Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
WS 8 – 3: Translation and Protein Synthesis Name_________________________________________________ For the questions 1 - 4, use the DNA molecule below. TACCGCTAGGATACGTGCAAATTAATT 1. What mRNA sequence molecule would be made from the strand of DNA above? ______________________________________________________________________________________ 2. What tRNA sequence would be complementary to the mRNA molecule produced above? _______________________________________________________________________________________ 3. Use the genetic code in your book to tell which amino acids are formed from this molecule. _______________________________________________________________________________________ For the questions 4 - 6, use the DNA molecule below. TACGGGCCCAAATTTTGGACTCATCTAATT 4. What mRNA sequence molecule would be made from the strand of DNA above? ______________________________________________________________________________________ 5. What tRNA sequence would be complementary to the mRNA molecule produced above? _______________________________________________________________________________________ 6. Use the genetic code in your book to tell which amino acids are formed from this molecule. _______________________________________________________________________________________ For the questions 7 - 9, use the DNA molecule below. TACAATCCGTTATGCCACTCATGATTAGAGTCGCGGGATT 7. What mRNA sequence molecule would be made from the strand of DNA above? ______________________________________________________________________________________ 8. What tRNA sequence would be complementary to the mRNA molecule produced above? _______________________________________________________________________________________ 9. Use the genetic code in your book to tell which amino acids are formed from this molecule. _______________________________________________________________________________________ 10. How many codons are in the above mRNA molecule?________________________________________ 11.________________________________________type of RNA that transfers amino acids to the ribosome for protein assembly 12.________________________________________known as the initiator codon 13.________________________________________set of instructions that DNA and RNA use to make proteins 14.________________________________________the 3 nucleotide sequence in tRNA that is complementary to mRNA. 15.________________________________________process by which mRNA is decoded into a protein 16.________________________________________name for a group of amino acids bonded together 17.________________________________________name for the 3 stop codons 18.________________________________________place in the cell where translation takes place (be specific) 19. Explain why DNA and mRNA are read 3 nucleotides at a time? 20. Explain the entire process of how DNA contains the code to make proteins such as hemoglobin or a protein that controls what color your hair or eyes are. In your answer you should include information about the structure of DNA, the process of transcription, and translation and protein synthesis. 21. Where does process A take place in the cell?________________________________________ 22. What is the process represented by A? ____________________________________________ 23. What is the process represented by B?______________________________________________ 24. Complete the table below: Original DNA code mRNA copy tRNA anticodon Amino Acid TGA AAA ACU GUU UGA Threonine Glutamine Tryptophan