Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
DNA sequencing wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
Eukaryotic DNA replication wikipedia , lookup
Microsatellite wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA polymerase wikipedia , lookup
DNA replication wikipedia , lookup
UNIT 2 STUDY GUIDE – Genetics Basics Date: _____________________ Block: ______________ GENETIC MATERIAL 1. SIMILARITIES & DIFFERENCES BETWEEN DNA & RNA Complete the table below by using check marks to indicate to which molecule each characteristic applies DNA Deoxyribonucleic acid Ribonucleic acid Ribose sugar present Deoxyribose sugar present Phosphate group present Adenine nucleotide present Thymine nucleotide present Uracil nucleotide present Guanine nucleotide present Cytosine nucleotide present Formed from nucleotides Double stranded Single stranded Remains in the nucleus Moves out of the nucleus Contains a chemical message code types Containsormultiple RNA 2. Name the three (3) main types of RNA and describe their function: Type of RNA Function 3. Using the information above; complete the VenDiagram below comparing and contrasting DNA & RNA. On your test you will be asked to either complete a VenDiagram or write an essay comparing and contrasting them. 4. What are the three parts of a nucleotide? a. ________________________________ (color brown below) b. ________________________________ (color purple below) c. ________________________________ (color green below) According to the above list… color-code each of the three parts on the nucleotide picture below (see above for colors). 5. Label and color code (you pick the colors) each specific nucleotide below: DNA REPLICATION 1. What is the PURPOSE of DNA Replication? ______________________________________________________________________________ ______________________________________________________________________________ ______________________ 2. When does DNA Replication occur? ______________________________________________________________________________ ___________ 3. Fill in the table below with the enzymes we discussed that are involved in DNA Replication (in order) and their functions: Step Enzyme Function(s) # 1 2 1. Using the table below; describe the two steps of Protein synthesis… answering the questions as you go… Step # Description of Process Location of Process 1. _________________________ 2. _________________________ 1. If you were given the following DNA strands; complete the protein synthesis of each… a. Strand #1 DNA strand: ATGGAGTGCAGTCGAGGGCTGGGCTAG _________:_____________________________________ _________: _____________________________________ b. Strand #2 DNA strand: ATGCCCGGTTTAGCTATGGTAAA _________: _____________________________________ _________: _____________________________________ 2. When comparing different organisms, you can see that they all have the same bases in DNA (A, T, G, and C)… what accounts for the differences between the organisms? ______________________________________________________________________________ ______________________________________________________________________________ ______________________