Survey of Conserved Alternative Splicing Events
... might have provided plants tolerance against droughts or temperature shifts and given them the ability to live on land. ...
... might have provided plants tolerance against droughts or temperature shifts and given them the ability to live on land. ...
08A-MembraneStructure
... forming glycolipids, or, more commonly, to proteins, forming glycoproteins. • The oligosaccharides on the external side of the plasma membrane vary from species to species, individual to individual, and even from cell type to cell type within the same individual. • This variation marks each cell typ ...
... forming glycolipids, or, more commonly, to proteins, forming glycoproteins. • The oligosaccharides on the external side of the plasma membrane vary from species to species, individual to individual, and even from cell type to cell type within the same individual. • This variation marks each cell typ ...
08A-MembraneStructure
... forming glycolipids, or, more commonly, to proteins, forming glycoproteins. • The oligosaccharides on the external side of the plasma membrane vary from species to species, individual to individual, and even from cell type to cell type within the same individual. • This variation marks each cell typ ...
... forming glycolipids, or, more commonly, to proteins, forming glycoproteins. • The oligosaccharides on the external side of the plasma membrane vary from species to species, individual to individual, and even from cell type to cell type within the same individual. • This variation marks each cell typ ...
Isolation and Characterization of a Histidine Biosynthetic Gene in
... The At-IE cDNA contained an ORF of 843 bp encoding a polypeptide of 281 amino acids with a calculated molecular mass of 31,666 D (Figs. 3 and 4). Nucleotide sequence analysis showed that the consensus motif surrounding a translation initiation codon (AACAATGGC) in plants (Lütcke et al., 1987) was w ...
... The At-IE cDNA contained an ORF of 843 bp encoding a polypeptide of 281 amino acids with a calculated molecular mass of 31,666 D (Figs. 3 and 4). Nucleotide sequence analysis showed that the consensus motif surrounding a translation initiation codon (AACAATGGC) in plants (Lütcke et al., 1987) was w ...
Glucose transport proteins
... lipid bilayer structure. Refer to a standard text book for a review of this. I will emphasize just one important point here; most metabolically active water-soluble materials are effectively hindered from crossing these membranes. Small channels are found in these membranes and these do allow low-mo ...
... lipid bilayer structure. Refer to a standard text book for a review of this. I will emphasize just one important point here; most metabolically active water-soluble materials are effectively hindered from crossing these membranes. Small channels are found in these membranes and these do allow low-mo ...
Slide 1
... high level of annotation (such as the description of the function of a protein, its domains structure, post-translational modifications, variants, etc.) ...
... high level of annotation (such as the description of the function of a protein, its domains structure, post-translational modifications, variants, etc.) ...
ABA-responsive gene expression - Journal of Cell Science
... produce the total number of signatures. Abundance for each distinct signature was counted and normalized in parts per million to estimate transcript abundance. Differences in expression levels were deemed significant when the ratio of the abundances was at least 3 and/or statistically significant at ...
... produce the total number of signatures. Abundance for each distinct signature was counted and normalized in parts per million to estimate transcript abundance. Differences in expression levels were deemed significant when the ratio of the abundances was at least 3 and/or statistically significant at ...
Phosphotyrosine dependent proteinprotein interaction network
... prey matrix (24 strains per pY reader per replica screen; for details, see Materials and Methods). To increase coverage, additional ORFs representing pY readers, for which we did not obtain interactions in the first screen, were screened four times with three kinases (FYN, ABL2, TNK1). In total, the ...
... prey matrix (24 strains per pY reader per replica screen; for details, see Materials and Methods). To increase coverage, additional ORFs representing pY readers, for which we did not obtain interactions in the first screen, were screened four times with three kinases (FYN, ABL2, TNK1). In total, the ...
Exercise 1: SRS
... Determine from the sequences of pancreatic ribonuclease from horse (Equus caballus), minke whale (Balaenoptera acutorostrata) and red kangaroo (Macropus rufus), which two of these species are most closely related. What do you think and what do the sequences tell you? 1. Go to srs.ebi.ac.uk and retr ...
... Determine from the sequences of pancreatic ribonuclease from horse (Equus caballus), minke whale (Balaenoptera acutorostrata) and red kangaroo (Macropus rufus), which two of these species are most closely related. What do you think and what do the sequences tell you? 1. Go to srs.ebi.ac.uk and retr ...
ARF1 and SAR1 GTPases in Endomembrane Trafficking in Plants
... mammalian system. It was also established in the same system that COPI proteins are involved in transport along the endocytic pathway [19,20]. During the selective transport of vesicles, the coat proteins must distinguish between cargo and resident proteins of the donor organelle. In intracellular t ...
... mammalian system. It was also established in the same system that COPI proteins are involved in transport along the endocytic pathway [19,20]. During the selective transport of vesicles, the coat proteins must distinguish between cargo and resident proteins of the donor organelle. In intracellular t ...
Slide 1
... Gene expression Genetic information to protein synthesis Gene presence vs. gene expression ...
... Gene expression Genetic information to protein synthesis Gene presence vs. gene expression ...
Retrieving data from UniProt databases Further reading Support
... (EBI), the Swiss Institute of Bioinformatics (SIB) and the Georgetown University Medical Center's Protein Information Resource (PIR). UniProt comprises three components: ...
... (EBI), the Swiss Institute of Bioinformatics (SIB) and the Georgetown University Medical Center's Protein Information Resource (PIR). UniProt comprises three components: ...
selection of antigens for antibody-based proteomics
... localizations of most proteins are still unknown. Antibody-based proteomics has great potential for exploration of the protein complement of the human genome, but there are antibodies only to a very limited set of proteins. The Human Proteome Resource (HPR) project was launched in August 2003, with ...
... localizations of most proteins are still unknown. Antibody-based proteomics has great potential for exploration of the protein complement of the human genome, but there are antibodies only to a very limited set of proteins. The Human Proteome Resource (HPR) project was launched in August 2003, with ...
Interaction of Graphene Oxide with Proteins and
... applications due to their in vitro and in vivo biocompatibility, low impact on the environment, structural features, large surface area, low cost, and facile chemical processing. GO based materials have shown the potential applications in drug and gene delivery, near-infrared photothermal treatment ...
... applications due to their in vitro and in vivo biocompatibility, low impact on the environment, structural features, large surface area, low cost, and facile chemical processing. GO based materials have shown the potential applications in drug and gene delivery, near-infrared photothermal treatment ...
A spectrum of genes expressed during early stages of rice... flower development
... also amenable to global sequence analysis. For a fraction of the rice and Arabidopsis genes, a probable function has been assigned on the basis of sequence similarity to previously studied genes from other systems. Apart from sequence similarity, function can be hypothesized from RNA and protein syn ...
... also amenable to global sequence analysis. For a fraction of the rice and Arabidopsis genes, a probable function has been assigned on the basis of sequence similarity to previously studied genes from other systems. Apart from sequence similarity, function can be hypothesized from RNA and protein syn ...
to get the file - Chair of Computational Biology
... messenger that is important in many biological processes. cAMP is derived from ATP and used for intracellular signal transduction in many different organisms, conveying the cAMP dependent pathway. In humans, cyclic AMP works by activating cAMPdependent protein kinase. Cyclic AMP binds to specific lo ...
... messenger that is important in many biological processes. cAMP is derived from ATP and used for intracellular signal transduction in many different organisms, conveying the cAMP dependent pathway. In humans, cyclic AMP works by activating cAMPdependent protein kinase. Cyclic AMP binds to specific lo ...
Preparation of recombinant proteins in milk to improve human and
... than ruminants to perform some posttranslational modifications as judged by the examination of a few proteins such as human protein C [36] and human protein C inhibitor [33]. This is particularly the case for glycosylation. Rabbits add almost quantitatively sialic acid under the NANA form (N-acetyln ...
... than ruminants to perform some posttranslational modifications as judged by the examination of a few proteins such as human protein C [36] and human protein C inhibitor [33]. This is particularly the case for glycosylation. Rabbits add almost quantitatively sialic acid under the NANA form (N-acetyln ...
Approach To A Case Of Anasarca
... increase in the interstitial fluid volume, which may expand by several liters before the abnormality is evident ...
... increase in the interstitial fluid volume, which may expand by several liters before the abnormality is evident ...
A golden fish reveals pigmentation loss in Europeans Data Activity
... Genetic origin of golden mutant zebrafish DNA or RNA sequences can be changed in many different ways. Some common types of mutations are single base pair changes (for example from A to T or C to G), insertions of additional nucleotides, or deletions (removal) of existing nucleotides. Parts of a gene ...
... Genetic origin of golden mutant zebrafish DNA or RNA sequences can be changed in many different ways. Some common types of mutations are single base pair changes (for example from A to T or C to G), insertions of additional nucleotides, or deletions (removal) of existing nucleotides. Parts of a gene ...
here - PHI-base
... Unaffected pathogenicity - the transgenic strain which expresses no or reduced levels of a specific gene product(s) has wild-type disease causing ability Increased virulence (Hypervirulence) - the transgenic strain causes higher levels of disease than the wild-type strain Effector (plant avirulence ...
... Unaffected pathogenicity - the transgenic strain which expresses no or reduced levels of a specific gene product(s) has wild-type disease causing ability Increased virulence (Hypervirulence) - the transgenic strain causes higher levels of disease than the wild-type strain Effector (plant avirulence ...
CHARACTERIZATION OF MOCR, A GNTR TRANSCRIPTIONAL
... nodules and fixing nitrogen when in a symbiosis with the leguminous soybean plant (Glycine max). Although these metabolite-responsive gntR genes have been found to be involved in many cellular processes, little is known about their role in the B. japonicum-soybean symbiosis. The blr6977 gene (mocR), ...
... nodules and fixing nitrogen when in a symbiosis with the leguminous soybean plant (Glycine max). Although these metabolite-responsive gntR genes have been found to be involved in many cellular processes, little is known about their role in the B. japonicum-soybean symbiosis. The blr6977 gene (mocR), ...
Characterization and transcript mapping of a bovine herpesvirus
... by Sambrook et al. (1989) using the oligonucleotide 5' GCCCATCCCTAGCGGCGTCCATGGC 3', encompassing the translation initiation codon of the VP8 gene coding sequences. Briefly, the oligonucleotide was radiolabelled with [~,-32p]ATPand T4 kinase, and then annealed with 10 /ag of total RNA extracted eith ...
... by Sambrook et al. (1989) using the oligonucleotide 5' GCCCATCCCTAGCGGCGTCCATGGC 3', encompassing the translation initiation codon of the VP8 gene coding sequences. Briefly, the oligonucleotide was radiolabelled with [~,-32p]ATPand T4 kinase, and then annealed with 10 /ag of total RNA extracted eith ...
lecture 8
... but recent study shows only a portion of those are completely chaperonin-dependent Belongs to so-called Group I chaperonins which includes evolutionarily-related bacterial GroEL, mitochondrial Hsp60, and chloroplast Rubisco subunit-binding protein (Rubisco is most abundant protein on earth and req ...
... but recent study shows only a portion of those are completely chaperonin-dependent Belongs to so-called Group I chaperonins which includes evolutionarily-related bacterial GroEL, mitochondrial Hsp60, and chloroplast Rubisco subunit-binding protein (Rubisco is most abundant protein on earth and req ...
Initiation of Innate Immune Responses in the
... cuticle proPOs of the silkworm, Bombyx mori have been characterized and one of them is shown to be transported from the hemolymph proPO to the cuticle. The transported cuticle proPO has different molecular mass from the hemolymph proPO because of the modification of one up to six methionine residue( ...
... cuticle proPOs of the silkworm, Bombyx mori have been characterized and one of them is shown to be transported from the hemolymph proPO to the cuticle. The transported cuticle proPO has different molecular mass from the hemolymph proPO because of the modification of one up to six methionine residue( ...
Protein moonlighting
Protein moonlighting (or gene sharing) is a phenomenon by which a protein can perform more than one function. Ancestral moonlighting proteins originally possessed a single function but through evolution, acquired additional functions. Many proteins that moonlight are enzymes; others are receptors, ion channels or chaperones. The most common primary function of moonlighting proteins is enzymatic catalysis, but these enzymes have acquired secondary non-enzymatic roles. Some examples of functions of moonlighting proteins secondary to catalysis include signal transduction, transcriptional regulation, apoptosis, motility, and structural.Protein moonlighting may occur widely in nature. Protein moonlighting through gene sharing differs from the use of a single gene to generate different proteins by alternative RNA splicing, DNA rearrangement, or post-translational processing. It is also different from multifunctionality of the protein, in which the protein has multiple domains, each serving a different function. Protein moonlighting by gene sharing means that a gene may acquire and maintain a second function without gene duplication and without loss of the primary function. Such genes are under two or more entirely different selective constraints.Various techniques have been used to reveal moonlighting functions in proteins. The detection of a protein in unexpected locations within cells, cell types, or tissues may suggest that a protein has a moonlighting function. Furthermore, sequence or structure homology of a protein may be used to infer both primary function as well as secondary moonlighting functions of a protein.The most well-studied examples of gene sharing are crystallins. These proteins, when expressed at low levels in many tissues function as enzymes, but when expressed at high levels in eye tissue, become densely packed and thus form lenses. While the recognition of gene sharing is relatively recent—the term was coined in 1988, after crystallins in chickens and ducks were found to be identical to separately identified enzymes—recent studies have found many examples throughout the living world. Joram Piatigorsky has suggested that many or all proteins exhibit gene sharing to some extent, and that gene sharing is a key aspect of molecular evolution. The genes encoding crystallins must maintain sequences for catalytic function and transparency maintenance function.Inappropriate moonlighting is a contributing factor in some genetic diseases, and moonlighting provides a possible mechanism by which bacteria may become resistant to antibiotics.