Download File

Name: _______________________________________________________
Period: ____
Enzyme and DNA Structure Test
Multiple Choice: Choose the best letter and record your response on the scantron (1pt each)
1. A protein containing more than one polypeptide chain exhibits the ________ level
of protein structure
a. primary.
c. tertiary
b. secondary
d. quaternary
2. Glucose molecules provide energy to power the leg muscles of a lacrosse player. In
this example, the muscles are changing
a.
b.
c.
d.
Chemical energy into kinetic energy
Chemical energy into potential energy
Kinetic energy into potential energy
Kinetic energy into chemical energy
3. A cell uses energy released by _______ reactions to drive the ______ reaction that
makes ATP. Then it uses the energy released by hydrolysis of ATP, an ______
reaction, to do various kinds of work in the cell.
a.
b.
c.
d.
Exergonic…exergonic….endergonic
Endergonic…exergonic…exergonic
Exergonic…endergonic…endergonic
Exergonic…endergonic…exergonic
4. Look at the figure to the right, what
phenomenon explains the flat area on the graph
between points B and C?
a.
b.
c.
d.
The reaction has come to a stop
All of the enzyme’s active sites are occupied
The reaction has run out of substrate
The enzyme has stopped working
/65
5. Which of the following is true of an enzyme that has undergone denaturation?
a.
b.
c.
d.
Its primary structure has not been disrupted
It is still able to catalyze the reaction for which it is specific
It is capable of lowering the activation energy of a reaction
Its active site can still bind to a substrate
6. How does an enzyme catalyze a reaction?
a.
b.
c.
d.
By supplying the energy to speed up a reaction
By lowering the activation energy of a reaction
By changing the equilibrium of a spontaneous reaction
By increasing the amount of free energy in a reaction
7. The hydrolysis of sucrose by the enzyme sucrase results in
a. bringing glucose and fructose together to form sucrose.
b. the release of free water from sucrose as the bonds between glucose and fructose
are broken.
c. breaking the bond between glucose and fructose and forming new bonds from
water.
d. production of water from the sugar as bonds are broken between the glucose
monomers
8. Succinate dehydrogenase catalyzes the conversion of succinate to fumarate. The
reaction is inhibited by malonic acid, which resembles succinate but cannot be acted
upon by succinate dehydrogenase.
a.
b.
c.
d.
Succinate dehydrogenase is the enzyme, and fumarate is the substrate.
Succinate dehydrogenase is the enzyme, and malonic acid is the substrate.
Succinate is the substrate, and fumarate is the product.
Fumarate is the product, and malonic acid is a noncompetitive inhibitor.
9. Elastase and trypsin are enzymes that catalyze hydrolysis of peptide bonds. Elastase
only cuts next to alanine, whereas trypsin only cuts next to lysine. What allows the
enzymes specificity?
a. Elastase is a protein and trypsin is not
b. Hydrolysis of alanine requires qater, while trypsin does not
c. The active sites for the two enzymes are different
d. Elastase reaction is exergonic while trypsin is an endergonic reaction
Use the following image to answer questions 10-12
10. The entire molecule in the figure to the right represents
which of the following
a. DNA
b. Ribose
c. ATP
d. ADP
11. What type of reaction is responsible for breaking down
molecule E to molecule D?
a. anabolism
c. dehydration synthesis
b. hydrolysis
d. dehydration decomposition
12. The reaction described in question 11 is
a. exergonic
b. endergonic
c. neutral
d. polygonic
13. Inorganic atoms, such as zinc ions bind to enzymes at a site other than the active site
making conformational changes in the enzyme, are
a. Cofactors
c. substrates
b. Coenzymes
d. isoenzymes
A series of enzymes catalyze the reaction X  Y  Z  A. Product A binds to the enzyme
that converts X to Y at a position away from its active site. This binding decreases the
activity of the enzyme.
14. With respect to the enzyme that converts X to Y, substance A functions as
a. a coenzyme
c. the substrate
b. a noncompetitive inhibitor
d. a competitive inhibitor
15. Generally, the effect of an enzyme on a reaction is all of the following except;
a. Reaction rate will be faster at the same temperature
b. More total product will form from the same amount of reactant
c. The number of effective collisions among substrate molecules increases
d. The amount of kinetic energy necessary for the substrate to react decreases
Questions 16-18
A biologist prepares an in vitro analysis of the activity of the enzyme amylase, which
promotes the hydrolysis of polysaccharides to monosaccharide residues. Three flasks
containing 5 milliliters of 4 percent amylose (starch) in water are prepared with the
addition at time zero of each of the substances indicated in the diagrams below.
16. In an experiment to test the effect of amylase
on starch, the control would be
a. flask A only
b. flask B only
c. flask C only
d. flasks A and B
17. After 2 minutes, a positive test
for sugar would most likely be
observed in
a. flask A only
b. flask B only
c. flask C only
d. flasks A and C
18. Support for the hypothesis of enzyme denaturation can be obtained by comparing
starch digestion in
a. flasks A and B after 5 minutes
b. flasks Band C after 5 minutes
c. flasks A and C after 5 minutes
d. flask A at time zero and again after 5 minutes
Please refer to Figure on the right to answer the
following questions.
19. In Figure 1, the optimum temperature for
enzyme 1 (curve 1) is approximately
a. 0C.
b. 35C.
c. 45C
d. the temperature optimum cannot be
determined
20. From Figure 1, predict which enzyme curve
would represent a reaction that occurs in
the stomach of the digestive tract.
a. curve 1
c. curve 4
b. curve 2
d. curve 5
21.
Human DNA contains about 30% adenine. What percent of the nitrogen
bases are cytosine?
a. 15%
b. 20%
c. 40%
d. 70%
22. Chargaff found that for DNA _______________
a. A + T = G + C
b. A + C > T + G
c. A+ G = T + C
d. None of the above
23. Which of the following is a DNA nucleotide?
a. uracil + deoxyribose sugar + phosphate
b. cytosine + ribose sugar + phosphate
c. uracil + ribose sugar + adenine
d. thymine + deoxyribose sugar + phosphate
Use the figure at right to answer questions 24-27.
24. Which
number
DEOXYRIBOSE?
a. 1
b. 2
c. 3
25. Which number
PURINE?
a. 1
b. 2
c. 3
is
d. 4
is
d. 4
pointing
e. 6
pointing
e. 6
26. Which number is pointing to a
COVALENT BOND?
a. 5
b. 7
27.
to
Which number(s) make up the
BACKBONE of DNA?
a. 2, 5, 6
c. 2 and 6
b. 3 and 4
d. 3, 4, 6
to
a
28. The burning of glucose molecules in paper is an exergonic reaction, which releases heat
and light. If this reaction is exergonic, what stops this test from spontaneously bursting into
flames? (3 pts)
29. What is meant by energy coupling? How is ATP involved? You may include a picture to
help explain. (5 pts)
DNA:
30.
3’
TACGGGACGTTCCCCCTGAAGAGCATT
5’
a. Determine the complementary DNA strand to the template shown above.
Write one triplet in each box. (4pts)
b. What is the specific name of the bond that holds the complementary bases
together? (2pts)
c.
What is the specific name of the bond that holds adjacent nucleotides together
on the backbone? (2pts)
31. Lactose, the sugar found in milk, is a disaccharide composed of glucose and galactose (both
six sided sugars). Sucrose, ordinary table sugar, is also a disaccharide composed of fructose and
glucose. Glucose is a six sided sugar and fructose is a five sided sugar.
Lactase is an enzyme that breaks down lactose into galactose and glucose. Lactase can be
purchased in pill form by people who are lactose intolerant. These people lack the enzyme
lactase and cannot break down the sugar lactose into its component parts.
a. Fill in the following table based on what you think the results would be: (5 pts)
Type of Solution
Positive or Negative Glucose Result
Test tube A:
Milk and lactase
Test tube B:
Milk and water
Test tube C:
Sucrose solution and lactase
Test tube D:
Sucrose solution and water
Test tube E:
Milk and denatured lactase
b. Write the chemical equation of this reaction (you may use words instead of
molecular formulas). Label the substrate and product(s) (2pts)
32. Catalase Lab Analysis. Please label a,b,c,d, and e as you answer the question.
a. Explain what an enzyme is and how does it affect chemical reactions. (3pts)
b. Using molecular formulas, write the chemical equation for the lab you did with hydrogen
peroxide. Label the substrate and the product. (4pts)
c. Explain why 20°C/40°C had a higher rate of reaction than both 0°C AND 100°C (4pts)
d. Explain why pH of 7 gave you the highest rate of product formation compared to pH 3.
Describe how acids affect enzymes. (2pts)
e. Describe one other reason why catalase may not function as it should other than
temperature and pH. (2pts)
Extra Credit. Demonstrate where the hydrogen bonds are in between each complementary pair.