Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Name:__________________________________________ Period: _____________ DNA Exam Matching: 1.____ Nitrogenous Base that pares with Adenine. 2.____ The hereditary molecule. 3.____ Copy of DNA used to make protein. 4.____ Nitrogenous Base that pares with Guanine. 5.____ Sugar in DNA 6.____ Site where protein production takes place. 7.____ Sugar found in RNA 8.____ Composes of A, T, C, G 9.____ One type of RNA 10.____ Made with the help of RNA. A. DNA B. RNA C. Thymine D. Cytosine E. mRNA F. Deoxyribose G. Nitrogenous Base H. Ribose I. Protein J. Ribosome K. PRNA Multiple Choice: 11. DNA is composed of_____________. a. Nucleotides b. RNA c. tRNA d. Acid 12. RNA has __________ as its main sugar. a. Deoxyribose b. Nucleic Acid c. Ribose d. Phosphate 13. DNA is held together by a _______________ bond? a. Nucleic b. Hydrogen c. Phosphate d. Sulfur 14. RNA has _________________ strand of nucleotides? a. Five b. Two c. One d. Three 15. When DNA twists and tightly compacts it is called ___________? a. Helix b. Double Helix c. Halo d. Twister 16. Watson and _________ were the first two that figured out DNA? a. Watson b. Luke c. Crick d. Tina 17. The A in a DNA strand stand for _____________? a. Apple b. Aggregate c. Adenine d. Amery 18. The G in a DNA strand stands for______________? a. Goiter b. Guanine c. Gipple d. Google 19. The T in a DNA strand stands for_______________? a. Tile b. Thymine c. Thitamine d. Trickle 20. The C in a DNA strand stands for_______________? a. Cytosine b. Chrio c. Chimer d. Catalyst 21. ________________ is the manipulation of genes in an organism? a. Gene Therapy b. Genetic Engineering c. Genetic Threat d. Genetic Cut Out 22. A ________________ is used to cut DNA to splice it. a. Scissor b. Water Molecule c. Enzyme d. Fluid True or False: 23. T or F DNA is found in the Nucleus. 24. T or F DNA is held together by a hydrogen bond. 25. T or F Bacteria is used to produce human insulin. 26. T or F DNA has to unzip as it replicates. 27. T or F RNA has the bases A, C, T and G 28. T or F mRNA stands for microbial RNA 29. T or F tRNA stands for transferRNA. 30. T or F rRNA stands for rightRNA Short Answer: 31. What do the letters DNA stand for? (spelled correctly) 32. In class we discussed three differences between DNA and RNA. Please list two? 33. Explain the process of DNA replication? 34. What are the benefits possible with genetics engineering discussed in class. 35. What are some of the issues with genetic engineering? 36. Why is gene mapping important in genetics? Finish the DNA Codes: ATTAAGCCGTCAGGTCATTCFinish the RNA Codes: AAUUCCGGUCGGCUGAUU- AAATTCCGAT- TCGTACGTGA- CGTATGCTAT- AUCGCAGCU- AUGCGUCGA- UCGUACGUA- Label the following diagram to the right.. 37. 38. 39. 40. Essay Questions: 41. Explain Gene Splicing? 42. Explain how we use bacteria to create insulin?