Download Name

Survey
yes no Was this document useful for you?
   Thank you for your participation!

* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project

Document related concepts

DNA repair wikipedia , lookup

DNA repair protein XRCC4 wikipedia , lookup

Homologous recombination wikipedia , lookup

DNA profiling wikipedia , lookup

DNA replication wikipedia , lookup

Microsatellite wikipedia , lookup

Helicase wikipedia , lookup

United Kingdom National DNA Database wikipedia , lookup

DNA polymerase wikipedia , lookup

DNA nanotechnology wikipedia , lookup

Helitron (biology) wikipedia , lookup

Replisome wikipedia , lookup

Transcript
Name:________________________________
DNA and Protein Synthesis Review
Definitions: Define the following terms
Nucleus: the nucleus is the organelle in a eukaryotic cell that contains and protects the
DNA
Gene: The portion of DNA that codes for a specific trait
Chromosome: the form DNA takes when it is ready to divide
Nucloetide: The molecule that makes up DNA and RNA, composed of a sugar,
phosphate group and a nitrogen base
DNA Replication: Process DNA goes through to copy its genetic info before the cell
divides.
Helicase: The enzyme that breaks the hydrogen bonds and splits open the DNA during
replication.
DNA Polymerase: The enzyme that attaches the new complimentary bases to the DNA
strand during replication.
Amino Acids: The subunits that combine to form proteins
Codon: Three base pair code that codes for a specific amino acid
Transcription: First stage of protein synthesis in which RNA copies DNA in the nucleus
Translation: Second stage of protein synthesis in which mRNA is converted into an
amino acid sequence
Protein Synthesis: Process in which information in the DNA is used to make proteins
Anti-codon: Three base pair code on the tRNA that matches with the codon on the
mRNA
DNA Structure
1. Where is the DNA found and why is it found there?
The DNA is found in the nucleus, it is protected in the nucleus.
2. What are the 3 components that make up a DNA molecule?
DNA is made up of the sugar deoxyribose, a phosphate group and a nitrogen base
3. If DNA is a ladder label the parts of the molecule in the diagram below:
The sides of the ladder is composed of alternating phophates and deoxyribose, and
the rungs are the nitrogen bases.
4. What are the 4 bases found in a DNA molecule?
Adenine, guanine, cytosine and thymine
5. Briefly describe the process of DNA replication. Use the terms helicase and
DNA polymerase.
 Helicase opens up the DNA strand
 Original strand acts as a template for the complimentary strand
 DNA polymerase adds complimentary bases to the original strand
 Process continues until entire DNA strand is replicated.
RNA
1. What are 3 ways that DNA is different from RNA
a.
Deoxyribose vs. ribose
b.
Double stranded vs. Single Stranded
c.
Thymine vs. Uracil
2. Explain the role of the 3 types of RNA below:
a. mRNA- copies the DNA during transcription
b. rRNA- makes up the ribosome
c. tRNA- carries amino acids to the ribosome during translation
3.
4. What does each 3 letter codon code for specifically?
A specific amino acid
Protein Synthesis
1. What is the overall purpose of the process of protein synthesis?
To synthesize proteins that the body needs.
2. Transcription:
a. Where does transcription occur?
Nucleolus
b. What type of RNA is used during transcription?
mRNA
c. Describe what is happening during transcription. Use the terms nucleus,
DNA, mRNA



During transcription the RNA synthase attaches at the promoter
on the DNA and unwinds the strand.
RNA synthase attaches complimentary RNA bases according to
the DNA strand.
The process conitinues until the STOP codon is reached.
3. Translation
a. Where does translation occur?
Cytoplasm
b. What type of RNA is used during translation?
rRNA, tRNA
c. Describe what is happening during translation. Use the terms ribosome,
mRNA, tRNA, codon, amino acid, protein
 mRNA leaves the nucleus and binds to a ribosome.
 The ribosome moves along the mRNA and reads every three
bases (codon).
 tRNA (compliment of mRNA) picks up specific amino acids
from the cytoplasm and attaches to the mRNA strand.
 The “anticodon” of tRNA temporarily attaches to its
complimentary codon on mRNA and adds its amino acid.
o Amino acids are bonded with peptide bonds forming a
polypeptide
 This process continues until a “STOP” codon is reached.
4. Use your codon wheels to translate the following DNA strands into mRNA and
then into amino acid sequences.
DNA:
TACTTTGACGGCCGATTACCCGATTAGATC
mRNA:
AUGAAACUGCCGGCUAAUGGGCUAAUCUAG
Amino acid
Chain
Met-Lys-Leu-Pro-Ala-Asp-Gly-Leu-Iso-STOP
DNA:
TACAAACGCATGGACTTTCACATT
mRNA:
AUGUUUGCGUACCUGAAAGUGUAA
Amino acid
Chain
Met-Phe-Ala-Tyr-Leu-Lys-Val-STOP