Download Supplemental File: Detailed Clinical Description, Sequencing

Supplemental File: Detailed Clinical Description, Sequencing Methods, and 2 Supplemental Tables.
A. Detailed Description of Clinical Presentation of Two Affected Siblings with AGC1 deficiency.
i.
Family History. Family history of the affected children was significant for known consanguinity with their
parents being first cousins of Indian descent. Mother is in good health, highly functioning, with normal
development and no history of seizures.
Father is highly functioning, has patchy skin hyper/hypo-
pigmentation, and had febrile seizures in childhood. A healthy sister has normal development and no
seizures. Paternal grandfather died from complications of Alzheimer's Disease.
ii. Clinical Description of Two Affected Siblings.
a. The proband, individual II-1 (Fig 1A), is a consanguineous Indian girl who presented at age 6.7 years
to Mitochondrial-Genetics Diagnostic Clinic at The Children’s Hospital of Philadelphia for diagnostic
evaluation of treatment-resistant epilepsy with both focal and generalized seizures and associated
epileptic encephalopathy, congenital hypyotonia, and global developmental delay, with absent speech.
Her prenatal history was remarkable for her being born prematurely at 36 weeks’ gestation by
spontaneous vaginal delivery following an uncomplicated pregnancy to a primigravida mother with birth
weight of 2,069 grams. She was hypoglycemic at birth and remained in the neonatal intensive care unit
(NICU) for seven days. Her development was globally delayed, where she began to roll over at 6 months
old but never learned to walk or speak. While some slow developmental gains were made, she followed a
primarily static course with periodic regression after status epilepticus and treatment with zonegran but
recovery to her previous baseline after recovery. Her first clinical seizure was recognized at 10 months of
age when she was found to be unresponsive. She subsequently had several episodes of febrile status
epilepticus. Her epilepsy progressed into seizures with both focal and generalized onset involving clonic,
complex partial, and generalized tonic clonic semiologies. At the age of 6.7 years her seizures were
moderately controlled on topiramate and phenobarbital, with typical occurrence every 2 to 3 months. An
EEG at that time revealed a diffusely slow background with diffuse 5-7 Hz theta activity and intermittent
runs of bifrontal 2-3 Hz spike and wave discharges.
1
She underwent Audiology evaluation at 6.7 years of age that was inconclusive, with subsequent
evaluation at 7.5 years of age showing normal hearing at 500 Hz to 4000 Hz in the right ear and mild
hearing loss at 500 Hz and normal hearing sensitivity at 1000 Hz to 4000 Hz in the left ear. Bilateral
myringotomy tube placement was performed at 7.3 years due to chronic otitis media. Ophthalmology
examinations at ages 2 years, 6.9 years, and 8.2 years were normal. Cardiology examinations, including
echocardiogram and electrocardiogram, were normal at 16 months and 6.8 years. There have been no
gastrointestinal problems such as reflux, frequent vomiting, constipation or diarrhea. She has no known
renal or hormonal problems, no known allergies, rashes, birthmarks, or sleep problems.
She has
occasional respiratory infections and fevers.
She has acquired microcephaly. Occipital-frontal circumference (OFC) was 41.9 cm at 9 months old (4th
percentile), 46 cm at 2 years old (6th percentile), 46.4 cm at 3 years old (0 percentile), and remained below
the 3rd percentile at 47 cm since 4.8 years old with no further growth upon interval measurements
recorded through age 8.2 years.
On examination in Mitochondrial-Genetics Clinic at age 6.7 years, her weight was at the 7th percentile,
height was below the 3rd percentile and equivalent to the 50th percentile for a 5-year-old, BMI was 16.2,
and head circumference was below the 3rd percentile and equivalent to the 50th percentile for an 18month-old. Her outer canthal distance plotted at the 75th percentile, inner canthal distance at the 50th
percentile, and interpupillary distance at the 97th percentile. Ear length plotted at the 75th percentile.
Dysmorphic features included an oval shaped face, microcephaly, small and hirsute forehead with very
low lateral hairline, synophrys, medial eyebrow flare, hypertelorism, small Darwinian nodule bilaterally,
very narrow and v-shaped palate, tapered fingers, transverse right palmar crease, generalized hirsutism
except for patchy areas on her arms with no hair, and a 1.5 cm café-au-lait macule on her right flank. Her
neurologic exam was significant for a lack of responsiveness to verbal stimuli, no ability to follow
commands, and she was non-verbal with minimal sound production. She did smile interactively on one
occasion and clapped her hands to seemingly express pleasure on two occasions. Her cranial nerves were
unremarkable, but her motor exam revealed profound hypotonia with associated poor head control,
2
inability to sit unassisted, and frequent copious drooling. She had symmetric antigravity strength but tight
heel cords. Her deep tendon reflexes were 1+ symmetric at patella and brachioradialis, with no ankle
clonus. Cerebellar testing showed a lack of any tremor, athetoid or dystonic movements, or stereotypical
behaviors.
Blood lactate at the age of two years was marginally elevated (2.1 mmol, control range 0.6 - 2.0). Plasma
amino acid quantitative analysis and urine organic acid quantitative analysis at that time were within
normal limits. Cerebrospinal fluid studies performed at the age of one year were significant for decreased
lactate (0.49 mmol, control range 0.70-2.0), decreased pyruvate (0.02 mmol, control range 0.05-0.17) and
elevated lactate:pyruvate ratio (25, control range 10-20). Blood acylcarnitine quantitative profiles
performed at the ages of 1 and 2 years were both within normal limits.
Muscle biopsy performed in the proband at age 1 year showed essentially normal histology with the
exception of mild fiber size variation with slight predominance of type I fibers. Fresh muscle biopsy in a
clinical diagnostic center that could perform oxidative phosphorylation capacity by polarography was not
pursued in this case due to family preference. However, frozen muscle was sent for spectrophotometric
analysis of respiratory chain enzyme capacity, with increased activity seen in all electron transport chain
(ETC) enzymes tested except complex IV, as well as increased citrate synthase, which were suggestive of
mitochondrial proliferation.
Pyruvate dehydrogenase complex and pyruvate carboxylase enzymatic
analyses performed in her skeletal muscle were normal as performed on a clinical diagnostic basis at The
Center for Inherited Disorders of Energy Metabolism (CIDEM) in Cleveland, Ohio. Blue native gel
testing also performed on a clinical diagnostic basis in skeletal muscle was normal, with no alterations
observed in the amount of respiratory chain complex components.
b. Individual II-3 (Fig 1A) is the proband’s younger brother who presented at age 13 months to the CHOP
Genetics Clinic for diagnostic evaluation of complex medical problems.
His prenatal period was
significant for polyhydramnios and fetal bowel obstruction, which was found to be type IV jejuna atresia
and required surgical repair in the immediate neonatal period. He was born prematurely by cesarean
delivery at 33 weeks’ gestation weighing 1,899 grams. Prenatal concern had been raised for mild right
3
ventricular hypertrophy, although follow-up postnatal Cardiology evaluation with normal. He has global
developmental delay. He sat unassisted at 9 months and rolled at 12 months. At 13 months old, he was
able to bear weight but not walk and could babble but speaks no words. He has not had developmental
regression. His first seizure occurred while febrile at 10 months of age, as was characterized by staring
and unresponsiveness for 2 to 3 minutes followed by clonic shaking of his left side that spread to his right
side. His electroencephalogram (EEG) was significant for voltage attenuation, which was thought to be a
non-specific finding suggestive of bilateral cerebral dysfunction. He experienced two additional febrile
seizures over the next two weeks characterized by bilateral clonic movements. Since that time, he has
developed afebrile seizures which now occur with decreased frequency on Keppra. There have been no
vision or hearing concerns, with a seemingly normal although inconclusive auditory brainstem response
(ABR) performed at age one month. He has no gastrointestinal problems such as reflux, frequent
vomiting, constipation or diarrhea. He has no known renal or hormonal problems, no known allergies,
rashes, birthmarks, or sleep problems. He has occasional respiratory infections.
He had congenital microcephaly that has resolved over time. Specifically, at birth his OFC was 31 cm
(0.35 percentile). At 6 months his OFC was 41.7 cm (6th percentile). When last measured at age 33
months, his OFC was 48.4 cm (25th percentile).
On examination in Mitochondrial-Genetics Clinic at 13 months, his length was at the 62nd percentile,
weight was at the 10th percentile, BMI was 15.25, and head circumference was at the 16th percentile. His
outer canthal distance plotted at the 97th percentile and inner canthal distance at the 50th percentile. His
ear length plotted at the 90th percentile, hand length at the 50th percentile, and foot length at the 25th
percentile.
Dysmorphic features included occipital flattening, pinched and narrow superior helices,
narrow palate, transverse palmar creases, tapered fingers, splotchy areas of hyper- and hypo-pigmentation
on his extremities particularly involving his lower legs and shoulders, and a 0.5 cm café-au-lait macule on
his right flank. Of note, he did not have forehead hirsutism or synophrys, which were features present in
his affected sister. Neurologic exam revealed a non-verbal child who appeared to be aware of his
environment and “cooed” and smiled responsively but did not babble. Cranial nerve testing was normal,
4
but motor exam was significant for pronounced truncal hypotonia with some slip-through, intermittent
head lag, extremity stiffness, and inability to get to sitting or to sit unassisted, although he was able to
pick his head and chest off the table without difficulty when prone and rolled over. He could bear weight
on his legs with support and had firm palmar grasp. Deep tendon reflexes were 2+ and symmetric in arms
and legs (patellar and brachioradialis) and cerebellar exam was normal with no tremor or unusual
movements.
His metabolic screening lab studies were unremarkable. Plasma amino acid and urine organic acid
analyses completed at 11 months of age were within normal limits. Blood lactate (1.36 mmol, control
range 0.80 - 2.00) and pyruvate (0.07 mmol, control range 0.05 - 0.14) were normal.
His blood
lactate:pyruvate ratio was normal (19, control range 10-20). He has not had brain MRI, brain MRS, or
muscle biopsy performed due to parental refusal to pursue invasive testing or procedures requiring
sedation.
iii. Results of prior clinical diagnostic genetic testing in individuals II-1 and II-3. Mitochondrial whole genome
sequencing on the proband was negative, with no deleterious mitochondrial DNA mutation identified.
“MitoMet” microarray analysis performed on a clinical diagnostic basis at Baylor Mitochondrial laboratory
on the proband’s muscle revealed an increased mtDNA content (240% as compared to age- and tissuematched controls). Extensive molecular testing for nuclear-encoded mitochondrial disease genes on a clinical
diagnostic basis at Baylor Mitochondrial Genetics Laboratory were normal, including sequencing of POLG,
POLG2, PDHA1, MPV17, ANT1/SLC25A4, TWINKLE, SUCLA2, TK2, DGUOK, SCO1, SCO2, COX10 and
SURF1. Gene sequencing of PNKP and SLC25A22 indicative of early infantile epileptic encephalopathy
performed at University of Chicago DNA Diagnostic Lab was also negative. Genome-wide SNP microarray
analysis was performed at the CHOP CytoGenomics Laboratory on a clinical diagnostic basis on both
affected children, but failed to identify any deletion or duplication of apparent pathogenicity. However,
several large (>10 Mb) regions of homozygosity that include hundreds of potential gene candidates were
identified (Supplemental Table 2, see below), as is consistent with their known consanguinity.
5
B. Sequencing Methods.
i.
Exome sequencing and bioinformatics variant analysis. Exome capture was initially carried out on
individuals II-2 (unaffected girl) and II-3 (affected boy) using Agilent SureSelect Human All Exon kit
(Agilent Technologies, Santa Clara, CA, USA), guided by the manufacturer’s protocols.
In brief, the
qualified genomic DNA samples were randomly sheared to 200 to 300 base pairs in size, followed by endrepair, a-tailing and pair-end index adapter ligation. The samples were then sequenced using a pair-end reads
for 101 cycles, on the Illumina HiSeq2000 following the manufacturer’s instructions (San Diego, CA, USA).
Base calling was performed by the Illumina CASAVA software (v1.8.2) with default parameters. All the raw
reads were aligned to the reference human genome (UCSC hg19) using the Burrows–Wheeler aligner (BWA)
(Li and Durbin 2009) and optical and PCR duplicates were marked and removed with Picard
(http://picard.sourceforge.net). Local realignment of reads in the indel sites and base quality recalibration
were performed with the Genome Analysis Tool Kit (GATK, version 2.3) (McKenna, Hanna et al. 2010).
Single nucleotide variants (SNVs) and small insertions/deletions (indels) were then called with GATK
Unified Genotyper (DePristo, Banks et al. 2011), Annovar (Wang, Li et al. 2010), and SnpEff (Cingolani,
Platts et al. 2012) were used to functionally annotate the variants and to categorize them into missense,
nonsense, splicing variants and coding frameshift indels, which are likely to be deleterious compared with
synonymous and non-coding variants. Under recessive mode of inheritance (genes carrying rare homozygous
variants or two rare heterozygous variants), we excluded variants that were: (1) synonymous variants, (2) with
minor allele frequency > 0.01 in either the 1000 Genomes Project or in 6,503 exomes from the Exome
Sequencing Project (ESP http://evs.gs.washington.edu/EVS/), (3) with other occurrences in our in-house
database, (4) benign variants predicted by SIFT/PolyPhen2 scores (Ng and Henikoff 2002; Adzhubei,
Schmidt et al. 2010). Whole exome data analysis was also performed using a separate bioinformatic analysis
pipeline, as previously reported (Falk, Zhang et al. 2012).
In addition, whole exome sequencing was
subsequently performed in effort to gain improve coverage depth on the original two children, as well as to
screen the exome sequence in the more severely affected oldest girl (individual II-1) and both healthy parents
(individuals I-1 and I-2), on all five members of the immediate nuclear family in this kindred using the
Agilent SureSelect Human v2 capture kit (Agilent Technologies, Santa Clara, CA, USA), guided by the
6
manufacturer’s protocols.
ii. Sanger sequencing validation. Validation of the mutation detected by exome sequencing was performed by
Sanger sequencing in all family members from whom DNA was available using standard PCR amplicon with
primer set 5' CCCTGTAGAGTCCAAAGAAG 3' and 5' GTATTTATGGATTTCAGTGCTT 3'.
7
C. Supplemental Table 1. Coverage statistics of repeat whole exome sequencing analysis performed in the
entire nuclear pedigree. Exome analysis was performed on blood DNA from all members of the nuclear
pedigree captured using the Agilent SureSelect v2 kit. This extended analysis identified one additional
homozygous variant, E574K, in IL17RA that was only present in individual II-1. While mutations in this gene
have been associated with familial candidiasis type 5, a primary immunodeficiency disorder with altered immune
responses and impaired clearance of fungal infections, no symptoms of immune dysfunction to raise suspicion for
this clinical disorder were present in individual II-3.
Mean
depth of
ID
target
region
Coverage
of target
region (%)
Fraction of
Fraction of
target
target
covered >
covered >
10X
20X
I-1
72.66
98.52
88.53
79.22
I-2
83.81
98.99
91.63
84.58
II-1
83.01
98.69
90.18
82.3
II-2
73.21
98.86
90.79
82.86
II-3
73.63
98.63
89.04
80.06
8
D. Supplemental Table 2. Genome-wide single nucleotide polymorphism (SNP) microarray analysis revealed
three large homozygous regions shared by two affected siblings. Microarray analysis was performed using the
Illumina Beadchip 6.0 platform in individuals II-1 and II-3.
Size
Region
(Mb)
chr1:181,125,316-192,024,476
10.90
chr2:140,651,162-177,106,078
36.45
chr8:66,218,027-78,808,171
12.59
9
SUPPLEMENTAL FILE REFERENCES
Adzhubei IA, Schmidt S, Peshkin L, et al. (2010) A method and server for predicting damaging missense mutations.
Nature methods 7(4): 248-249.
Cingolani P, Platts A, Wang le L, et al. (2012) A program for annotating and predicting the effects of single nucleotide
polymorphisms, SnpEff: SNPs in the genome of Drosophila melanogaster strain w1118; iso-2; iso-3. Fly 6(2): 8092.
DePristo MA, Banks E, Poplin R, et al. (2011) A framework for variation discovery and genotyping using next-generation
DNA sequencing data. Nature genetics 43(5): 491-498.
Falk MJ, Zhang Q, Nakamaru-Ogiso E, et al. (2012) NMNAT1 mutations cause Leber congenital amaurosis. Nature
genetics 44(9): 1040-1045.
Li H, Durbin R (2009) Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25(14):
1754-1760.
McKenna A, Hanna M, Banks E, et al. (2010) The Genome Analysis Toolkit: a MapReduce framework for analyzing
next-generation DNA sequencing data. Genome research 20(9): 1297-1303.
Ng PC, Henikoff S (2002) Accounting for human polymorphisms predicted to affect protein function. Genome research
12(3): 436-446.
Wang K, Li M, Hakonarson H (2010) ANNOVAR: functional annotation of genetic variants from high-throughput
sequencing data. Nucleic acids research 38(16): e164.
10