Figure S1. Interactions between AS1 and CO proteins that contains
... “No protein” sample. Empty vector and 6xHis-AS1 indicate 1.25 μg of total extracts containing 6xHis protein or 6xHis-AS1 fusion protein, respectively. (a) The DNA-AS1 protein complex was only detected in the 32P-labeled amplicon 11 (-482/-189) fragment. (b) The effect of CO on the binding of AS1 to ...
... “No protein” sample. Empty vector and 6xHis-AS1 indicate 1.25 μg of total extracts containing 6xHis protein or 6xHis-AS1 fusion protein, respectively. (a) The DNA-AS1 protein complex was only detected in the 32P-labeled amplicon 11 (-482/-189) fragment. (b) The effect of CO on the binding of AS1 to ...
A process for analysis of microarray comparative genomics
... the microarray slide. If a gene is conserved in both samples the fluorescence emitted at the corresponding position on the array will be a mixture derived from both labels. If the gene is present in only one sample then only one type of fluorescence will be observed. The use of a reference sample in ...
... the microarray slide. If a gene is conserved in both samples the fluorescence emitted at the corresponding position on the array will be a mixture derived from both labels. If the gene is present in only one sample then only one type of fluorescence will be observed. The use of a reference sample in ...
Investigation of Four Genes Responsible for Autosomal Recessive
... protein EphA2 is an epithelial cell kinase that interacts with membrane-bound ephrin ligands, which play an important role in morphogenesis and in numerous developmental processes [22]. For the first time, it was reported responsible for autosomal dominant cataracts (ADCC) and recently it was implic ...
... protein EphA2 is an epithelial cell kinase that interacts with membrane-bound ephrin ligands, which play an important role in morphogenesis and in numerous developmental processes [22]. For the first time, it was reported responsible for autosomal dominant cataracts (ADCC) and recently it was implic ...
Participation of the proteasomal lid subunit Rpn11 in mitochondrial
... histidine residues located in this motif (the rpn11AXA mutant) was non-viable [12]; likewise, double substitution of both these histidine residues could not rescue RNA-interference treatment of DmS13/rpn11 in insect cells [31]. Equivalent mutations in Csn5, the MPN+ component of the CSN, abolished t ...
... histidine residues located in this motif (the rpn11AXA mutant) was non-viable [12]; likewise, double substitution of both these histidine residues could not rescue RNA-interference treatment of DmS13/rpn11 in insect cells [31]. Equivalent mutations in Csn5, the MPN+ component of the CSN, abolished t ...
High-Resolution Single-Copy Gene Fluorescence in Situ
... is biologically relevant to genetic maps since pachytene is thought to be the stage when recombination is completed (Roeder, 1997), and recombination occurs at a much higher frequency within genes than outside genes (Civardi et al., 1994; ...
... is biologically relevant to genetic maps since pachytene is thought to be the stage when recombination is completed (Roeder, 1997), and recombination occurs at a much higher frequency within genes than outside genes (Civardi et al., 1994; ...
A Single Amino Acid Change in the SPRY Domain of Human Trim5
... become clear that Ref1 and Lv1 are encoded by the same gene, Trim5␣, which inhibits retrovirus replication in a species-specific manner [10–14]. A series of chimeras between the human and rhesus monkey Trim5 genes were created to map and identify these specificity determinants. The Trim5␣ SPRY domai ...
... become clear that Ref1 and Lv1 are encoded by the same gene, Trim5␣, which inhibits retrovirus replication in a species-specific manner [10–14]. A series of chimeras between the human and rhesus monkey Trim5 genes were created to map and identify these specificity determinants. The Trim5␣ SPRY domai ...
human genome research
... around one quarter of the total code (including many of the regions of greatest interest) along with a sketchier 'first draft' of most of the remaining sequence. All told, around 85% of the genome has been sequenced in finished or draft form. The current aim is to go back and fill in the gaps over t ...
... around one quarter of the total code (including many of the regions of greatest interest) along with a sketchier 'first draft' of most of the remaining sequence. All told, around 85% of the genome has been sequenced in finished or draft form. The current aim is to go back and fill in the gaps over t ...
Gene Section NQO1 (NAD(P)H dehydrogenase, quinone 1) Atlas of Genetics and Cytogenetics
... electron mechanism, which precludes generation of reactive oxygen radicals, demonstrates that NQO1 is a chemoprotective enzyme. Certain compounds such as antitumor quinones, however, can be bioactivated by two electron reduction and in these cases NQO1 serves as an activating enzyme. Because of the ...
... electron mechanism, which precludes generation of reactive oxygen radicals, demonstrates that NQO1 is a chemoprotective enzyme. Certain compounds such as antitumor quinones, however, can be bioactivated by two electron reduction and in these cases NQO1 serves as an activating enzyme. Because of the ...
A pair of Sox: distinct and overlapping functions of
... Genomic clones of sox9b (submitted as AY627769) were isolated by PCR from genomic DNA of 3 dpf (days post fertilization) zebrafish embryos using primers sox9b+296 CACCGGGACGAGCAGGAGAAGTT and sox9b-644 GTCTGGGCTGGTATTTGTAGTCTGGATGA obtained from the cDNA sequence AF277097, and they amplify most of th ...
... Genomic clones of sox9b (submitted as AY627769) were isolated by PCR from genomic DNA of 3 dpf (days post fertilization) zebrafish embryos using primers sox9b+296 CACCGGGACGAGCAGGAGAAGTT and sox9b-644 GTCTGGGCTGGTATTTGTAGTCTGGATGA obtained from the cDNA sequence AF277097, and they amplify most of th ...
Gene Section MYB (v-myb myeloblastosis viral oncogene homolog (avian))
... The NRD negatively regulates the trans-activating and transforming capacity of MYB. Several motifs within the NRD have been identified, including a Heptad Leucine Repeat (HLR) and a highly conserved EVES motif. Disruption of the HLR motif results in enhancement of MYB's trans-activating and transfor ...
... The NRD negatively regulates the trans-activating and transforming capacity of MYB. Several motifs within the NRD have been identified, including a Heptad Leucine Repeat (HLR) and a highly conserved EVES motif. Disruption of the HLR motif results in enhancement of MYB's trans-activating and transfor ...
Trichothiodystrophy: Update on the sulfur
... of the XPD gene. Rarely, mutated XPB gene or an unidentified TTD-A gene may result in TTD. In UVsensitive TTD, the TFIIH transcription factor containing XPB and XPD helicase activities necessary for both transcription initiation and DNA repair is damaged. Beyond deficiency in the NER pathway, it is ...
... of the XPD gene. Rarely, mutated XPB gene or an unidentified TTD-A gene may result in TTD. In UVsensitive TTD, the TFIIH transcription factor containing XPB and XPD helicase activities necessary for both transcription initiation and DNA repair is damaged. Beyond deficiency in the NER pathway, it is ...
PDF
... The aim of this study was to examine the role of histone H3S10 phosphorylation in transcriptional regulation in Drosophila. Many of the commercially available antibodies to this histone modification have been mostly used as a marker for mitotic chromosomes (Hendzel et al., 1997; Wei et al., 1998) an ...
... The aim of this study was to examine the role of histone H3S10 phosphorylation in transcriptional regulation in Drosophila. Many of the commercially available antibodies to this histone modification have been mostly used as a marker for mitotic chromosomes (Hendzel et al., 1997; Wei et al., 1998) an ...
Genomics Reveal Ancient Forms of Stanniocalcin in Amphioxus and
... 2006), and the non-teleostean gar and bowfin (Amemiya and Youson 2004). All these hormones share consistent structural features, including a conserved N-glycosylation site and 10 invariant cysteine residues that form intrachain disulfide bonds. Also, an 11th conserved cysteine residue that is critic ...
... 2006), and the non-teleostean gar and bowfin (Amemiya and Youson 2004). All these hormones share consistent structural features, including a conserved N-glycosylation site and 10 invariant cysteine residues that form intrachain disulfide bonds. Also, an 11th conserved cysteine residue that is critic ...
The Rad50 Signature Motif: Essential to ATP Binding and
... manganese ions for catalysis and form a DNAbinding groove that can accommodate a doublestranded DNA end.10 In vitro, Mre11 homologs exhibit 30 to 50 exonuclease activity on DNA substrates, as well as endonuclease activity on constrained structures such as hairpin ends.11 – 16 In every organism studi ...
... manganese ions for catalysis and form a DNAbinding groove that can accommodate a doublestranded DNA end.10 In vitro, Mre11 homologs exhibit 30 to 50 exonuclease activity on DNA substrates, as well as endonuclease activity on constrained structures such as hairpin ends.11 – 16 In every organism studi ...
Letter Gene Survival and Death on the Human Y
... X-linked genes without functional Y gametologs. Given the rapid evolution and importance of sex-biased genes (Ellegren and Parsch 2007), especially the high expression divergence of male-biased genes between species (Zhang et al. 2007), we also wondered whether X-linked genes expressed at high level ...
... X-linked genes without functional Y gametologs. Given the rapid evolution and importance of sex-biased genes (Ellegren and Parsch 2007), especially the high expression divergence of male-biased genes between species (Zhang et al. 2007), we also wondered whether X-linked genes expressed at high level ...
Molecular basis of the inflammatory response to adenovirus
... cytokines and chemokines and the recruitment of effector cells to the site of infection.8 These effector cells, which include neutrophils, monocytes/macrophages and natural killer cells in turn, limit the infection directly by killing infected cells or indirectly by secreting antiviral cytokines and ...
... cytokines and chemokines and the recruitment of effector cells to the site of infection.8 These effector cells, which include neutrophils, monocytes/macrophages and natural killer cells in turn, limit the infection directly by killing infected cells or indirectly by secreting antiviral cytokines and ...
There is an old saying
... Appetite-suppressant medications Appetite-suppressant medications promote weight loss by decreasing appetite or increasing the feeling of being full. Inhibitors of Dietary Cholesterol absorption In 1999, the drug orlistat was approved by the Food and Drug Administration (FDA) as an obesity treatment ...
... Appetite-suppressant medications Appetite-suppressant medications promote weight loss by decreasing appetite or increasing the feeling of being full. Inhibitors of Dietary Cholesterol absorption In 1999, the drug orlistat was approved by the Food and Drug Administration (FDA) as an obesity treatment ...
Translocation Breakpoints Are Clustered on Both Chromosome 8
... charge payment. This article must therefore be hereby marked "advertisement" in nccordunce with 18 U.S.C.section 1734 solely to indicute this fact. 0 1993 by The American Society of Hematology. ...
... charge payment. This article must therefore be hereby marked "advertisement" in nccordunce with 18 U.S.C.section 1734 solely to indicute this fact. 0 1993 by The American Society of Hematology. ...
Ribosomal Protein RPL27a Promotes Female
... (Fig. 2C). The frequency of defective ovules in rpl27ab mutants was higher than the wild type but less than that in rpl27ac mutants. Given that RPL27aC and RPL27aB acted redundantly in leaf development, we examined whether these genes are redundant in ovule development by testing whether RPL27aB can ...
... (Fig. 2C). The frequency of defective ovules in rpl27ab mutants was higher than the wild type but less than that in rpl27ac mutants. Given that RPL27aC and RPL27aB acted redundantly in leaf development, we examined whether these genes are redundant in ovule development by testing whether RPL27aB can ...
RiboT
... RiboT with mutations in the PTC A-site (normally lethal!) - were functional in cellular protein synthesis - gained the ability to bypass translation arrest caused by the SecM sequence ...
... RiboT with mutations in the PTC A-site (normally lethal!) - were functional in cellular protein synthesis - gained the ability to bypass translation arrest caused by the SecM sequence ...
What is Sequence Alignment?
... • Assembling multiple sequence reads into contigs, scaffolds • Aligning sequences with chromosomes • Finding genes and regulatory regions • Identifying gene products • Identifying function of gene products • Studying the structural organization of genomes • Comparative genomics BCB 444/544 F07 ISU ...
... • Assembling multiple sequence reads into contigs, scaffolds • Aligning sequences with chromosomes • Finding genes and regulatory regions • Identifying gene products • Identifying function of gene products • Studying the structural organization of genomes • Comparative genomics BCB 444/544 F07 ISU ...
Mitochondrial DNA - Circle
... their genetic information to the nucleus. The hydrogenosome, a structure involved in carbohydrate metabolism found in some Archezoans (Muller, 1992), is now thought to represent a mitochondria that has lost its genetic information completely and along with that loss, the ability to do the Krebs cycl ...
... their genetic information to the nucleus. The hydrogenosome, a structure involved in carbohydrate metabolism found in some Archezoans (Muller, 1992), is now thought to represent a mitochondria that has lost its genetic information completely and along with that loss, the ability to do the Krebs cycl ...
Imprinting capacity of gamete lineages in C. elegans
... populations of animals, the only difference being the parental source of the reporter chromosome (sperm versus oocyte) and the paired or unpaired character of the reporter-carrying chromosome in the parental generation. Measurement of relative GFP levels between two populations of animals presents a ...
... populations of animals, the only difference being the parental source of the reporter chromosome (sperm versus oocyte) and the paired or unpaired character of the reporter-carrying chromosome in the parental generation. Measurement of relative GFP levels between two populations of animals presents a ...