Download Translation Worksheet

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA replication wikipedia , lookup

DNA repair protein XRCC4 wikipedia , lookup

Helicase wikipedia , lookup

DNA polymerase wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

DNA nanotechnology wikipedia , lookup

Microsatellite wikipedia , lookup

Replisome wikipedia , lookup

Helitron (biology) wikipedia , lookup

Transcript
WS 8 – 3: Translation and Protein Synthesis
Name_________________________________________________
For the questions 1 - 4, use the DNA molecule below.
TACCGCTAGGATACGTGCAAATTAATT
1. What mRNA sequence molecule would be made from the strand of DNA above?
______________________________________________________________________________________
2. What tRNA sequence would be complementary to the mRNA molecule produced above?
_______________________________________________________________________________________
3. Use the genetic code in your book to tell which amino acids are formed from this molecule.
_______________________________________________________________________________________
For the questions 4 - 6, use the DNA molecule below.
TACGGGCCCAAATTTTGGACTCATCTAATT
4. What mRNA sequence molecule would be made from the strand of DNA above?
______________________________________________________________________________________
5. What tRNA sequence would be complementary to the mRNA molecule produced above?
_______________________________________________________________________________________
6. Use the genetic code in your book to tell which amino acids are formed from this molecule.
_______________________________________________________________________________________
For the questions 7 - 9, use the DNA molecule below.
TACAATCCGTTATGCCACTCATGATTAGAGTCGCGGGATT
7. What mRNA sequence molecule would be made from the strand of DNA above?
______________________________________________________________________________________
8. What tRNA sequence would be complementary to the mRNA molecule produced above?
_______________________________________________________________________________________
9. Use the genetic code in your book to tell which amino acids are formed from this molecule.
_______________________________________________________________________________________
10. How many codons are in the above mRNA molecule?________________________________________
11.________________________________________type of RNA that transfers amino acids to the ribosome for
protein assembly
12.________________________________________known as the initiator codon
13.________________________________________set of instructions that DNA and RNA use to make
proteins
14.________________________________________the 3 nucleotide sequence in tRNA that is complementary
to mRNA.
15.________________________________________process by which mRNA is decoded into a protein
16.________________________________________name for a group of amino acids bonded together
17.________________________________________name for the 3 stop codons
18.________________________________________place in the cell where translation takes place (be specific)
19. Explain why DNA and mRNA are read 3 nucleotides at a time?
20. Explain the entire process of how DNA contains the code to make proteins such as hemoglobin or a protein
that controls what color your hair or eyes are. In your answer you should include information about the structure
of DNA, the process of transcription, and translation and protein synthesis.
21. Where does process A take place in the cell?________________________________________
22. What is the process represented by A? ____________________________________________
23. What is the process represented by B?______________________________________________
24. Complete the table below:
Original DNA
code
mRNA copy
tRNA
anticodon
Amino Acid
TGA
AAA
ACU
GUU
UGA
Threonine
Glutamine
Tryptophan