Survey
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
* Your assessment is very important for improving the workof artificial intelligence, which forms the content of this project
Polycomb Group Proteins and Cancer wikipedia , lookup
Epigenetics in stem-cell differentiation wikipedia , lookup
History of genetic engineering wikipedia , lookup
Vectors in gene therapy wikipedia , lookup
Site-specific recombinase technology wikipedia , lookup
Supplementary Information Methods Generation of double knockout mice. Homozygous TSG-53® mice [C57BL/6 N12] were purchased from Taconic Farm, Inc. (37) and were crossed with inhouse Rassf1a-/- mice (Rassf1a.301A-102/129S1 strain) (23). Heterozygous offspring Rassf1a+/- p53+/- mice were then intercrossed to produce single and compound mutant animals with a hybrid C57BL/6 x 129/Sv genetic background. The mice were housed in a high-efficiency particulate air-filtered, environmentally controlled room (at 24 + 1 C, on a 12-h light/dark cycle), with food and water available ad libitum. The animals were maintained in compliance with the National Institute of Health guidelines for animal care and use. Mice were routinely genotyped using tail DNA isolated by DirectPCR Lysis Reagent (Viagen Biotech, Inc.). To identify the Rassf1a status, PCR amplification was performed with primers UMIOAI, 5’ –TTGTGCCGTGCCCCGCCCA, LMIIAA, 5’ – TGACCAGCCCTCCACTGCCGC and Neo48U, 5’ – GGGCCAGCTCATTCCTCCCAC, as previously described (23). To detect the p53 genotype, the following primers were used in independent PCR reactions: P5314F, 5’-ACACACCTGTAGCTCCAGCAC, P53E5R, 5’- AGCGTCTCACGACCTCCGTG, OPT-21, 5’ –GTGTTCCGGCTGTCAGCGCA, which produced a 520-bp band for the wild type allele, a 730-bp band for the knockout allele and both fragments for heterozygous mice (Figure 1A). PCR thermocycling conditions were set in accordance with the Taconic protocol: 95C for 15 min (1 cycle); 94°C for 45 sec, 60C for 1 min, 7C for 1 min (30 cycles); 72C for 5 min (1 cycle) (Taconic Farm, Inc.). Multiplex PCR products were separated on 2% agarose gels. MEF generation and cell culture. Primary mouse embryonic fibroblasts (MEFs) were isolated from embryos derived from Rassf1a+/- p53+/- parents, according to published procedures (19, 23). Briefly, mouse embryos were harvested in utero at 13.5 days of gestation. Following the removal of the head (for DNA genotyping) and internal organs, the embryos were roughly minced and incubated with trypsin for 30 min at 37C. Next, cells were disaggregated by passage through a syringe equipped with an 18-gauge needle. Homogenous cell suspensions were then added to 25 ml of Dulbecco Modified Eagle’s Medium (DMEM, SIGMA,), supplemented with 10% fetal calf serum, non-essential aminoacids, and 0.1 mM -mercaptoethanol. Following 3-4 days of incubation at 37°C, confluent cultures were trypsinized and frozen, at 2-3 x 106 cells per vial. Early passage (P<6) mouse embryonic fibroblasts (MEFs) were used for all experiments. Fluorescence Activated Cell Sorting (FACS) and video time lapse recording. MEFs were plated at a density of 0.7-1 x 106 per 100-mm dish at least 24 h prior to all the experiments. To study cell cycle perturbations following DNA damage, fibroblasts were treated with 0.2 µg/ml fresh doxorubicin (SIGMA) in DMEM for 18 h. For FACS analysis, cells were collected before and after treatment, washed thrice in PBS, fixed in 70% cold ethanol, and stained with propidium iodide (at a final concentration of 100 g/ml) in a PBS buffer containing 0.1% BSA, 0.1% Triton X-100, and 150 g/ml RNase. Fifty thousand to 100,000 cells were processed using a MoFlo MLS apparatus (Dako Cytomation, Colorado), and data were analyzed using the Summit software v4.2 (Dako Cytomation, Colorado). For life cell imaging, asynchronous fibroblasts derived from Rassf1a+/+ p53+/+, Rassf1a-/- p53+/+, Rassf1a+/+ p53-/-, Rassf1a+/- p53-/-, and Rassf1a-/- p53-/- embryos, were seeded at a density of 1 x 10 5 in 25-mm flasks and consecutive images were captured by time-lapse microscopy (Nikon Eclipse TS100, Nikon Instruments Inc., Melville, NY). Mitotic progression was monitored from prophase (time 0: when cells began to change morphology) until cytokinesis was completed. Microphotoghraphs of the cell cultures were taken every 5 min with video time lapse-frame (VTLF) software. GTG banding and interphase fluorescence in situ hybridization (FISH). For metaphase spread preparation, early passage (passage 3) mouse embryonic fibroblasts from Rassf1a+/+ p53+/+, Rassf1a-/- p53+/-, and Rassf1a-/- p53-/littermates, were grown to 80% confluency and harvested following standard procedures. Cells were fixed using Carnoy’s fixative (3:1 methanol:acetic acid), dropped onto non-sylanized slides, and air-dried. The slides were baked at 45C for 72 hours prior to staining. Slides were then GTG-banded with trypsin (standard procedures), and metaphases (30 per genotype) were photographed with the BandView imaging system from Applied Spectral Imaging (ASI). To determine the ploidy level of mouse paraffin-embedded tissue (PET) sections, FISH was performed using the FISH-mapped confirmed BAC probe, RP23-159j3 (8qA1.1) labeled in Spectrum Orange (Abbott Laboratories, Inc.). Unstained PET slides were baked (60C for 3 h), placed in fresh xylene (5 min, twice), and rehydrated through serial ethanol rinses and water. Following several washes in 1xPBS and 2xSSC, slides were pretreated with pepsin and hybridized with the FISH probe, as recommended by the manufacturer. Two hundred interphase cells were scored per specimen. Images were captured with the BioView Imaging system (BioView, Israel). Figure legends Suppl. Figure 1. A multi-step model for tumor development in Rassf1a, p53 single and double mutant mice. a) wildtype mouse; very slow tumor development. b) Rassf1a-/- p53+/- mouse; in the situation where an active p53 allele is retained, as well as its ability to overrule the mitotic defects dictated by the Rassf1a-/- phenotype (at least initially and/or in absence of other oncogenic events), tumors may grow slowly due to low levels of aneuploidy and/or chromosome rearrangements (Rassf1a-/- p53+/- phenotype). A second hit (loss of the functional p53 allele) may be required to accelerate tumorigenesis. c) p53-/mouse; rapid onset of tumorigenesis d) Rassf1a-/-, p53-/- mouse; in a more severe scenario where both Rassf1a and p53 functions are completely lost, cells are incapable of monitoring the mitotic defects generated by loss of Rassf1a. This will lead to significant genomic instability, possible growth advantage and aggressive tumor development (Rassf1a-/- p53-/- phenotype).