hashimoto K, McCune S, Altschuld RA, and
Marban E. Origin of contractile dysfunction in heart failure.
Calcium cycling versus myofilaments. Circulation 99: 1077–
1083, 1999.
21. Popping S, Fischer MY, Ionescu I, Kammermeier H, and
Rose H. Economy of contraction of cardiomyocytes as influenced
by different positive inotropic interventions. Am J Physiol Heart
Circ Physiol 271: H357–H364, 1996.
22. Ruffolo RR. Dobutamine: review of pharmacology. Am J Med
Sci 294: 244–248, 1987.
23. Shistik E, Ivanina T, Blumenstein Y, and Dascal N. Crucial
role of N terminus in function of cardiac L-type Ca2⫹ channel
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017
transgenic techniques that change the endogenous
gene would avoid this uncertainty relating to the efficiency of mutant protein production. Also, total TnI
levels including mutant and wild-type proteins are
similar in wild-type and transgenic mice, so the results
presented are not the result of overexpression of TnI.
All of the the experiments in the current study are
performed in isolated isovolumically contracting
hearts, and it must be recognized that this experimental preparation may produce different results to ejecting, or in vivo preparations. Nevertheless, in the
present study, the data regarding developed pressure,
myocardial oxygen consumption, and intracellular calcium are all derived from the same experimental methods, i.e., the perfused mouse heart, allowing correlations between these data. Also, we have used the
physiological heart rate of 8 Hz. Because the mouse
has a negative force-frequency relationship (5), higher
pressures and altered calcium levels at lower stimulation rates may be expected. With respect to rhod 2
measurements of intracellular calcium, other investigators using myocyte studies and different loading
procedures to those described in the present study
have used rhod 2 as an indicator of mitochondrial
calcium (28). Though we cannot exclude a small proportion of rhod 2 leaking into organelles, we have
previously shown that there is predominant cytosolic
localization of rhod 2 (7, and unpublished data by
MacGowan and Koretsky). The differences in rhod 2
localization probably relate to different loading conditions used by different investigators.
In conclusion, transgenic mice expressing mutant
TnI lacking PKC phosphorylation sites have markedly
diminished levels of intracellular calcium levels and
prolonged calcium transients, but have normal developed pressures under conditions that activate PKC.
This altered pressure-calcium relationship is associated with a predisposition to development of ischemic
contracture, and a reduced energetic cost of calciuminduced inotropy. These studies demonstrate that in
vivo phosphorylation of TnI by PKC can have marked
effects on myocyte function and energetics during ischemia and normoxia. Furthermore, the presence of
reduced intracellular calcium levels and prolonged calcium transients suggests a potent interaction between
the myofilament and the processes that control calcium
homeostasis.
ISCHEMIC DYSFUNCTION IN TROPONIN I TRANSGENIC MICE
and its modulation by protein kinase C. J Biol Chem 273:
17901–17909, 1998.
24. Solaro RJ, Gambassi G, Warshaw DM, Keller MR, Spurgeon HA, Beier N, and Lakatta EG. Stereoselective actions of
thiadiazinones on canine cardiac myocytes and myofilaments.
Circ Res 73: 981–990, 1993.
25. Steenbergen C, Murphy E, Watts JA, and London RE.
Correlation between cytosolic free calcium, contracture, ATP,
and irreversible ischemic injury in perfused rat heart. Circ Res
60: 135–146, 1990.
26. Subramaniam A, Jones WK, Gulick J, Wert S, Neumann J,
and Robbins J. Tissue-specific regulation of the ␣-myosin
heavy chain gene prometer in transgenic mice. J Biol Chem 266:
24613–24620, 1991.
H843
27. Takeishi Y, Chu G, Kirkpatrick DM, Li Z, Wakasaki H,
Kranias EG, King GL, and Walsh RA. In vivo phosphorylation of cardiac troponin I by protein kinase C␤2 decreases cardiomyocyte calcium responsiveness and contractility in transgenic mouse hearts. J Clin Invest 102: 72–78, 1998.
28. Trollinger DR, Cascio WE, and Lemasters JJ. Selective
loading of rhod-2 into mitochondria shows Ca2⫹ transients during the contractile cycle in adult rabbit cardiac myocytes. Biochem Biophys Res Commun 236: 738–742, 1997.
29. Venema RC and Kuo JF. Protein kinase C-mediated phosphorylation of troponin I and C protein in isolated myocardial
cells is associated with inhibition of myofibrillar actomyosin
MgATPase. J Biol Chem 268: 2705–2711, 1993.
Downloaded from http://ajpheart.physiology.org/ by 10.220.33.2 on June 12, 2017