That Impairs Th1-Type Immunity Down
... by bacillus Calmette-Guérin, the TB vaccine bacillus (30). The current literature suggests that the inflammatory response of macrophages is terminated in part by several intracellular regulators, including IL receptor-associated kinase M (IRAK-M) and SOCS (28, 31, 32). IRAK-M dampens TLR signaling, ...
... by bacillus Calmette-Guérin, the TB vaccine bacillus (30). The current literature suggests that the inflammatory response of macrophages is terminated in part by several intracellular regulators, including IL receptor-associated kinase M (IRAK-M) and SOCS (28, 31, 32). IRAK-M dampens TLR signaling, ...
improving methodological strategies for satellite cells counting in
... Satellite cells are relatively rare structures, probably evenly distributed along individual muscle fibres, but more concentrated within end plate regions. When activated they enter the mytotic cycle, proliferate and fuse either with each other or with the existing muscle fibres. The main function o ...
... Satellite cells are relatively rare structures, probably evenly distributed along individual muscle fibres, but more concentrated within end plate regions. When activated they enter the mytotic cycle, proliferate and fuse either with each other or with the existing muscle fibres. The main function o ...
Nuclear centering in Spirogyra
... upon distal branching of the stalks (Fig. 5B,D). Tubulin immuno¯uorescence was evenly spread over the convex side of the lens-shaped nucleus. Eects of cytoskeletal inhibitors on the structural integrity of the PNS. Cytochalasin D (2 ´ 10)5 mol á l)1) reversibly inhibited the transportation of small ...
... upon distal branching of the stalks (Fig. 5B,D). Tubulin immuno¯uorescence was evenly spread over the convex side of the lens-shaped nucleus. Eects of cytoskeletal inhibitors on the structural integrity of the PNS. Cytochalasin D (2 ´ 10)5 mol á l)1) reversibly inhibited the transportation of small ...
Full-Text PDF
... and HSV-1 appear to have a role during this process as deletion of the US3 gene resulted in the accumulation of virus particles in the perinuclear space and significantly reduced virus titers [18–20]. It has been shown that pUS3 is necessary for the homogenous distribution of the primary tegument an ...
... and HSV-1 appear to have a role during this process as deletion of the US3 gene resulted in the accumulation of virus particles in the perinuclear space and significantly reduced virus titers [18–20]. It has been shown that pUS3 is necessary for the homogenous distribution of the primary tegument an ...
Chapter 2 The Microsporangium and the Pollen Grain
... Tapetum Before and During Meiosis. In Avena the newly formed tapetal cells show plasmodesmatal connections between the adjacent cells, and also between the sporogenous cells. Microtubules run parallel to the long axis of anther along the tangential walls and tangentially or radially along the radia ...
... Tapetum Before and During Meiosis. In Avena the newly formed tapetal cells show plasmodesmatal connections between the adjacent cells, and also between the sporogenous cells. Microtubules run parallel to the long axis of anther along the tangential walls and tangentially or radially along the radia ...
PDF
... few of these genes are the same as the genes expressed during sporulation in S. cerevisiae (Mata et al., 2002). This observation suggests that in addition to meiotic processes conserved across eukaryotes, sporulation, including meiosis, involves processes that are more evolutionarily divergent and r ...
... few of these genes are the same as the genes expressed during sporulation in S. cerevisiae (Mata et al., 2002). This observation suggests that in addition to meiotic processes conserved across eukaryotes, sporulation, including meiosis, involves processes that are more evolutionarily divergent and r ...
Prey Food Quality Affects Flagellate Ingestion Rates | SpringerLink
... Bacterial abundance was determined by direct epifluorescent microscopic enumeration (1250) of formaldehyde-preserved (2% final concentration) samples using DAPI as the fluorochrome [51]. Cell volume (V) was determined from length and width of at least 100 cells according to the formula: V ¼ ½ðð0:5 ...
... Bacterial abundance was determined by direct epifluorescent microscopic enumeration (1250) of formaldehyde-preserved (2% final concentration) samples using DAPI as the fluorochrome [51]. Cell volume (V) was determined from length and width of at least 100 cells according to the formula: V ¼ ½ðð0:5 ...
Yersinia pestis targets neutrophils via complement receptor 3
... cells in a process that involves assembly of a needle-like structure on the bacterial surface (Buttner, 2012). The pathogenic Yersinia species (Y. pestis, Y. pseudotuberculosis and Y. enterocolitica) rely on a plasmid-encoded T3SS to deliver a suite of effectors, known as Yops, into immune cells (De ...
... cells in a process that involves assembly of a needle-like structure on the bacterial surface (Buttner, 2012). The pathogenic Yersinia species (Y. pestis, Y. pseudotuberculosis and Y. enterocolitica) rely on a plasmid-encoded T3SS to deliver a suite of effectors, known as Yops, into immune cells (De ...
Do Bacteria have Mitotic Spindles, Fusion Tubes and
... I have often drawn attention to the errors of interpretation which may arise from failure to recognize that many bacteria are divided into numerous, small cells by cross-walls and septa (Bisset, 1948a, b, 1950, 1951a, 1952a, b ) . This is especially true of Bacillus and Mycobacterium. These observat ...
... I have often drawn attention to the errors of interpretation which may arise from failure to recognize that many bacteria are divided into numerous, small cells by cross-walls and septa (Bisset, 1948a, b, 1950, 1951a, 1952a, b ) . This is especially true of Bacillus and Mycobacterium. These observat ...
Mercuric Conjugates of Cysteine Are Transported by the Amino Acid
... cystine) or amino acids that are not transportable substrates of system b0,⫹ (glutamate or aspartate). With the exception of cystine, all amino acids were used at a concentration of 3 mM. Because of low solubility, the highest attainable concentration of cystine was 1 mM. In addition, 5 M Hg2⫹ (as ...
... cystine) or amino acids that are not transportable substrates of system b0,⫹ (glutamate or aspartate). With the exception of cystine, all amino acids were used at a concentration of 3 mM. Because of low solubility, the highest attainable concentration of cystine was 1 mM. In addition, 5 M Hg2⫹ (as ...
4-3. Cell wall structure of E. coli and B. subtilis
... Figure 2. Spore peptidoglycan (cortex) structure of B. subtilis. δ indicates the deltalactam structure, which is a unique structure of the cortex. Numbers are the same as those shown in the legend to Fig. 1. ...
... Figure 2. Spore peptidoglycan (cortex) structure of B. subtilis. δ indicates the deltalactam structure, which is a unique structure of the cortex. Numbers are the same as those shown in the legend to Fig. 1. ...
The sigA gene encoding the major G factor of RNA polymerase from
... reaction. The oligonucleotide used was 5’ CGCTTGGGTCATGCCTATTTCCTC 3’ (complementary to nt 923-946 in Fig. 3). The primer extension product was denatured and subjected to electrophoresis on a standard DNA sequencing gel alongside DNA sequencing ladders generated using the same primer on a plasmid te ...
... reaction. The oligonucleotide used was 5’ CGCTTGGGTCATGCCTATTTCCTC 3’ (complementary to nt 923-946 in Fig. 3). The primer extension product was denatured and subjected to electrophoresis on a standard DNA sequencing gel alongside DNA sequencing ladders generated using the same primer on a plasmid te ...
Molecular differences between the rostral and caudal halves of the
... Although the mannose-specificity of ConA was not tested by competition with the appropriate carbohydrate, the specificity was confirmed by its binding to the molecular weight standard that contained mannose (ovalbumin; Mr = 46xl(r). Non-carbohydrate-containing protein standards did not bind ConA. Re ...
... Although the mannose-specificity of ConA was not tested by competition with the appropriate carbohydrate, the specificity was confirmed by its binding to the molecular weight standard that contained mannose (ovalbumin; Mr = 46xl(r). Non-carbohydrate-containing protein standards did not bind ConA. Re ...
Quantitative Changes in Microtubule Distribution Correlate with
... background. This was accomplished by drawing curved transects down the middle of the longitudinal axis of each cell to sample most microtubule structures on an orthogonal axis (Figure 5A, from a guard cell from an open stoma), then using these transects to re-slice the volume along the z-axis to cre ...
... background. This was accomplished by drawing curved transects down the middle of the longitudinal axis of each cell to sample most microtubule structures on an orthogonal axis (Figure 5A, from a guard cell from an open stoma), then using these transects to re-slice the volume along the z-axis to cre ...
Antimicrobial Agents and Chemotherapy
... Peptidoglycan synthesis in vivo. Peptidoglycan synthesis in vivo was followed in a modification of the wall medium CWSM-I (12) containing 10 ,ug of L-alanine per ml instead of 5 ,ug per ml. The medium was supplemented with glycine (100 ,ug/ml) when S. aureus was used. If necessary, antibiotics were ...
... Peptidoglycan synthesis in vivo. Peptidoglycan synthesis in vivo was followed in a modification of the wall medium CWSM-I (12) containing 10 ,ug of L-alanine per ml instead of 5 ,ug per ml. The medium was supplemented with glycine (100 ,ug/ml) when S. aureus was used. If necessary, antibiotics were ...
Introduction to Endocrinology
... The receptor proteins themselves are often inactivated or destroyed during the course of their function, and at other times they are reactivated or new ones are manufactured by the protein-manufacturing mechanism of the cell. For instance, increased hormone concentration and increased binding with i ...
... The receptor proteins themselves are often inactivated or destroyed during the course of their function, and at other times they are reactivated or new ones are manufactured by the protein-manufacturing mechanism of the cell. For instance, increased hormone concentration and increased binding with i ...
Redox regulation of cysteine
... will, either spontaneously or through a catalyzed reaction with superoxide dismutase, decompose to peroxide (Pacher et al., 2007). Although debatable, it is through the formation of peroxide and other metabolic products that superoxide likely exerts its effects on the cell. Nitric oxide, also known ...
... will, either spontaneously or through a catalyzed reaction with superoxide dismutase, decompose to peroxide (Pacher et al., 2007). Although debatable, it is through the formation of peroxide and other metabolic products that superoxide likely exerts its effects on the cell. Nitric oxide, also known ...
Potentiometric measurement of intracellular redox activity.
... To implement the potentiometric method mentioned above, we have used a modified Cytosensor microphysiometer. The essential features of the microphysiometer system are that it allows a moderate number of cells (≈105) to be trapped in a small volume (≈10 µL) that is in contact with electrodes. In addi ...
... To implement the potentiometric method mentioned above, we have used a modified Cytosensor microphysiometer. The essential features of the microphysiometer system are that it allows a moderate number of cells (≈105) to be trapped in a small volume (≈10 µL) that is in contact with electrodes. In addi ...
effeot of moisture stress on submicrosoopic struoture of maize roots
... of endoplasmic reticulum and number of golgi bodies seems to be a result of starvation, as this did not occur if the root segments were kept in the nutrient medium. All the other changes described above appear to be true drought-induced phenomena. In all the experiments described above, fixation was ...
... of endoplasmic reticulum and number of golgi bodies seems to be a result of starvation, as this did not occur if the root segments were kept in the nutrient medium. All the other changes described above appear to be true drought-induced phenomena. In all the experiments described above, fixation was ...
Translocation of proteins across archaeal cytoplasmic membranes
... conserved SRP. The information required for targeting in both modes of translocation is encoded in the signal sequence, located in the extreme N-terminus of the preprotein. 2.1.1. Sec signal sequences and their signal peptidases Signal sequences of Sec substrates fall into three categories (Fig. 1(a ...
... conserved SRP. The information required for targeting in both modes of translocation is encoded in the signal sequence, located in the extreme N-terminus of the preprotein. 2.1.1. Sec signal sequences and their signal peptidases Signal sequences of Sec substrates fall into three categories (Fig. 1(a ...
A TUrBO SWITCH SpEEdS Up A CRUCIAL CALCIUM PUMP
... such as changes in cell activity or cell division. Calcium signalling derives from the 20.000-fold gradient between the high concentration outside the cells and the low intracellular level. For example, during signalling or under stress the calcium concentration inside the cells increases due to ope ...
... such as changes in cell activity or cell division. Calcium signalling derives from the 20.000-fold gradient between the high concentration outside the cells and the low intracellular level. For example, during signalling or under stress the calcium concentration inside the cells increases due to ope ...
The cortical cytoskeletal network and cell-wall
... cell cortex (Van Damme, 2009; Muller, 2012). If the PPB is altered through pharmacological or genetic means, subsequent division processes are significantly altered, which in turn lead to profound changes in thallus morphogenesis (Azimzadeh et al., 2008; Wright et al., 2009; Spinner et al., 2010). T ...
... cell cortex (Van Damme, 2009; Muller, 2012). If the PPB is altered through pharmacological or genetic means, subsequent division processes are significantly altered, which in turn lead to profound changes in thallus morphogenesis (Azimzadeh et al., 2008; Wright et al., 2009; Spinner et al., 2010). T ...
Bacteriophages and Their Structural Organisation
... by dsDNA genomes and by the common overall organisation of the virus particles characterized by a capsid and a tail (Figure 3). Different phage species can vary both in size from 24-400 nm in length and genome length. Their DNA sequences differ significantly and can range in the size from 18 to 400 ...
... by dsDNA genomes and by the common overall organisation of the virus particles characterized by a capsid and a tail (Figure 3). Different phage species can vary both in size from 24-400 nm in length and genome length. Their DNA sequences differ significantly and can range in the size from 18 to 400 ...
Blood Stem Cell Activity Is Arrested by Th1
... from clinical studies performed in the 1980s in which BM allografts were depleted of T cells to reduce the complication of graftversus-host disease (GVHD), but were associated with increased engraftment failures (28–30). In retrospect, these failures may have been caused in part by reduced progenito ...
... from clinical studies performed in the 1980s in which BM allografts were depleted of T cells to reduce the complication of graftversus-host disease (GVHD), but were associated with increased engraftment failures (28–30). In retrospect, these failures may have been caused in part by reduced progenito ...
Diverse Effects of Mutations in the Signal Sequence on the Secretion of b-lactamase in Salmonella typhimurium.
... synthesized by the remaining mutants resemble wild-type in that they remain trypsin-inaccessible. One of the latter mutants does produce mature protein, but at a very reduced rate. It thus appears that signalsequence mutations can affect more than one step in the secretion process, and that processi ...
... synthesized by the remaining mutants resemble wild-type in that they remain trypsin-inaccessible. One of the latter mutants does produce mature protein, but at a very reduced rate. It thus appears that signalsequence mutations can affect more than one step in the secretion process, and that processi ...