Download Supplementary Information (doc 62K)

1
Supplementary data
Viral vector production:
Retroviral vectors - We produced two series of retroviral vectors, as described previously
by our group [14, 23-24]. In brief, the recombinant retroviral vector encoding fibulin-5
was constructed by inserting the 1361bp fibulin-5 cDNA fragment (Genebank accession:
#NM 006329) into the BamHI site of pLXSN plasmid (# K1060-B Clontech, USA) under
the control of Mo-MULV 5’-long terminal repeat (LTR) and the SV40 poly A signal. The
first series of 3 vectors used in short term (2 weeks) experiments, encoded fibulin-5-GFP
and VEGF165-GFP, using bicistronic expression cassettes, and GFP alone. The second
series of vectors, used in the long term experiments (24 weeks) encoded fibulin-5 or
VEGF165 alone. Fibulin-5 encoding vectors were pseudo-typed to the 10A envelop while
VEGF165 encoding vectors were pseudo-typed to the GaLV envelop (packaging cell lines
were obtained from F-L Cosset, Lyon, France){Cosset #210}.
Adenoviral vectors - The recombinant adenoviral vector expressing the human fibulin-5
and GFP genes was constructed by a modified AdEasy protocol.{He, 1998 #134}
Construction of adenoviral vectors encoding VEGF165-GFP and GFP alone was
performed as described by Weisz et al, with minor modifications. {Weisz, 2001 #211}
Titer of each viral stock was determined by plaque assay in 293 cells and the titers ranged
-1010 -1011pfu/ml.
Trans-gene expression was monitored by GFP expression under fluorescent microscope,
Western blot, and by immunohistochemistry (IHC) for the relevant trans-gene.
Smooth muscle cell (SMC) isolation and expansion
2
5-10cm vein remnants from patients undergoing coronary artery bypass grafting were
used for vascular cell isolation. Informed consent was obtained from the patients prior to
surgery. The vein segment was cut open longitudinally and incubated in a 15 ml tube at
37C, 5% CO2 for 60 min with a mixture of Elastase (0.65 unit/ml; Sigma, USA) and
Collagenase (277 unit/ml; Sigma, USA) solutions. The entire vein was then sectioned
using surgical scissors into 2x2mm segments. Each segment (ex-plant) was stretched in a
fibronectin-coated well of a 24-well tissue culture plate using forceps with the intimal
side facing the plate. 250 μl SMC growth medium (DMEM (Sigma, USA), FBS 20%,
Glutamine 2 mM, Penicillin 100 U/ml Streptomycin 100µg/ml and bFGF 3ng/ml) was
dripped over each ex-plant. The ex-plants were incubated at 37C, 5% CO2. 24 hours
following ex-plant placement, the medium was exchanged (350µl/well). Medium was
exchanged thereafter every 48 hours, until SMCs grew out from the ex-plant and covered
1/4 of the well surface. Cells were trypsinized and seeded on PBS-Gelatin (Sigma, USA)
coated plates. In all in-vitro experiments we used SMCs at passage 7-8 to maintain
phenotypic stability.
SMC identification
SMCs are identified by typical "hill and valley" morphology and by IHC to intra-cellular
-smooth muscle cell actin (αSMC actin). In brief, cells were seeded on 4-well tissue
culture slides (Nunc, USA) for 24h and then fixed with 4% paraformaldehyde (PFA).
Following antigen retrieval, slides were incubated with CAS block (Zymed, USA) and
then immunostained with mouse anti- human SMC actin antibodies (1:50, DAKO,
Denmark). Secondary biotin-conjugated goat anti-mouse (1:1000, Chemicon, USA).
3
Bound antibody detection was performed with Horseradish Peroxidase conjugated
streptavidin (Chemicon, USA).
Retroviral vector transduction
4x105 cells were seeded on 60mm fibronectin-coated plates (4.5g/ml) 24h prior to
transduction. Transduction was initiated by incubation of each cell type with DEAEdextran (1mg/ml; Sigma, USA) in transduction medium (M199 medium supplemented
with Glutamine 2 mM) for 1 min at 37C, 5% CO2. Then, the cells were exposed to the
retroviral vectors in transduction medium for 4 hours at 37°C, 5% CO2. At the end of 4
hours of exposure to the vectors, medium containing the retrovirus was replaced with
growth medium.
Vascular cells were cultured in the presence of G418 (0.5 mg/ml) and trans-gene
expression was monitored by GFP expression under fluorescent microscope, Western
blot, ELISA and by IHC for the relevant trans-gene.
Telomerase activity in retrovirally transduced ECs:
Telomeric repeat amplification protocol (TRAP) is a fast and sensitive PCR-based assay
for detection and measurement of telomerase activity. Primary human saphenous vein
ECs (HSVEC) were tested for telomerase activity following retroviral transduction.
Naïve cells (passage 2-3) and retrovirally transduced cells (co-expressing fibulin-5 and
VEGF165) (passages 8-9) were analyzed. HSVEC were seeded in 6-well plates or in 25
cm2 flasks and allowed to grow to sub-confluence. Cells were then trypsinized and
counted, and 2x105 cells were added to a sterile 1.5 ml Eppendorf tube for each reaction.
The cells were centrifuged at 4°C, 3000g for 10 min. The supernatant was removed, and
4
the cells were re-suspended in PBS and centrifuged again at 4°C, 3000g for 10 min. After
the supernatant was removed, the cell pellets were stored at -80°C until use.
We used the telomerase PCR ELISA kit according to the manufacturer’s instructions
(Roche Applied Science, Indianapolis, IN). Cell pellets were re-suspended in lysis buffer
and incubated for 30 min. The lysates were centrifuged at 4°C, 16,000g for 20 min, and
the supernatants were transferred to a new sterile tube. To perform the telomeric repeat
amplification protocol (TRAP), 3µl of the cell extracts were subjected to PCR, using a
MJ Research Inc., DNA Thermal Cycler PTC-100, according to the following protocol:
20 min at 25°C for primer elongation; 2 cycles of 5 min at 94°C; 30 cycles of 30 sec at
94°C (denaturation), 30 sec at 50°C (annealing), 90 sec at 72°C (polymerization), and 10
min at 72°C. The amplification product was denatured and hybridized to a digoxygeninlabeled telomeric repeat-specific probe. The primer was biotin-labeled so it could be
immobilized on the streptavidin-coated microtiter plate. The sample was incubated with
an antibody against digoxygenin conjugated to peroxidase and was visualized by a
peroxidase-metabolizing tetramethyl benzidine substrate. Absorbance was measured at
450 nm with a reference wavelength of 620 nm. As a negative control, cell extracts were
heat treated at 85°C for 10 min prior to the TRAP reaction. As a positive control we used
an extract of human embryonic kidney cell line (293 cells).
Transgene copy number in dually transduced endothelial cells (ECs):
Retroviral vector transgene copy number per cell was tested in primary human ECs using
a quantitative PCR assay (Taqman PCR). PCR was performed on genomic DNA
extracted from transduced cells. We used specific transgene primers and probes for
fibulin-5 or VEGF165, as well as primers and probes for RNase P, a housekeeping gene of
5
which only one copy is present per cell genome. The number of transgene copies per cell
was calculated also according to the percentage of transduced cells, as evaluated by IHC.
Amplification, data acquisition and analysis were performed using an ABI PRISM 7700
sequencer detector. The primers and probes were all "Assays on Demand", purchased
from AB Applied Biosystems. Assays-on-Demand products for gene expression are
biologically informative, pre-formulated gene expression assays that provide rapid,
reliable results on human RefSeq transcripts. Target assays contain TaqMan ® MGB
probes (6-FAM dye-labeled) combined with primers at non-limiting concentrations.
PCRs were held at 95°C for 10 min and then 40 cycles at 95°C 15 s, 60°C 1 min.
For VEGF165 we used Assay on Demand ID: Hs00173626_m1 which amplifies a region
of the VEGF165 gene between exons 1 and 2. For fibulin-5 we used Assay on Demand ID:
HS01056639_m1, which amplifies a region of the fibulin-5 gene between exons 8 and 9.
For human RNase P (a one-copy per genome housekeeping gene) we used Assay on
Demand (cat no. 4316831, Applied Biosystems).
Genomic DNA from transduced cells (HSVEC) was extracted using the DNA easy
(Qiagen, Germany), according to the manufacturer protocol. For cellular DNA analysis,
10-15ng of genomic DNA collected from transduced cells were submitted to quantitative
PCR with the two sets of primers and probes. To determine the DNA content we
generated serial 10-fold dilutions of fibulin-5 and of VEGF165 (LXSN plasmid) from
10,000 to 10 copies. In parallel, serial 10-fold dilutions of standard human genomic
control DNA in a known concentration (10ng/µl) were generated from 10,000 to 10
copies, assuming that the human genome weight is 6 pg. The Ct values obtained with the
two sets of primers were used to determine the genomic copy number in PCR, thereby
6
allowing determination of the percentage of transduced cells by quantitative PCR. The
number of fibulin-5 or VEGF165 copies per cell was calculated as the ratio between the
percentage of transduced cell, as determined by quantitative PCR, and the equivalent
percentage that was determined by IHC.
Rat carotid artery model of vascular injury:
Twenty six male Sprague-Dowley rats weighting 400-450 g were anesthetized with
ketamin (100mg/kg), xylazine (10mg/kg) and acepromazine 0.25 mg/kg, injected
intramuscularly. Heparin (100 U) was injected at this stage subcutaneously and 50U were
injected intramuscularly. The distal segment of the right external carotid was ligated and
an arteriotomy was performed. A 2F Fogarty balloon catheter was introduced through the
arteriotomy and was advanced to the origin of the right common carotid artery. The
balloon was inflated sufficiently to generate slight resistance (0.3ml) and the filled
balloon was withdrawn three times to produce endothelial denudation of the entire length
of the right common carotid artery.
After induction of injury, a 24G catheter was introduced via the arteriotomy into the
injured segment, and 0.15 ml of the following solutions were injected: adenoviral vector
suspension (1010 pfu) encoding fibulin-5-GFP (n=6), adenoviral vectors encoding GFP,
adenoviral vectors encoding VEGF165-GFP (n=5) and adenoviral mixture of vectors
encoding fibulin-5 and VEGF (5x109 pfu from each vector in total volume of 0.15ml)
(n=5). Five rats were injected with normal saline. Using two ligatures, the common
carotid artery was isolated from the aorta and the distal artery for 20 minutes, allowing
the injected solution to be maintained in the isolated segment. After removal of the
catheter, the external right carotid artery was ligated proximally to the arteriotomy and
7
blood flow was restored in the injured segment. Core temperature was maintained at 3637C; animals were kept on dry electrical warming blankets.
The rats were anesthetized 14 days after vascular injury and transgene transduction.
Pressure perfusion fixation was performed for the carotid arteries and the rats were
sacrificed. After fixation, the entire right common carotid artery was retrieved and
immersed in formalin for 48 hours and embedded in paraffin blocks. The left common
carotid artery was also excised and used as control. The injured arterial segment artery
was evaluated for the presence of neointimal formation, luminal patency, elastin fiber
structure and EC coating, using morphometric analysis of 2 cross sections from the mid
and distal segments. Slides were stained by hematoxylin-eosin (H&E) for morphometric
analysis using digital image analysis (Image Pro Plus 4, Media Cybernetics, USA).
The injured arterial segment artery was evaluated for the presence of neointimal
formation, luminal patency, elastin fiber structure and EC coating, using morphometric
analysis of 2 cross sections from the mid and distal segments. The uninjured carotid
artery from the same animal served as baseline control. Slides were stained by
hematoxylin-eosin for morphometric analysis using digital image analysis (Image Pro
Plus 4, Media Cybernetics, USA). The degree of arterial neointimal formation was
determined by the ratio of neointimal area to the medial area (I/M). Elastic fiber
abnormal structure was calculated as the ratio between the normal appearance of elastin
fibers to abnormal, ruptured, discontinued fibers.
Adjacent carotid sections were stained for the presence of fibulin-5 and for proliferating
cells using Ki-67 staining, a marker of cell proliferation. In situ hybridization for VEGF
in the rat carotid arteries was performed using the entire mouse coding region of VEGF
8
(660 bp). Hybridization was kindly performed in the laboratory of Prof. Keshet, Hebrew
University, Jerusalem, Israel.
Small caliber ePTFE graft implantation in the sheep carotid artery model:
The animal protocol was reviewed and approved by the "animal handling and care
committee", Technion, Haifa, Israel. The vascular surgeon who performed the graft
implantation was aware to the type of the seeded graft (seeded vs. unseeded) but was
unaware whether grafts were seeded with control or modified endothelial cells. To
eliminate bias in quality of surgery we used flow criteria and angiographic findings at the
end of surgery to exclude technically failed or borderline graft implantation.
Anesthesia and medications: Sheep were treated with 325mg aspirin and 75mg
clopidogrel 2 days prior to graft implantation, and until sacrifice in the short-term
experiment (2 weeks), and for 1 month in the long-term experiment. After one month of
dual anti-platelet therapy, aspirin alone was given for the remaining of the study. For all
operations and catheterization procedures sheep were sedated using intra-venous
injection of a mixture containing Ketaset 10 mg/kg and Xylazine base 2% - 0.1 mg/kg.
Induction of anesthesia was performed using Propofol 4-6mg intravenously. Anesthesia
was maintained with inhaled Isoflurane 0.5-3%. Analgesia was administered 2 days prior
to surgery and 2 days following surgery using Tolfine 4%, 2 mg/kg, intra-muscular.
In all sheep studied, the initial procedure included stripping a 10 cm long segment of the
lateral saphenous vein (hind limb) under general anesthesia. After vein stripping, the
sheep were awakened and returned to their cage. The vein was used for autologous cell
isolation. Isolated ECs were expanded and transduced as detailed above. The goals of the
9
short term experiments were to test the effects of seeding modified cells on inflammation
and thrombosis. We also tested cell adherence at the end of the study in order to correlate
cell adherence to patency, inflammation and thrombosis.
PCR for transgene expression in seeded grafts at 6 months:
To validate the presence of the seeded cells on the grafts after 6 months we identified
retroviral vector-specific sequences in sheep tissues. PCR was performed on DNA
samples extracted from the distal, medial and proximal parts of the implanted grafts. To
test for migration of seeded graft cells to other tissues, the following tissues were also
tested by PCR: peripheral blood, eye, kidney, spleen, lung, testes or ovaries, liver, heart,
bone marrow, brain, mastication muscle (the muscle supplied by the carotid artery) and
quadriceps muscle. Extraction of genomic DNA from tissue and peripheral blood cells
was performed using the QIAmp DNeasy kit (Qiagen, Germany) according to
manufacturer’s protocol. Nested PCR assay was employed due to its sensitivity and
specificity, designed to detect the sequences of two adjacent vector genes, the SV40
promoter (SV40) region and neomycin resistance gene (Neo) in the retroviral vector
(pLXSN, gene bank accession #: M28248). The primers chosen led to the amplification
of a single PCR product of 140bp. Triplicate PCR were performed for each tissue, each
containing ~1g DNA. One of the triplicates was spiked with 50 copies of vector DNA.
The integrity of the DNA extracted from the tissue samples was assessed by PCR specific
for the sheep housekeeping gene -actin. Sample DNA (~0.01g) yielding a single
specific PCR amplification product of 182bp was considered affirmative when no
amplification products were observed for negative controls.
10
PCR reaction mixture included Thermo-Start® (ABgene, UK) master mix containing:
1.25 units Thermo-Start® DNA polymerase, reaction buffer with 1.5mM MgCl2, and
0.2mM of each dNTP and 0.02M of each primer. The first round of PCR amplification
included
the
sense
primer-
SV40
gene
from
LXSN
vector
(bp1690)
GGTGTGGAAAGTCCCCAGGCT and the anti-sense primer - neo gene from the LXSN
vector- (bp2813) GATAGAAGGCGATGCGCTGCGAATCG.
The second round of PCR amplification included the sense primer - neo gene from LXSN
vector (bp2400) AAACTATCCATCATGGCTGAT and the anti-sense primer - neo gene
from LXSN vector (bp2540) ATGCTCTTCGTCCAGATCAT.
PCR reactions, carried out in a Biometra T3 Thermocycler (Germany) included a 15min
hotstart at 95C, followed by 40 cycles of 30sec denaturation at 93C, 30sec annealing
and 40sec extension at 72C. The reaction was finalized by a 5min extension at 72C.