* Your assessment is very important for improving the work of artificial intelligence, which forms the content of this project
Download Genetics Name: ____ Unit 4: Genetic Engineering Date: :_____
DNA repair protein XRCC4 wikipedia , lookup
DNA sequencing wikipedia , lookup
Zinc finger nuclease wikipedia , lookup
Homologous recombination wikipedia , lookup
DNA replication wikipedia , lookup
DNA profiling wikipedia , lookup
DNA nanotechnology wikipedia , lookup
DNA polymerase wikipedia , lookup
Microsatellite wikipedia , lookup
Genetics Unit 4: Genetic Engineering Name: __________________________ Date: ___________________Per:_____ Restriction Enzyme Worksheet #1 (From City Lab’s Case of the Missing Crown Jewels. Trustees of Boston University) Background Info: A natural enemy of bacteria is a virus. To defend themselves when attacked by a virus, bacteria use chemical weapons (enzymes in this case) that break up the DNA of the virus. The action of the enzymes on the viral DNA is shown in the diagram below: DNA from virus cut site cut site TACCGGGAATTCATCCGGTGAATTCTAGCGTAC ATGGCCCTTAAGTAGGCCACTTAAGATCGCATG TACCGGG ATGGCCCTTAA AATTCATCCGGTG GTAGGCCACTTAA AATTCTAGCGTAC GATCGCATG Use the diagram above to answer the following questions: 1. The macromolecule that cuts the DNA is called a __________________________________. 2. These enzymes cut the DNA, which creates different sized _______________________. 3. The restriction enzyme used above is called EcoRI. EcoRI cuts DNA everywhere the base pattern is _______________. 4. Another restriction enzyme is called HaeIII. It cuts DNA at the following base sequence: CCGG GGCC a. Show the DNA fragments that would result if HaeIII was used to cut the DNA fragment shown in the first diagram above. Use your pencil to draw the cut sites in. 5. Explain why the same restriction enzymes can be used to cut DNA from any organism. 6. The words BOB and MADAM are called palindromes. What are palindromes? 7. Explain how palindromes are used by restriction enzymes to cut double stranded DNA.