Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
DNA repair protein XRCC4 wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA profiling wikipedia , lookup
DNA replication wikipedia , lookup
DNA polymerase wikipedia , lookup
Microsatellite wikipedia , lookup
United Kingdom National DNA Database wikipedia , lookup
DNA Notes Chapter 8 DNA- (Deoxyribose Nucleic Acid) Molecule shaped like a twisted ladder made up of 6 main subparts. Nucleotides- the subunits of DNA. Each sub unit is made of a sugar and phosphate backbone and a nitrogen base, which attaches itself to a complimentary nitrogen base. Draw them from page 231 A-T G-C A (adenine) only bonds with T (thymine) G (guanine) only bonds with C (cytosine) Exercise: Finish this DNA sequence by writing in the complimentary base to the one shown: GCATTTTAAAGGCCTATCTAGCTAGCAT CGTA DNA replication DNA “unzips” at the nitrogen bases and new nucleotides attach to the two half DNA’s forming two new identical DNA structures. Occurs using an enzyme called Helicase. Exercise: Given the DNA sequence below show, in a three step process, what happens during replication? Step 1: ATGCCTGACAGTATCG TACGGACTGTCATAGC AGTATCG Step 2: ATGCCTGAC AGC hydrogen bonds (DNA starts to unzip, complimentary Bases attach) TACGGACTG TCG TCATAGC GCCTGACAGTATCG CGGACTGTCATAGC Step 3: AT TA GCCTGACAGTATCG CGGACTGTCATAGC RNA transcription RNA- Ribo Nucleic Acid- similar to DNA but only half strand and Thymine is replaced with Uracil so, the base pairs are A-U G-C Transcription of RNA- DNA unwinds and Nucleotides attach to the DNA with U replacing T and this new molecule unzips from the DNA, which then reattaches to itself. Exercise: Create a RNA strand from the DNA code given: DNA STRAND ATGCCTGACAGTATCGTATCGG RNA STRAND UACG Protein production 1. DNA transcription to RNA, 2. RNA translates the message into a protein by attaching the amino acids together into a long chain according to a genetic code of bases called a codon. Found on page 244 in your textbook. Exercise: answer the following questions: 1. What is the start codon? (methionine is the amino acid) _______ 2. What are the 3 stop codons? _____, _____, ____. 3. Given the following sequence of RNA translate the code into the protein it will create: RNA code:AUGCAGUCAGAAUUACAUUUGUAG Amino acid: MET- GLN- SER- (Start codon) When Finished create your own 30 amino acid chain protein by 1. Creating the DNA strand (Don’t forget your start and stop codons) 2. Transcribing the RNA 3. Translating the amino acids to make your protein