Download That Impairs Th1-Type Immunity Down

Tuberculosis Is Associated with a
Down-Modulatory Lung Immune Response
That Impairs Th1-Type Immunity
This information is current as
of June 15, 2017.
Alexandre S. Almeida, Patrícia M. Lago, Neio Boechat,
Richard C. Huard, Luiz C. O. Lazzarini, Adalberto R.
Santos, Marcelo Nociari, Hongxia Zhu, Beatriz M.
Perez-Sweeney, Heejung Bang, Quanhong Ni, Jie Huang,
Andrea L. Gibson, Vera C. Flores, Lorena R. Pecanha,
Afrânio L. Kritski, José R. Lapa e Silva and John L. Ho
Supplementary
Material
References
Subscription
Permissions
Email Alerts
http://www.jimmunol.org/content/suppl/2009/06/18/jimmunol.080121
2.DC1
This article cites 77 articles, 41 of which you can access for free at:
http://www.jimmunol.org/content/183/1/718.full#ref-list-1
Information about subscribing to The Journal of Immunology is online at:
http://jimmunol.org/subscription
Submit copyright permission requests at:
http://www.aai.org/About/Publications/JI/copyright.html
Receive free email-alerts when new articles cite this article. Sign up at:
http://jimmunol.org/alerts
The Journal of Immunology is published twice each month by
The American Association of Immunologists, Inc.,
1451 Rockville Pike, Suite 650, Rockville, MD 20852
Copyright © 2009 by The American Association of
Immunologists, Inc. All rights reserved.
Print ISSN: 0022-1767 Online ISSN: 1550-6606.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
J Immunol 2009; 183:718-731; Prepublished online 17 June
2009;
doi: 10.4049/jimmunol.0801212
http://www.jimmunol.org/content/183/1/718
The Journal of Immunology
Tuberculosis Is Associated with a Down-Modulatory Lung
Immune Response That Impairs Th1-Type Immunity1
Alexandre S. Almeida,2*† Patrícia M. Lago,2* Neio Boechat,* Richard C. Huard,†§
Luiz C. O. Lazzarini,*† Adalberto R. Santos,¶ Marcelo Nociari,† Hongxia Zhu,†
Beatriz M. Perez-Sweeney,† Heejung Bang,‡ Quanhong Ni,‡ Jie Huang,† Andrea L. Gibson,†
Vera C. Flores,*† Lorena R. Pecanha,* Afrânio L. Kritski,* José R. Lapa e Silva,3*†
and John L. Ho3*
M
ycobacterium tuberculosis, the etiologic agent of tuberculosis (TB),4 is estimated to infect one-third of the
world’s population and annually causes ⬃8 million
new TB cases and ⬎2 million deaths (1, 2). The challenge of TB
*Institute of Thoracic Diseases and Clementino Fraga Filho University Hospital of
Federal University of Rio de Janeiro, Rio de Janeiro, Brazil; †Division of International
Medicine and Infectious Disease, Department of Medicine and ‡Division of Biostatistics and Epidemiology, Department of Public Health, Weill Medical College of
Cornell University, New York, NY 10021; §Clinical Microbiology Service, New
York-Presbyterian Hospital, Columbia University Medical Center, New York, NY
10032; and ¶Laboratory of Molecular Biology Applied to Mycobacteria, Oswaldo
Cruz Institute, Rio de Janeiro, Brazil
Received for publication April 30, 2008. Accepted for publication May 3, 2009.
The costs of publication of this article were defrayed in part by the payment of page
charges. This article must therefore be hereby marked advertisement in accordance
with 18 U.S.C. Section 1734 solely to indicate this fact.
1
Funding for this study was provided by National Institutes of Health (NIH) Grants
R01 HL61960, R21 AI063147, and R21 AI063147 (to J.L.H.), NIH Fogarty International Center Training Grant (FICTG) D43 TW00018 under the AIDS International
Training and Research Program (to Warren D. Johnson and J.L.H.), ICOHRTA
AIDS/TB 5 U2R TW006883 (to J.R.L.e.S.), and grants from the Coordenação de
Aperfeicoamento de Pessoal de Nivel Superior, Ministry of Education-Brazil, the
Brazilian Research Council/Conselho Nacional de Desenvolvimento Científico e Tecnológico (CNPq), the Brazilian Research Council/World Bank Millennium Institute
of Science, Programa de Apoio a Núcleos de Excelência (to J.R.L.e.S. and A.L.K.),
and the Laura Cook Hull Trust Fund (LCHTF) (to W.D.J.). R.C.H., H.Z., and A.L.G.
were supported by LCHTF as well as Grants R21 AI063147 and R21 AI063147,
L.C.O.L. was supported by CNPq, and A.S.A. was a FICTG trainee. Completion of
this study contributed to the Ph.D. requirements of A.S.A.
2
A.S.A. and P.M.L. contributed equally to this work.
3
Address correspondence and reprint requests to Dr. John L. Ho, Division of International Medicine and Infectious Disease, Weill Medical College of Cornell University, 1300 York Avenue, Room A-421, New York, NY 10021. E-mail address:
[email protected] or Dr. José Roberto Lapa e Silva, Laboratório Multidisplinar de Pesquisa, Universidade Federal do Rio de Janeiro, Avenida Prof. Rodolpho Paulo Rocco 255, 21941-590 Rio de Janeiro, Rio de Janeiro, Brazil. E-mail
address: [email protected]
www.jimmunol.org/cgi/doi/10.4049/jimmunol.0801212
is worsened by the emergence of multiple and extensively drugresistant strains. Once infected, the majority of individuals harbor
latent M. tuberculosis that persists for years or decades before the
bacillus is reactivated, leading to active TB at some point in later
life (2). Those with cellular immune defects are especially at risk
for active TB. As such, depletion of CD4⫹ T cells stemming from
HIV coinfection increases the risk for active TB from ⬃7% lifetime risk to a 10% annual risk (1). It is now clear that coordination/
cooperation between the various cellular elements, especially the
macrophages and T lymphocytes, are critical for the control of M.
tuberculosis (reviewed in Refs. 3 and 4). However, the factors
mediating active TB or latency following M. tuberculosis infection
remain poorly defined.
The local cytokine milieu, cellular receptors, and the transduction of receptor signals that modulate T cell and macrophage functions are thought to be important for the development of
counter-M. tuberculosis immune responses (3– 6). In that microenvironment, IL-2, IFN-␥, IL-12, and IL-23 cytokines (reviewed
in Refs. 5 and 6) are thought to play a significant role in defense
against M. tuberculosis in humans, and elevated mRNA and protein levels of some of these cytokines or their effector molecules
are often correlated with better anti-M. tuberculosis immune responses (7, 8). Indeed, genetic alteration in some of these cytokine
receptors or receptor signal transducers is linked to increased risk
4
Abbreviations used in this paper: TB, tuberculosis; BAL, bronchoalveolar lavage;
GEE, generalized estimating equation; HCW, healthcare worker; IL-1Rn, IL-1R antagonist; IRAK-M, IL-receptor-associated kinase M: NEMO, NF-␬B essential modulator I␬B kinase ␥; NOS, NO synthase; OLD, other lung disease; SOCS, suppressor
of cytokine signaling; TGF-␤RI, TGF-␤ receptor type I; TGF-␤RII, TGF-␤ receptor
type II; IDO, indoleamine 2,3-dioxygenase.
Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Immune mediators associated with human tuberculosis (TB) remain poorly defined. This study quantified levels of lung immune
mediator gene expression at the time of diagnosis and during anti-TB treatment using cells obtained by induced sputum. Upon
comparison to patients with other infectious lung diseases and volunteers, active pulmonary TB cases expressed significantly
higher levels of mediators that counteract Th1-type and innate immunity. Despite the concomitant heightened levels of Th1-type
mediators, immune activation may be rendered ineffectual by high levels of intracellular (SOCS and IRAK-M) and extracellular
(IL-10 and TGF-␤RII, IL-1Rn, and IDO) immune suppressive mediators. These modulators are a direct response to Mycobacterium tuberculosis as, by day 30 of anti-TB treatment, many suppressive factors declined to that of controls whereas most
Th1-type and innate immune mediators rose above pretreatment levels. Challenge of human immune cells with M. tuberculosis in
vitro up-regulated these immune modulators as well. The observed low levels of NO synthase-2 produced by alveolar macrophages
at TB diagnosis, along with the heightened amounts of suppressive mediators, support the conclusion that M. tuberculosis actively
promotes down-modulatory mediators to counteract Th1-type and innate immunity as an immunopathological strategy. Our data
highlight the potential application of immune mediators as surrogate markers for TB diagnosis or treatment response. The
Journal of Immunology, 2009, 183: 718 –731.
The Journal of Immunology
719
Table I. Primer sets used for the real-time PCR assays
PCR Size
Observations
GAPDH
For: GAGTCAACGGATTTGGTCGT
Rev: AAATGAGCCCCAGCCTTCT
For: CCCCCAGAGGGAAGAGTTC
Rev: GAGGGTTTGCTACAACATGG
For: GAGAACAGCTGCACCCACTT
Rev: ACAGCGCCGTAGCCTCAG
For: ATGCTCCAGAAGGCCAGAC
Rev: TCTGGAATTTAGGCAACTCTCA
For: GCATCGTTTTGGGTTCTCTT
Rev: CAGTTACCGAATAATTAGTCAGCTTTT
For: CGACGGCGTTACAGTGTTT
Rev: AAACCTGAGCCAGAACCTGA
For: GCACGTTCAGAAGTCGGTTA
Rev: CGTCATTCTTTCTCCATACAGC
For: GCCTTCAGAATCTGGGATGT
Rev: CAGCTGGAGTCTGGTCTCATC
For: CACCTCTCCTGGTTGGAAAA
Rev: AGCAGTAGGTCAGGCAGCAT
For: GCCACCTACTGAACCCTCCT
Rev: ACGGTCTTCCGACAGAGATG
For: AGAGCTTCGACTGCCTCTTC
Rev: AGGGGAAGGAGCTCAGGTAG
For: GTCTTGGGGGTCATCATCAG
Rev: TCCTGTTGTTGGACAGGTCA
For: GGCCTGGCAGAGAGACTTT
Rev: TGAATAGCTCGACGATGTCC
For: CTGCTCTCTGGTGCTGCTC
Rev: CGGCCCATATACTTGGAATG
For: CCTGGAGAAATGGTGGTCCT
Rev: GCTTAGAACCTCGCCTCCTT
For: AAGGCCCAGGCGGATATCTA
Rev: ATCCTGGCCGACTCCTGAC
For: GCCAAATCCACAGGAAAATC
Rev: GGCAAGACCTTACGGACATC
For: TGGGACACATGGATCTAAGAGA
Rev: TGCAAGCAGAACTGACTGTTG
For: GCCCCTCCCAGTTCTAGTTC
Rev: CTTCTGGGCCACTGACTGAT
316 bp
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 4-5
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 3-4
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 4-5
Exon-exon junction on one side
Forward: exons 2-3; Reverse: exon 4
Exon-exon junction on one side
Forward: exon 1; Reverse: exons 3-4
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 3-4
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 2-3
Exon-exon junction covered on both sides
Forward: exons 3-4; Reverse: exons 5-6
Exon-exon junction on one side
Forward: exon 3; Reverse: exons 4-5
Only inside the exon region
Forward: exon 1; Reverse: exon 1
Only inside the exon region
Forward: exon 1; Reverse: exon 1
Only inside the exon region
Forward: exon 1; Reverse: exon 1
Exon-exon junction on one side
Forward: exons 1-2; Reverse: exon 2
Exon-exon junction on one side
Forward: exons 2-3; Reverse: exon 3
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 2-3
Exon-exon junction covered on both sides
Forward: exons 6-7; Reverse: exons 7-8
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 3-4
Exon-exon junction covered on both sides
Forward: exons 1-2; Reverse: exons 2-3
Genomic DNA control
TNF-␣
IL-10
IL-12p35
IFN-␥
TGF-␤RI
TGF-␤RII
IL-1RN
CD80
SOCS3
SOCS1
TLR2
IRAK-M
CD86
IL-12p40
NEMO
IDO
IL-23p19
TNF-␣ intronic
a
119 bp
300 bp
150 bp
336 bp
487 bp
200 bp
207 bp
286 bp
177 bp
201 bp
163 bp
173 bp
200 bp
171 bp
155 bp
237 bp
121 bp
170 bp
For, Forward; Rev, reverse.
for mycobacterial disease (5, 6). IFN-␥ mediates its protective effect in mice predominantly by the up-regulation of macrophage
NO synthase (NOS) 2, an enzyme that produces NO and is involved in the killing of tubercle bacilli (3, 4), a concept supported
by unrestricted M. tuberculosis growth in IFN-␥ or NOS2 gene
knockout mice (3, 4). In humans, NOS2 transcripts, protein, and
activity have been detected in the alveolar macrophages from active TB patients (9, 10), and NO contributes to the killing of tubercle bacilli in vitro (11). Despite the above observations, however, the preferred intracellular niche of M. tuberculosis remains
the hostile phagolysosome of the alveolar macrophage (3, 4). It is
postulated that the suppressed responses to M. tuberculosis Ags in
active TB (12, 13) involves a suboptimal Th1-type response and
ineffective macrophage activation.
M. tuberculosis may avoid sterilizing immunity and promote
active disease through the exploitative induction of immunosuppressive cytokines that counteract activation by IL-2 and IFN-␥.
Two such deactivators of the immune response in TB are IL-10
and TGF-␤, which to varying degrees inhibit T cell proliferation,
differentiation, and the production of IL-2 and IFN-␥, thus antagonizing IFN-␥-mediated macrophage activation and the killing of
ingested microorganisms (14, 15), as well as inhibiting early mycobacterial clearance through the attenuation of antimycobacterial
immunity (16, 17). In our previous study, we reported that the
bronchoalveolar lavage (BAL) cells of TB patients were significantly more likely than patients with other lung diseases (OLD) to
coexpress IL-10 and TGF-␤ receptor type I (TGF-␤RI) and receptor type II (TGF-␤RII) mRNA. The BAL fluid of TB patients also
contained significantly more IL-10 and bioactive TGF-␤. In contrast, IFN-␥ and IL-2 were seen in both TB and OLD patients (18).
Intersecting studies of TGF-␤ and IL-10 suggest that they impair
macrophage activation in part by inhibiting IFN-␥-induced NO
synthesis (19, 20). These data further support the supposition that
the combined production of the immunosuppressants acts to downmodulate host anti-M. tuberculosis immunity and thereby allow
uncontrolled bacterial replication and overt disease.
We sought additional host mediators not previously evaluated in
TB patients that may act to counter protective Th1-type and innate
immune response. Promotion of other extracellular suppressors such
as a natural IL-1R antagonist (IL-1Rn) or IDO could limit IL-1 availability and reduce Th cell proliferation (21, 22) or inhibit Th1-type
immunity and induce T cell tolerance (23–25), respectively. The clinical use of IL-1Rn for autoimmune disease treatments and the increasing levels of IDO observed in infectious and allergic diseases associated with a Th2-type bias support the possibility that both mediators
may counter Th1-type immunity (21, 26, 27). Several novel intracellular mediators have recently emerged as key physiological regulators
of cytokine and innate immune responses that may dampen Th1-type
immunity. The suppressor of cytokine signaling (SOCS) gene family,
for instance, encodes intracellular proteins that negatively regulate
IFN-␥, IL-12, IL-23, and IL-6 receptor signaling and cell activation,
thereby promoting a Th2-type immune bias (28, 29). Importantly,
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Sequences (5⬘3-3⬘)a
Primer
720
PREDOMINANCE OF DOWN-MODULATORY LUNG IMMUNE RESPONSES IN TB
Table II. Demographic, clinical, and laboratory data of all subjects at the time of diagnosisa
Clinical Characteristics
TB (n ⫽ 30)
OLD (n ⫽ 11)
HCW (n ⫽ 16)
p Value
Age in years, median (mean ⫾ SD)
Male subjects (%)
Smokers (%)
Lung involvement
⬍1 lobe (%)
ⱖ1 lobe (%)
Cavitation (%)
AFB smear positive (%)
Mycobacterial culture positive (%)
AFB and/or mycobacterial culture positive (%)
Median duration of symptoms in weeks (mean ⫾ SD)
Induced sputum cells ⫻ 106/ml (mean ⫾ SD)
Total
Macrophages
Lymphocytes
Neutrophils
Eosinophils
Ciliated epithelia
33 (34.7 ⫾ 11.1)
67
46.7
64 (57.1 ⫾ 15.6)
46
18.2
24 (24.4 ⫾ 5.1)
50
0
⬍0.0001
0.36
⬍0.0001
36.7
63.3
56.7
70
83.3
93.3
8 (10.5 ⫾ 7.0)
81.8
18.2
0
0
0
0
3 (5.2 ⫾ 6.4)
NA
NA
NA
NA
NA
NA
0.015
⬍0.001
⬍0.0001
⬍0.0001
⬍0.0001
0.25
7.32 ⫾ 15.7
3.71 ⫾ 6.6
0.02 ⫾ 0.08
3.51 ⫾ 9.15
0.05 ⫾ 0.19
0.05 ⫾ 0.08
3.33 ⫾ 5.4
2.19 ⫾ 4.9
0.005 ⫾ 0.014
0.94 ⫾ 1.85
0.017 ⫾ 0.027
0.01 ⫾ 0.02
1.43 ⫾ 1.3
0.95 ⫾ 0.98
0.017 ⫾ 0.04
0.44 ⫾ 0.5
0.003 ⫾ 0.005
0.05 ⫾ 0.01
0.22
0.052
0.004
0.63
0.19
0.21
SOCS expression is promoted upon in vitro infection of macrophages
by bacillus Calmette-Guérin, the TB vaccine bacillus (30). The current literature suggests that the inflammatory response of macrophages is terminated in part by several intracellular regulators, including IL receptor-associated kinase M (IRAK-M) and SOCS (28, 31,
32). IRAK-M dampens TLR signaling, resulting in decreased IL-1
and TNF-␣ output, as well as T cell proliferation and functional development (31, 32).
In this study, we used real-time PCR to quantify the gene expression levels in lung cells from TB patients, patients with infectious
OLD, and healthy volunteer healthcare workers (HCW). We analyzed
whether levels of the above intracellular and extracellular immunesuppressive mediators are operating at the site of disease and whether
levels of mediators that promote Th1-type immunity (IFN-␥, IL12p35, IL-12p40, and IL-23p19) or innate immune activation (NF-␬B
essential modulator I␬B kinase ␥ (NEMO), TLR 2, CD80, CD86) are
reduced during active TB. We used lung cells obtained by induced
sputum, because prior studies have noted a similar representation of
the lung environment by sputum as by BAL samples (33, 34).
Materials and Methods
Patients with suspected pulmonary TB who required induced sputum between
April 1998 and June 2001 were enrolled from the Clementino Fraga Filho
University Hospital of the Federal University of Rio de Janeiro (UH-FURJ), a
reference hospital for TB in Rio de Janeiro, Brazil. Both the study and informed consent forms were approved by the Institutional Review Board of
UH-FURJ and Weill Medical College of New York, NY. This study evaluated
TB cases (n ⫽ 30) and compared them to patients with infectious OLD (n ⫽
11) and to clinically well HCW (n ⫽ 16). All TB patients received standard
anti-TB chemotherapy for 6 mo (rifampicin, isoniazid, and pyrazinamide for 2
mo followed by rifampicin and isoniazid for another 4 mo). During TB treatment, the patients were evaluated weekly for the first month and monthly
thereafter. All patients were confirmed to be compliant with anti-TB treatment
by pill count during each visit. At the end of therapy at 180 days, all TB
patients were deemed cured of active TB. Of the 30 patients with TB, 22 were
available for re-evaluation in August 2005. The mean followup for these patients was 5 years (range 4 –7 years) after the end of treatment. Eight patients
(code nos. 11, 13, 16, 22, 24, 26, 31, and 32) were not available for re-evaluation because they had moved. In a subgroup of these TB cases (n ⫽ 18) and
healthy volunteers (⫽ 9), the supernatants of the induced sputum were separated from the cellular elements and stored at ⫺80°C, and cytopreps were used
for human NOS2 immunolocalization.
Treatment of induced sputum samples
Induction of sputum was performed by inhalation of nebulized 2% saline
solution (35). For TB patients, sputum was induced at diagnosis and at 15,
30, 60, and 180 days of anti-TB chemotherapy. For OLD and HCW, sputum was induced at the time of diagnosis and study enrollment, respectively. One aliquot was treated with 10% DTT (Sigma-Aldrich) for 10 min
at 37°C, then centrifuged, and the supernatant was collected and stored at
⫺70°C until required. A second aliquot, without DTT, was centrifuged and
washed twice with PBS, filtrated through gauze to exclude squamous cells,
and, after cell count (on average 1–2 ⫻ 106 cells) and cytoprep preparation,
the cell pellet was suspended in TRIzol reagent (Invitrogen) for storage at
⫺70°C until required. Up to 12 slides were prepared for each subject in
which ⬃104 cytoprep cells per well were fixed in ice cold acetone, wrapped
in film, and kept at ⫺20°C until use.
RNA isolation, cDNA synthesis, and quantitative real-time PCR
Total RNA extracted from cells suspended in TRIzol reagent was analyzed
by spectrophotometer (260 nm) and, in some samples, RNA integrity was
confirmed by electrophoresis. One microgram of total mRNA using 50 nM
oligo(dT)20 primer was reverse transcribed in a 20-␮l volume using
SuperScript II reverse transcriptase (Invitrogen). The cDNA samples were
diluted 5-fold. Primer sequences were designed using Primer3 software
(frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and synthesized by
Sigma-Genosys, (Sigma-Aldrich). Most primer sets (both or at least one
primer) spanned a mRNA exon-exon junction so as to restrict the amplification from any residual genomic DNA in the cDNA preparations (Table
I). Real-time PCR analysis used the primers shown in Table I in which each
real-time PCR plate contained the following controls: GAPDH (positive),
no template (negative), and DNA contamination (TNF-␣ intron primers).
Quantification of mRNA levels was performed in an ABI Prism 7900H
sequencing system (Applied Biosystems) using relative quantitative PCR
SYBR Green ROX mix (Qiagen) in a 384-well optical plate. The 20-␮l
final volume PCR consisted of 1⫻ QuantiTect SYBR Green, 2.5 mM
MgCl2, 2 ␮l of diluted cDNA, and 0.3 ␮M each primer using the following
thermocycling conditions: an initial step (95°C for 10 min) followed by 40
cycles (94°C for 45 s, 62°C for 45 s, and 72°C for 90 s) without a final
elongation. To verify that the primer pair produced a single specific product, a dissociation protocol was added after thermocycling. The PCR product was also verified at least once by agarose gel electrophoresis and
ethidium bromide staining to confirm the presence of a single amplicon of
the correct size and also by sequence analysis (Cornell University Life
Science Core Laboratories Center, New York, NY). Minimal variance between plate reactions was shown by using a single cDNA sample and
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
a
Of the 30 TB cases, 28 were bacteriologically proven, two were defined clinically (see Materials and Methods), and four were coinfected with HIV-1. All TB cases were
deemed cured after 180 days of anti-TB treatment. All patients with other infectious lung disease (OLD; n ⫽ 11) had negative acid-fast bacilli smears and mycobacterial cultures.
Clinically well volunteers were recruited from HCW employed at the Clementino Fraga Filho University Hospital or the Federal University of Rio de Janeiro in Rio de Janeiro,
Brazil. All values are the mean ⫾ SD. For statistical comparisons, the following tests were used: Kruskal-Wallis (for three groups) or the Wilcoxon sign rank test (for two groups)
for continuous variables and the Fisher exact test for categorical variables. AFB, Acid-fast bacilli; NA, not applicable.
The Journal of Immunology
721
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 1. Lung immune response of TB cases, patients with OLD, and HCW. Illustrated are the mRNA expression levels in log10 scale of the lung
cells from patients with TB, patients with infectious OLD, and clinically well HCW quantified by real-time PCR relative to GADPH. The scale of the
horizontal axis for gene expression relative to GAPDH for each mediator was set to illustrate the lowest to the highest recorded levels. Linear bars represent
the median of the group. The findings were segregated by mediators that impair Th1-type immunity (A), promote Th1-type immunity (B), or affect both
Th1-type or Th2-type cells (C). Each symbol represents the value of one subject and the triangles designate HIV-1-coinfected patients. The two asterisks
(ⴱⴱ) alongside the name of the gene indicate a significant difference between TB cases and OLD and HCW was observed (Kruskal-Wallis or Fishers’ exact
test). The p values for the comparison between groups are shown below the horizontal axis. A *P indicates that Fishers’ exact test was used for six of the
17 genes (see Materials and Methods).
GAPDH as the reference between plates. Triplicate 1:6 serial cDNA dilutions for each gene were used to generate calibration standard curves following the manufacturer’s directions for QuantiFast SYBR PCR (Qiagen).
Standard curves (y ⫽ mx ⫹ b) were obtained by plotting the cycle threshold value (x) of each 6-fold dilution series vs the log2 of the dilution factor
(y). The quantified target gene relative to GAPDH was calculated by the
following: anti-log2 y[target gene]/anti-log2 y[GAPDH]. SDS 2.1 software was
used for exporting the experimental values into a Microsoft Excel work-
sheet for computations and imported into Prism version 4.03 (GraphPad
Software) for statistical analysis and illustration.
Isolation of PBMC and monocytes and challenge with
M. tuberculosis
Leukocyte-enriched buffy coats were purchased from the New York Blood
Center (New York, NY) from which PBMC and monocytes were obtained
722
PREDOMINANCE OF DOWN-MODULATORY LUNG IMMUNE RESPONSES IN TB
by Ficoll-Hypaque density centrifugation separation protocol (Amersham
Pharmacia) and Ab-mediated immunodepletion via erythrocyte rosetting
(RosetteSep; Stem Cell Technologies), respectively. Duplicate wells (24well plate) containing 2 ⫻ 106 cells were cultured and mock challenged or
challenged with M. tuberculosis H37Rv previously quantified by limiting
dilution and culture and stored as a stock (36). Collection of culture supernatants or cell pellets in TRIzol reagent were collected at designated
times and stored at ⫺80°C. Gene expression measurements were conducted as described above.
Cytokine assays and immunostaining for NOS2
Protein cytokines were quantified from supernatants collected from an in
vitro challenge study and from induced sputum supernatants using commercial ELISA kits (Immunotech-Coulter) (18, 37). The limit of detection
for IL-10 and IFN-␥ are 5 pg/ml and 0.08 UI/ml, respectively. NOS2 was
assessed using centrifuged cytopreps containing ⬃104 lung cells stored at
⫺20°. Immunolocalization was performed with immune alkaline phosphatase using the primary mAb, anti-human NOS2 (purified mouse monoclonal IgG1, clone 2D2-B2, 100 ␮g; R&D Systems), diluted to 1/40 in TBS
containing BSA. Positive cells appear as red stained and the results were
presented as the mean (⫾SEM) percentage of positive cells in which at
least 100 nonsquamous lung cells were counted from at least 10 randomly
selected fields.
Statistics analysis
The Kruskal-Wallis test and Dunn’s posttest correction were applied to
continuous variables, and Fisher’s exact test was applied for categorical
variables (38) in the three group comparisons. All tests were performed
using Prism 4.03 (GraphPad Software) and used to generate Fig. 1, Table
II, and Table III. A Wilcoxon sign rank test was used for comparing the
duration of symptoms between TB and OLD patients (e.g., two group
comparisons) (Table II). Six of the 17 mediators for Fig. 1 and three of the
17 mediators for Table III had some individuals whose numerical values
were very low compared with other individuals. We interpreted ⱕ0.001
copies relative to GAPDH to indicate a very low value, because this translates as gene copies 1000-fold lower than those of GAPDH, a constitutively
expressed gene. For these mediators, values in each group were segregated
as ⱕ0.001 or ⬎0.001 copies relative to GAPDH and analyzed as categorical data by Fisher’s exact test. Such cases are indicated by ** in Fig. 1. To
compare group differences using median values in Fig. 3, three different
methods, ANOVA, generalized estimating equation (GEE), and mixed
model were used (39, 40). GEE and mixed model account for the nature of
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 2. The lung immune response of TB patients at the time of diagnosis and during anti-TB treatment. During anti-TB therapy at days 15, 30,
60, and 180, mediator gene expression by lung cells from patients with active TB were quantified by real-time PCR. The findings are segregated as
mediators of genes that impair Th1-type immunity (A), promote Th1-type immunity (B), or are variable in countering effects (C). Of note, the levels of
mediators quantified for the four HIV-coinfected TB patients (triangles and dots) were not distinguishable from the other TB cases.
The Journal of Immunology
723
repeated measures, whereas ANOVA does not. To the best of our knowledge, there is no statistical method that can account for severe non-normality and the aspect for longitudinal data. Therefore, although limited, we
decided to use three standard analytic methods for testing group differences
to ascertain the robustness of the results. In these analyses, we did not
correct for multiple testing for each analysis that entails a different threshold. A stricter threshold for interpreting p values can be used based on the
Bonferroni’s method that adopts 0.05 divided by the number of hypotheses
or comparisons. For example, p ⫽ 0.005 was used when 10 comparisons
were made.
Results
Clinical and demographic characteristics of TB cases compared
with patients with OLD and clinically well HCW volunteers
FIGURE 3. Patterns of lung mediator gene expression by cells from TB
cases during anti-TB treatment. To test the hypothesis that anti-TB treatment modified gene expression, the pattern of gene expression during antiTB was evaluated relative to the pretreatment value. The gene expression
fold change for each mediator was derived by dividing each time point’s
monitored value for each patient during anti-TB treatment (Fig. 2) by the
pretreatment amount (Fig. 1). The median value for each mediator was
plotted, and three groups could be segregated based on the fold change in
mRNA expression at day 15 of anti-TB treatment: declined ⱖ2-fold (A),
changed by ⬍2-fold (B), or increased by ⱖ2-fold (C).
centages of various cell types noted in TB cases, patients with
infectious OLD, and HCW were similar to our prior reported findings using BAL cells (18).
Expression of immune mediators at the time of diagnostic
evaluation
The expression of immune mediators in cells harvested from the
induced sputum of TB and OLD patients at the time of diagnosis
and in HCW was evaluated after reverse transcription of the
mRNA. Real-time PCR was performed and quantified using a standard curve method relative to the GAPDH reference gene. Fig. 1
illustrates the expression levels of immune mediators at the initial
diagnosis. Mediators are separated into three groups: 1) those that
are known to impair Th1-type immunity (IL-10, TGF-␤RI, TGF␤RII, IRAK-M, SOCS1, SOCS3, IL-1Rn, and IDO; Fig. 1A); 2)
those that promote Th1-type immunity (IFN-␥, IL-12p35, IL12p40, IL-23p19, TNF-␣, and NEMO; Fig. 1B); and 3) those that
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
We evaluated TB cases (n ⫽ 30) and compared them to patients
with infectious OLD (n ⫽ 11) and clinically well HCW (n ⫽ 16).
Bacteriologically proven TB cases (n ⫽ 28) were defined by compatible clinical and chest x-ray findings of infiltrates and/or cavitation and a positive M. tuberculosis culture (n ⫽ 25) or acid-fast
bacilli smear (n ⫽ 3). Clinical TB cases (n ⫽ 2) had compatible
clinical and chest x-ray parameters but lacked bacteriologically
positive results. All TB patients received standard anti-TB chemotherapy for 6 mo (see Materials and Methods). At the end of therapy (day 180), all TB patients were deemed cured of active TB
based on the resolution of clinical signs and symptoms and radiological infiltrates or cavitation. Four patients (code nos. 12, 13, 14,
and 23) were diagnosed with HIV-1 coinfection while under antiTB treatment or after the completion of treatment. As there was a
delay in consent for HIV testing, none of the HIV/AIDS patients
were on antiretroviral therapy at the time of diagnosis or during the
early phase of anti-TB treatment. CD4 T cell counts were available
for two patients (patient 14 was 344 ␮l⫺1 at 6 mo after completion
of TB treatment, and patient 12 was 707 ␮l⫺1 6 years after completion of anti-TB treatment and had then suffered a second episode of TB). Patients in whom TB was excluded by culture and
clinical assessment served as controls with infectious OLD. All
patients with infectious OLD (n ⫽ 11) had negative acid-fast bacilli smears, and mycobacterial cultures and were diagnosed with
community-acquired bacterial pneumonia (n ⫽ 9; chest x-ray findings resolved after treatment with a nonquinolone antibiotic), paracoccidiomycosis pneumonia (n ⫽ 1; sputum-stained smear suggestive of Paracoccidioides braziliensis and clinical response to
antifungal therapy), or community-acquired viral respiratory infection (n ⫽ 1; clinical symptoms and chest x-ray findings resolved without antimicrobial treatment). In addition, clinically
well HCW (n ⫽ 16) were recruited from the UH-FURJ, half of
whom were positive for the tuberculin skin test.
Illustrated in Table II are the patient characteristics of the cohort. TB patients tended to be significantly younger than patients
with OLD, but older than HCW. A slightly greater male to female
ratio was noted in TB patients, which is similar to the ratio noted
in the national data (from 2005) for Rio de Janeiro and Brazil from
the Health Surveillance Secretariat of the Brazilian Ministry of
Health (portal.saude.gov.br/portal/arquivos/pdf/epidemio.pdf).
There was no tobacco use by HCW; however, a greater proportion
of TB cases smoked cigarettes than patients with OLD. By chest
x-ray, TB cases manifested more extensive lung involvement, as
indicated by only TB cases having cavitary disease and a greater
proportion presenting with disease in more than one lobe. The
analysis of the cytospin cell preparation at the time of diagnosis
showed that the major cell type was macrophage. The differences
in cell types between patients with TB and OLD or with HCW
showed a slightly greater percentage of macrophages and lymphocytes for TB cases, resulting in a lower percentage of neutrophils.
Eosinophil cell counts were similar in all three groups. The per-
724
PREDOMINANCE OF DOWN-MODULATORY LUNG IMMUNE RESPONSES IN TB
Table III. Comparison of the quantified mediators in TB cases during anti-TB drug treatment with patients with infectious OLD and HCWa
Median Gene Copies Relative to GAPDH during Days of Anti-TB Treatment
15 days
Mediators
Decreased ⱖ2-fold
TGF-␤RII
TNF-␣
SOCS3
IL-1Rn
IDO
Changed ⬍2-fold
SOCS1
IL-23p19
CD80
CD86
IL-10
IRAK-M
5.240
4.950
4.535
0.9400
0.18
85.09
0.0089
0.10
0.39
0.0400
0.6700
3223
23.56
6.005
8.620
2.530
4097
OLD
HCW
p value
1.000
1.000
NS
1.000 12.60
NS
0.10
0.10
0.0011
0.6400 0.0100
NS
0.01
0.01
NS
0.1000
0.01
0.10
3.63
0.0010
0.0100
1.222 0.0001
0.0001
NS
0.10
NS
0.6178
NS
0.0010
NS
0.0100 0.002
0.170 49.76
0.6600 0.10
1.000
1.000
0.5200 0.6061
0.1000 0.1000
9.730 85.55
TB
4.790
7.205
3.925
1.410
0.155
36.08
0.0023
0.69
0.4857
0.0600
0.7700
0.0006 2754
0.0006
17.87
NS
1.000
0.005*
2.720
0.0003
0.1000
0.006* 3062
OLD
HCW
60 days
p value
1.000
1.000
NS
1.000 12.60
NS
0.10
0.10
0.0011
0.6400 0.0100
NS
0.01
0.01
NS
0.10
0.0100
0.10
3.630
0.0010
0.0100
1.222 0.0004
0.0001
NS
0.10
NS
0.6178
NS
0.0010
NS
0.0100 0.0002
0.170 49.76
0.6600 0.1000
1.000
1.000
0.5200 0.6061
0.1000 0.1000
9.730 85.55
TB
3.370
3.455
4.815
0.8400
0.055
86.95
0.0023
0.10
0.1600
0.0500
0.3750
0.0004 1409
0.0003
19.72
NS
1.000
0.002*
1.585
0.001
0.1000
0.003* 1765
OLD
HCW
1.000
1.000
1.000 12.60
0.10
0.10
0.6400 0.0100
0.01
0.01
0.1000
0.0100
0.10
3.630
0.0010
0.0100
180 days
p value
NS
NS
NS
NS
NS
1.222 0.0001
0.0001
NS
0.10
NS
0.6178
NS
0.0010
NS
0.0100 0.0009
TB
7.110
7.825
3.055
0.9750
0.075
41.58
0.0012
0.875
1.110
0.0600
0.6350
0.1700 49.76
NS
2704
0.6600 0.1000 0.001
28.08
1.000
1.000
NS
1.000
0.5200 0.6061 0.002*
2.395
0.1000 0.1000
NS
1.070
9.730 85.55
0.003* 1523
OLD
HCW
1.000
1.000
1.000 12.60
0.10
0.10
0.6400 0.0100
0.01
0.01
0.10
0.0100
0.10
3.630
0.0010
0.0100
p value
NS
NS
NS
NS
NS
1.222 0.0003
0.0001
NS
0.10
NS
0.6178
NS
0.0010 0.022*
0.0100 0.0005
0.1700 49.76
0.6600 0.1000
1.000
1.000
0.5200 0.6061
0.1000 0.1000
9.730 85.55
0.0003
0.0002
NS
0.001*
0.001
0.002*
a
To validate the assertion that anti-TB treatment affected levels of gene expression as shown in Fig. 3, we tested the hypothesis that treatment normalized the gene expression
of the mediators to that of controls. Therefore, gene copies for each mediator relative to GAPDH recorded during treatment (15, 30, 60, and 180 days) of TB cases
(illustrated in Figure 2) were compared with the values for the control groups (HCW and OLD patients) at initial evaluation (shown in Figure 1; Kruskal-Wallis with
Dunn’s correction or Fisher’s exact test (ⴱ) for three mediators; see Materials and Methods). Shown in this table are the median group gene copies relative to GAPDH
values for each mediator that are shown in Figs. 1 and 2 as a horizontal bar. For cross comparison with Fig. 3, mediators were grouped as shown in that figure (decreased
ⱖ2-fold, changed ⬍2 fold, and increased ⱖ2-fold). In response to anti-TB treatment, the majority of lung mediators in TB cases returned to levels similar to those
quantified for patients with OLD and HCW.
affect both Th1 and Th2 immunity (CD80, CD86, and TLR2; Fig.
1C). Overall, of the 17 illustrated immune mediators, 13 were at
significantly higher levels in TB cases when compared with patients with OLD, and 14 were higher when compared with HCW
( p ⱕ 0.05; Kruskal-Wallis test or Fishers’ exact test).
These data demonstrate that TB cases express significantly
higher levels of mediators with anti-inflammatory activity and/or
mediators that may impair Th1 immunity (IL-10, TGF-␤RII,
IRAK-M, IL-1Rn, SOCS1, SOCS3, and IDO) when compared
FIGURE 4. Schematic illustrating
the down-modulated lung immune
state associated with TB. Based on the
findings of this study, a working
model of the immunopathological
mechanisms associated with TB is
presented. The symbol (⫻) indicates a
blockade of a pathway or function.
with the control groups (patients with OLD and HCW) (Fig. 1A).
TB cases were also found to express higher levels of mediators that
promote Th1-type immunity (IFN-␥, IL-12p40, IL-12p35, and
NEMO) when compared with the control groups (Fig. 1B). TNF-␣
levels in TB cases were similar to those of controls. Therefore, the
functional effects of proinflammation appear to be more sustained
in TB cases than for either comparison group. Of the molecules
that may promote both Th1-type and Th2-type immunity (Fig. 1C),
TLR2 levels were significantly higher in TB cases whereas the
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
Increased ⱖ2-fold
IL-12p40
TLR2
TGF-␤RI
NEMO
IFN-␥
IL-12p35
TB
30 days
The Journal of Immunology
725
FIGURE 5. Gene expression profile of immune modulators following in
vitro challenge with M. tuberculosis (M.tb). Immune modulators previously studied in lung cells were evaluated in vitro following challenge with
M. tuberculosis H37Rv. Gene expression relative to GAPDH for monocytes (⬎95% CD14 positive) (A) and PBMC (B) were quantified at designated times after challenge with M. tuberculosis. Illustrated is one representative of two experiments; each condition was tested in duplicate.
␤RII, SOCS3, IL1Rn, and IDO; range, 3- to ⬃1000-fold) or
showed a declining trend as in the case of IL-10 and IRAK-M but
changed by ⬍2-fold. In contrast, mediators that promote Th1-type
immunity increased by ⱖ2-fold (Fig. 3C) during anti-TB treatment
(IFN-␥, IL-12p40, IL-12p35, NEMO, and TLR2; range, 3- to 14fold). The distinct temporal changes in response to anti-TB drug
treatment compared with initial pretreatment lend further support
that these lung mediators are specific to TB. We next applied three
CD86 costimulatory molecule levels were significantly lower compared with the control groups. CD80 costimulatory molecule levels
were similar in all three groups.
Lung immune response of TB patients at initial diagnosis and
in response to anti-TB drug treatment
We next evaluated the lung gene expression of each mediator at
the initial diagnosis and in response to anti-TB drug treatment to
test the hypothesis that anti-TB treatment modified gene expression (Fig. 2). No obvious trend was observed during treatment,
likely because of the variability in range between patients. To evaluate for potential temporal trends, we transformed the mediator
values into fold change for each patient during anti-TB treatment
by dividing the quantified mediator value at days 15, 30, 60, and
180 of anti-TB treatment by the pretreatment value (day 0). After
data transformation and plotting of the median value for each mediator in TB cases, three patterns could be grouped by the fold
change in mRNA expression on day 15 of anti-TB treatment: ⱖ2fold decreased (Fig. 3A), ⬍2-fold change (Fig. 3B), and ⱖ2-fold
increased above pretreatment value (Fig. 3C). The application of a
2-fold difference in gene expression is in accordance with the convention used for microarrays, which presumes that a 2-fold gene
expression difference has a biological impact. Of note, mediators
that impair Th1-type immunity either declined by ⱖ2-fold (TGF-
FIGURE 7. Levels of cytokines in induced sputum supernatants. A and
B, Illustrated are the mean (⫹SEM) IL-10 (A) and IFN-␥ (B) levels. Comparisons between IL-10 and IFN-␥ levels in TB cases and healthy volunteers (VOL) at times (T) 0 and 15 were statistically different (ⴱ, p ⬍ 0.05;
Mann-Whitney U test). C and D, Illustrated are the individual and median
(horizontal bar) IL-10 (C) and IFN-␥ (D) levels quantified in induced sputum for each TB case at diagnosis and during anti-TB treatment. IL-10
levels showed a decreasing trend until 60 days of anti-TB treatment, paralleling the bacilli clearance; however, the trend was not statistically significant (Student’s t test for repeated measures).
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 6. Protein levels of select immune modulators following in
vitro challenge with M. tuberculosis (M.tb). In experiments parallel to that
of the in vitro gene expression study, cell culture supernatant from monocytes (A) and PBMC (B) at the designated times following challenge with
M. tuberculosis H37Rv were harvested after cell depletion and TNF-␣,
IL-10, and IFN-␥ were measured. Illustrated is one representative experiment of three.
726
PREDOMINANCE OF DOWN-MODULATORY LUNG IMMUNE RESPONSES IN TB
statistical methods to analyze the patients’ fold change values for
each mediator represented in Fig. 3 as median mediator values to
determine whether the noted variances were significantly different.
The fold change comparison between mediators in A and C of Fig.
3 by three methods without slope or curve fitting supported the
assertion that variances between mediators were significantly different (Fig. 3, A vs C, p ⫽ 0.0001 by ANOVA; p ⫽ 0.002 by GEE;
and p ⫽ 0.0002 by mixed model).
To investigate whether anti-TB drug treatment was associated
with the normalization of lung mediators, the quantified values of
each mediator relative to GAPDH, assayed for TB cases during
treatment at 15, 30, 60, and 180 days (Fig. 2), were compared with
control groups (HCW and OLD; Fig. 1). Of the 14 mediators that
were at significantly greater levels in TB cases at the time of diagnosis compared with those in HCW (Fig. 1), seven declined
during anti-TB drug treatment to levels similar to those in HCW.
The remaining seven mediators did not normalize. Five of the
seven mediators (IL-12p35, IL-12p40, TLR2, NEMO, and IFN-␥)
Table IV. Clinical characteristics associated with specific lung mediatorsa
Clinical Characteristics
Mediator
Median Gene Copies Relative
to GAPDH Level (presence or
absence of clinical characteristic)
Cavitation disease
IL-23
IL-23
IRAK-M
SOCS3
CD80
NEMO
(36.2; 24.9)
(36.7; 20.5)
(7.8; 0.97)
(226.3; 44.4)
(0.82; 0.11)
(1746; 5904)
Disease of ⬎1 lobe
Second episode TB
Treatment (days)
p Value
15 thru 180
180
15
60
60
30
0.047
0.016
0.02
0.023
0.011
0.048
a
To discern whether levels of immune mediators correlate with distinct clinical manifestations or treatment outcome, we
relinked the patients’ study numbers with patients’ records to obtain clinical information regarding disease severity (n ⫽ 30) and
second episode TB (n ⫽ 20). Twenty of the 30 patients and/or their families were located ⱖ4 years after treatment completion.
Of the 20 patients, five had a second TB episode within 2 years of TB treatment (several months (n ⫽ 1) to 2 years (n ⫽ 4).
These data were confirmed by the review of patients’ medical records. The clinical evaluation was performed by clinicians
without knowledge of the mediator levels. The clinical data file was later merged for statistical analyses (Wilcoxon rank sum;
p ⬍ 0.05). Levels of each of the mediators with associations appear to have plausible biological function in potentially contributing to the clinical state. For example, IL-23 is associated with hyperinflammatory response in autoimmune diseases, and
a heightened level of IL-23 may lead to more tissue destruction or cavitation disease. Lower anti-M. tuberculosis-specific innate
and adaptive immune responses associated with heightened levels of IRAK-M and SOCS3 may lead to more extensive disease
as indicated by more lung lobes being involved. Most of statistical associations noted here are regarded with suspicion, as they
were significant at only one time point.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
FIGURE 8. Expression of human NOS2 by lung cells. A, Comparisons
of NOS2 levels between those in TB patients and healthy volunteers (VOL)
are illustrated as the mean (⫹SEM) percentage of positive cells (alveolar
macrophages) obtained at diagnosis (time (T) 0) and at day 15 of anti-TB
treatment. Statistically significant differences in NOS2 levels were noted
between those TB patients and the healthy volunteers (ⴱ, p ⬍ 0.05; MannWhitney U test). B, Mean NOS2 levels quantified from TB cases at time of
diagnosis to 180 days are illustrated. Of the 15 TB cases studies, the number of patients with positive NOS2 lung cells at time of diagnosis (T0) and
during anti-TB treatment (days 15, 30, 60, and 180), respectively, were 13,
10, 5, 6, and 3. All of the nine healthy volunteers had NOS2 detected.
Statistical differences in the expressions of NOS2 at different times during
anti-TB treatment are shown (ⴱ, p ⬍ 0.0; Student’s t test for repeated
measures).
that promote Th1-type immunity rose ⬎2-fold in response to antiTB treatment (Fig. 3) and sustained the heightened levels throughout treatment when compared with patients with OLD and HCW
(Table III). The remaining two mediators, SOCS1 and IRAK-M,
which impair macrophage activation by IFN-␥ or the sensing of M.
tuberculosis ligands by TLRs, respectively, remained persistently
elevated even at the end of treatment with anti-TB drugs at levels
that were significantly greater than those in OLD and HCW (Table
III). These selective changes in immune mediator expression levels
in response to anti-TB drug treatment provide additional support
that the observed findings could be directly attributable to M. tuberculosis infection. The interplay of genes with down-modulatory
function and those that promote Th1-type activity is illustrated in
Fig. 4. The consequence of a heightened down-modulatory immune response that impairs Th1-type activity may therefore be the
uncontrolled proliferation of M. tuberculosis and active TB.
Our findings suggest that M. tuberculosis triggered the in vivo
expression of the measured immune genes. To validate that these
immunomodulatory genes are a direct consequence of challenge
by M. tuberculosis, in vitro experiments using naive human PBMC
and monocytes were conducted. As illustrated in Fig. 5, the expression of a similar set of immunomodulatory genes as that detected in lung cells obtained by induced sputum during active TB
was also up-regulated in monocytes (Fig. 5A) and PBMCs (Fig.
5B) after direct in vitro challenge with M. tuberculosis. Furthermore, TNF-␣ and IL-10, but not IFN-␥, protein levels were also
shown to be greatly induced in human monocytes (Fig. 6A) and
PBMC (Fig. 6B), thereby confirming that up-regulation of gene
expression is accompanied by protein production. To further confirm that the genes up-regulated by cells obtained from induced
sputum were similarly translated into proteins, a subset of the cohort with available induced sputum supernatant was evaluated by
ELISA for the presence of IL-10 and IFN-␥. Clearly, control
healthy volunteers (VOL in Fig. 7) do not manifest significant
changes in levels of IL-10 and IFN-␥ at entry (time 0) compared
with 15 days later (Fig. 7, A and B, respectively). Healthy volunteers also produced significantly lower levels of IL-10 and IFN-␥
at entry than TB cases ( p ⬍ 0.05). In contrast, the IL-10 and IFN-␥
quantified for TB patients were both elevated at study entry (time
0) and showed a decreasing trend during the course of TB treatment. The decline was most apparent for the mean IL-10 level
The Journal of Immunology
Discussion
Progression to active TB in humans is mediated by a combination
of poorly understood microbial and host factors that are the focus
of active investigation. Most studies have relied on murine models
(3, 4), in vitro M. tuberculosis Ag-rechallenged ex vivo human
BAL cells, peripheral blood from TB patients and their contacts
(41, 42), or BAL cells from patients with TB pleurisy (42). Few
studies have comprehensively evaluated the immune profiles of
lung cells from active TB patients during treatment (8). In our
previous study using BAL samples from bacteriologically proven
TB cases, TB cases compared with patients with infectious OLD
and healthy volunteers produced significantly higher levels of IL-2
and IFN-␥ (18). Concomitant overexpression of IL-10 and TGF␤RI and TGF-␤RII, as well as bioactive TGF-␤, led us to posit that
M. tuberculosis products actively promote a down-modulatory immune response to dampen host anti-M. tuberculosis immunity and
thereby allow uncontrolled bacterial replication and overt disease
(18, 36).
In the current study, we used cells obtained from induced sputum to further delineate the immune response in the lung during
active pulmonary TB. The sensitivity of induced sputum for TB
diagnosis is comparable to that of BAL (35). Likewise, the results
of lung immune responses were similar in most studies when samples obtained from induced sputum or BAL were used (33, 34).
The percentages of cell types obtained by induced sputum in the
current study also appeared similar to those in our previous study
using BAL cells (18). In addition, we previously observed that
levels of IL-10 protein in induced sputum samples of pulmonary
TB patients positively correlated with the amount of CFP32, a M.
tuberculosis Ag, indicating that IL-10 levels correlate with the
failure of immune control M. tuberculosis (37). In the current
study, using lung cells from induced sputum we confirmed and
5
The online version of this article contains supplemental material.
further extended our prior results (18, 37); TB cases expressed
significantly higher levels of mediators associated with Th1-like
immunity (IFN-␥, IL-12p35, IL-12p40, and NEMO) compared
with patients with OLD or with clinically well HCW. Our observations are supported by other studies that measured IFN-␥,
TNF-␣, or IL-12 (41, 43) and by microarray evaluation of BAL
cells from TB patients (8, 44). However, immunity in TB patients
remains suboptimally oriented, and so, despite the presence of
proinflammatory signals, competing anti-inflammatory signals
must predominate. Indeed, coincident with the higher expression
of Th1-like mediators, TB patients also expressed significantly
higher levels of IL-10, TGF-␤RI, TGF-␤RII, IL-1Rn, and IDO
than patients infected with OLD and HCW. These findings are in
agreement with our prior study using BAL cells and with microarray analysis of lung cells from BAL that showed increased expression of TGF-␤ or a comparable Th2 presence (8, 44). In addition
to TGF-␤ and IL-10, we report herein that the extracellular suppressors IL-1Rn and IDO and the potent intracellular negative regulators IRAK-M and the SOCS family members were significantly
elevated in TB cases and likely serve to impair innate as well as
Th1-type immunity. This may be one of the first human studies to
demonstrate that SOCS1, SOCS3, IRAK-M, IL-1Rn, and IDO are
overexpressed by the lung cells of patients with active pulmonary TB
as compared with patients with infectious OLD. Our current observations conceptually parallel the findings by Raju et al. (8) even
though the mediators classified as Th1 or Th2 by that study were not
examined by our study, and many of mediators uncovered by this
report were not detected by Raju et al. as being up-regulated in TB
patients. Potential explanations that account for the differences in our
current findings may include the fact that different methods were used
and that Raju et al. sampled BAL (predominately containing
macrophages) whereas we sampled induced sputum that contains
several cellular immune elements (Table II).
Fig. 4 illustrates both the permissive and the immune suppressive lung environments observed in the present findings that allow
the uncontrolled proliferation of M. tuberculosis in active TB. The
pattern of gene expression noted in patients’ lung cells was similarly found upon in vitro challenge of PBMC and monocytes with
M. tuberculosis (Fig. 5). Moreover, the translation of these genes
into proteins that effect their function were confirmed by the measurement of a limited number of these immune modulators in vitro
and in induced sputum samples (Figs. 6 – 8). Even though the macrophage was the major cell type, we detected lymphocytes at
⬃1%. Therefore, the model includes both cell types in interpreting
the data with the following caveats. It should be recognized that
regulatory T cells may be more important in the production of
Th2-type pulmonary responses in humans rather than the canonical
Th2 cells as seen in murine studies. Secondly, we do not know
whether the illustrated innate Th lung environment reflects the immune education that typically occurs in a lymphoid compartment.
Furthermore, neutrophils in the sample may indicate the contribution of airway cells in addition to that from the alveolar space.
However, in our previous study using lung cells obtained by BAL,
neutrophils were also noted in samples from TB cases (18). Therefore, this finding may reflect the lung environment in “early” TB
and/or the fact that TB involves not only the alveoli but is a granulomatous process that encompasses alveoli and airways.
The upper panel of Fig. 4 illustrates the heightened expression
of IL-10, TGF-␤ ligand, TGF-␤RI, TGF-␤RII, IL-1Rn, and IDO in
the lung cells of TB cases that act in concert to minimize Th0-type
cell development into Th1-type cells while promoting the expansion of Th2-type cells despite the concomitantly expression of mediators that promote Th1-type immunity (IFN-␥ and IL-12). Overproduction of IL-10 has been reported to impair Th1-type cell
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
shown for the entire cohort of TB cases (Fig. 7C). We next evaluated the expression of inducible NOS by alveolar macrophages as
an indicator of the in situ lung’s state of antimicrobicidal activity.
Importantly, all healthy volunteers had cells expressing NO2, such
that ⬎60% of visualized alveolar macrophages expressed NO2. In
contrast, 13 of 15 TB patients studied had NOS2 detected in their
alveolar macrophages at the time of TB diagnosis with a mean
number of cells expressing inducible NOS of ⬍30% (Fig. 8 and
illustrated in supplemental Fig. 1).5 The lower number of NOS2
expressing alveolar macrophages in TB cases compared with volunteers (⬎60%) underscores the overall immune down-modulated
state of the lung during active TB. The decline in the percentage of
NOS2-positive alveolar macrophages and number of patients with
NOS2-positive cells detected during anti-TB drug treatment further support the assertion that NOS2 expression is in response to
M. tuberculosis (Fig. 8B).
To discern whether the levels of immune mediators correlate
with distinct clinical manifestations or a second episode TB, the
patients’ study numbers were relinked with the patients’ records
for disease severity (n ⫽ 30) and second episode TB (n ⫽ 20). We
found the following associations in TB cases (Wilcoxon rank sum,
p ⬍ 0.05; Table IV): 1) cavitation disease associated with higher
levels of IL-23 and lower levels of IRAK-M; 2) disease affecting
more than one lobe associated with higher levels of SOCS3; and 3)
acquisition of second episode TB associated with lower levels of
NEMO and higher levels of CD80. It is important to note that these
associations, with the exception of IL-23, were found at only one
time point and therefore could be due to chance.
727
728
PREDOMINANCE OF DOWN-MODULATORY LUNG IMMUNE RESPONSES IN TB
cases is permissive for M. tuberculosis proliferation. Heightened
expression of SOCS1 and SOCS3 in human TB shown by this
study is supported by findings from three prior reports: 1) in vitro
infection of murine macrophages by the TB vaccine bacillus
Calmette-Guérin is associated with increased SOCS1 expression
(30); 2) SOCS1, SOCS4, and SOCS5 are preferentially up-regulated in the lungs of mice infected with W/Beijing M. tuberculosis
(63); and 3) SOCS3 is up-regulated in human macrophages and
dendritic cells after in vitro infection by M. tuberculosis (59). The
lower right panel of Fig. 4 illustrates SOCS1 and SOCS3 functioning to interrupt one or more steps of the cell signaling cascade
initiated by IFN-␥, IL-12, and IL-23 binding to their cognate receptors (28, 29, 64). The sum effect of the overexpression of SOCS
genes could be limited proliferation and expansion of Th1 cells,
less responsiveness to Th1-type cytokines, and, in turn, less production of Th1-type cytokines. Supporting this concept is our finding that, subsequent to treatment with anti-TB drugs (and killing of
the tubercle bacilli), lung cells from TB cases produced greater
amounts of IFN-␥ (a Th1-type cytokine) than were produced pretreatment (Fig. 3C and Table III). Lastly, overexpression of
SOCS3 in Th2-type cells also regulates the onset and maintenance
of Th2-mediated allergic responses and may promote Th2 activity
in TB (65).
As illustrated for macrophages (Fig. 4, left bottom panel), the
increase in SOCS1 may dampen cell activation by IFN-␥ and minimize antimycobacterial activity, thereby permitting uncontrolled
M. tuberculosis proliferation (28, 29, 64). Current data also suggest that participation by SOCS1 in the negative regulation of TLR
signaling dampens antimycobactericidal activity (28, 64). Another
consequence of the overexpression of SOCS1 in lung macrophages
is an impaired capacity to promote Th1-type immunity, because
enhanced SOCS1 expression by innate immune cells has been reported to inhibit the acquisition of CD4 and CD8 T cell adaptive
immunity against a viral agent (66). Consistent with this interpretation is our finding that levels of IL-23p19 in TB cases at the time
of diagnosis were as low as those in HCW and in patients with
OLD. Because IL-23p19 is an output of innate immune cells induced by IFN-␥, this finding along with uncontrolled M. tuberculosis proliferation supports our hypothesis that lung macrophage
activation by IFN-␥ is functionally impaired. Macrophages also
respond to IFN-␥ to enhance its antimicrobicidal activity as a consequence of NOS2 expression. Our finding that ⬍30% of alveolar
macrophages expressed NOS2 at TB diagnosis supports the notion
that a lower state of antimicrobicidal activity exists in the lung
during active TB (Fig. 8).
The overexpression of IRAK-M in TB cases may also counter
maximal macrophage activation by pathogen-associated molecular
patterns of M. tuberculosis. IRAK-M normally functions as a negative regulator of TLR signaling after the ligation of TLR with its
cognate microbial ligand (31, 32). The heightened expression of
IRAK-M in TB may therefore act to dampen the sensing of mycobacterial ligands by TLR family members, in particular the
TLR2, TLR4, and TLR9 receptors that have a putative role in the
control of M. tuberculosis (67–70). Our finding that IRAK-M is
overexpressed provides another line of data to explain why, despite
M. tuberculosis cell wall components being highly inflammatory
(as shown by Freund’s adjuvant), macrophages lack antimycobacterial activity to control M. tuberculosis. TLR2 is also overexpressed in TB cases. Increased TLR2 expression may provide M.
tuberculosis another avenue to exploit immune subversion, because many M. tuberculosis ligands detected by innate immune
cells are apparently sensed by TLR2. These include lipoproteins
and the ESAT-6 protein, each of which has been shown to impair
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
development/function and promote the expansion of Th2-type
cells (12, 15, 45, 46). The fact that IL-10 may also underlie the
susceptibility of certain mouse strains to mycobacterial infection
(47) and that the alleles of IL-10 in humans are linked to susceptibility to TB point to the contribution of IL-10 to TB disease (5).
A similar outcome may be expected with the overexpression of the
TGF-␤ ligand and receptors, because they have been reported to
contribute to a shift toward a Th2-type response (14, 46, 48, 49).
Sustained secretion of IL-10 and TGF-␤ has been reported to result
in a long-lasting hyporesponsive (anergic) state to specific Ags
(45, 46) and is likely in play because PBMC from pulmonary TB
patients manifest bioresponses similar to those induced by IL-10
and/or TGF-␤ (12, 48, 50, 51). The increased levels of serum
IL-10 and TGF-␤ detected in TB patients, and the increased in
vitro IL-10 and TGF-␤ secretion by the PBMC and/or monocytes
of TB patients in response to M. tuberculosis Ags, also support a
role for these two immune suppressive mediators (7, 52–54). The
fact that M. tuberculosis can directly induce macrophage IL-10 and
TGF-␤ production (36, 55) and that the growth restriction of M.
tuberculosis by human monocytes/macrophages is correlated inversely with the amount of stimulated IL-10 and TGF-␤ secretion
(36, 56) further underscores their antagonistic role in microbicidal
activity in TB.
High amounts of IL-1Rn may impair Th0 development into Th1
cells, because IL-1 promotes Th1-type-mediated inflammation under several clinical conditions (21, 22). In an experimental arthritis
model IL-1Rn-null mice had a prominent Th1-type immunity with
exaggerated IL-23, IL-17, and IL-23 blockade (with anti-p19
mAb) abolished the IL-17 production induced by IL-1 and decreased disease severity (57). Another study showed that immune
responses to liparabinomannan, the M. tuberculosis cell wall component, appeared to be mediated by IL-1 activity, because IL-1R
null mice showed significantly reduced cell recruitment into the
lung, as well as lower levels of TNF-␣ in the lung (58). Lastly,
alleles of the IL-1Rn gene have been associated with susceptibility
to mycobacterial infection (5, 6).
Our current data suggest that IDO overexpression may favor
Th2-type immunity through the depletion of the tryptophan needed
by Th1-type cells or via the deletion of Th1 cells by kynurenines,
toxic metabolites resulting from IDO catabolism of tryptophan (23,
24). In addition to the finding that in vitro infection by intracellular
Toxoplasma, Leishmania, and M. tuberculosis induced macrophages and/or dendritic cells to express IDO (24, 59), enhanced
IDO expression has been implicated in the pathogenesis of influenza and West Nile virus infection (26, 27). As such, following
influenza infection and treatment with an IDO inhibitor, mice
showed reduced bacterial load and, thus, less severe secondary
pneumococcal pneumonia (26, 27).
CD80 and CD86 costimulatory molecules have been reported to
direct Th1 and Th2 responses, respectively; however, the effects of
CD80 and CD86 on Th0 cell development are likely more complex
(60). Depending on the temporal sequence of immune events and
level of expression, CD86, may bias either a Th1 or Th2 response
(61, 62). In this study, we noted that levels of CD80 in TB cases
were similar to those in two control groups, whereas the levels of
CD86 were significantly lower in TB cases than in controls Our
findings may therefore suggest that, in sum, similar CD80 levels in
the context of lower CD86 in TB may promote a biased Th2-type
immunity.
The two lower panels of Fig. 4 illustrate the effect of SOCS1
and SOCS3 overexpression. This schematic of the overexpression
of SOCS provides new insight into why, despite heightened levels
of Th1-type mediators (at levels that were higher than those in
patients with infectious OLD), the lung environment in active TB
The Journal of Immunology
findings provide the immunological data supporting this premise.
Several of the mediators in this study were associated with either
cavitary, more extensive disease, or the acquisition of second episode TB (Table IV). These preliminary findings were presented
solely to illustrate that certain lung immune mediators, when studied in a prospective patient cohort with a sufficient sample size,
may potentially provide additional insights into TB disease and
recurrence; this approach is supported by a previous report noting
that the levels of circulating Th1 and Th2 cytokines correlated with
the severity of clinical disease (7).
In summary, our findings in active TB suggest that M. tuberculosis promotes down-modulatory lung immune mediators to counteract Th1-type and innate immunity as an immunopathological
strategy. The temporal changes in certain immune factors during
anti-TB treatment substantiate the contention that these mediators
are modulated by M. tuberculosis to transit to active disease. Differences in the level of expression of lung immune mediators between TB cases and patients with infectious OLD and HCW and in
their temporal change in response to anti-TB therapy suggest that
certain mediators have the potential to be surrogate markers for TB
diagnosis and treatment response. Surrogate markers are critically
needed to monitor treatment response to anti-TB drugs, especially
in resource-poor settings that lack the personnel and/or facilities to
perform mycobacterial culture (79, 80). Moreover, having surrogate markers will facilitate large multicenter clinical trials for new
anti-TB drugs in regions of high TB incidence that coincidentally
are also resource poor. We recognize that real-time PCR is not
practical in resource-poor regions, but ELISA-based assays have
the potential to be made affordable, rapid, and sensitive. In a proof
of concept, we used Ag capture ELISA to diagnose TB by the
presence of a M. tuberculosis protein, CFP32, in induced sputum
that positively correlated with IL-10 levels (37). Prospective cohorts with sufficiently large sample sizes and segregated by M.
tuberculosis strain family are needed to confirm our findings that
host proteins can be used as surrogate markers for TB diagnosis
and treatment response, especially in the setting of emerging multidrug-resistant and extensively drug resistant TB.
Acknowledgments
We are grateful to Warren D. Johnson Jr. for supporting this study.
Disclosures
The authors have no financial conflict of interest.
References
1. Corbett, E. L., C. J. Watt, N. Walker, D. Maher, B. G. Williams,
M. C. Raviglione, and C. Dye. 2003. The growing burden of tuberculosis: global
trends and interactions with the HIV epidemic. Arch. Intern. Med. 163:
1009 –1021.
2. World Health Organization. 2007. Global Tuberculosis Control: Surveillance,
Planning, Financing. World Health Organization, Geneva.
3. Collins, H. L., and S. H. Kaufmann. 2001. The many faces of host responses to
tuberculosis. Immunology 103: 1–9.
4. Flynn, J. L., and J. Chan. 2001. Immunology of tuberculosis. Annu. Rev. Immunol. 19: 93–129.
5. Ottenhoff, T. H., F. A. Verreck, M. A. Hoeve, and E. van de Vosse. 2005. Control
of human host immunity to mycobacteria. Tuberculosis 85: 53– 64.
6. Bellamy, R., C. Ruwende, T. Corrah, K. P. McAdam, H. C. Whittle, and
A. V. Hill. 1998. Assessment of the interleukin 1 gene cluster and other candidate
gene polymorphisms in host susceptibility to tuberculosis. Tuber. Lung. Dis. 79:
83– 89.
7. Dlugovitzky, D., A. Torres-Morales, L. Rateni, M. A. Farroni, C. Largacha,
O. Molteni, and O. Bottasso. 1997. Circulating profile of Th1 and Th2 cytokines
in tuberculosis patients with different degrees of pulmonary involvement. FEMS
Immunol. Med. Microbiol. 18: 203–207.
8. Raju, B., Y. Hoshino, I. Belitskaya-Ley, R. Dawson, S. Ress, J. A. Gold,
R. Condos, R. Pine, S. Brown, A Nolan, et al. 2008. Gene expression profiles of
bronchoalveolar cells in pulmonary TB. Tuberculosis (Edinb.) 88: 39 –51.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
immune activation and/or favor the production of more antiinflammatory than inflammatory cytokines (36, 71–73). Through a systematic comparison of innate immune responses after cell stimulation with agonists specific for TLR2, TLR3, TLR4, TLR5 and
TLR7, Re and Strominger found that TLR2 stimulation led to the
blockage of subsequent cell activation by TLR3 and TLR4 agonists (74). Moreover, cell activation via TLR2 resulted in the rapid
release of IL-10 that inhibited IP-10 and IL-12p35 induction (74).
In light of these in vitro findings, we speculate that the preferential
signaling via TLR2 in active TB results in a net anti-inflammatory
effect that functionally deactivates macrophages harboring M. tuberculosis and thus allows unrestricted proliferation and overt disease. The notion that M. tuberculosis-mediated TLR2 signaling is
anti-inflammatory was previously posited by Salgame et al. (73,
75). The consequence of heightened expression of SOCS1,
IRAK-M, and TLR2 as well as potent soluble suppressors of macrophage activation such as IL-10 and TGF-␤ may result in lower
antimicrobicidal activity, as shown by ⬍30% of alveolar macrophages expressing NOS2 (Fig. 8).
The temporal changes in the lung mediators in response to antiTB treatment further supports our hypothesis that M. tuberculosis
is modulating these factors (Fig. 3 and Table III). Specifically, we
noted that Th1-type immune modulators as a whole increased by
⬎2-fold (range, 3- to 14-fold) after 15 or more days of anti-TB
treatment, whereas the majority (four of seven) of mediators that
impair Th1-type immunity declined by ⬎2-fold (range, 3- to 1000fold). Statistical comparison of mediator levels during anti-TB
treatment compared with those in patients with OLD and HCW
strengthens our claim that these factors are indeed responding to
M. tuberculosis (Table III). The majority of mediators that impair
Th1-type immunity declined to levels that were comparable with
those in patients with OLD and HCW. In contrast, mediators that
promote Th1-type immunity rose and remained at significantly
higher levels than those in patients with OLD and HCW even at
the end of anti-TB treatment at 180 days. Our preferred interpretation regarding changes in modulator expression in response to
anti-TB drugs is that the removal of M. tuberculosis led to immune
improvement. However, we have not excluded the possibility that
changes in cellular constituents may also contribute to our findings. Our finding that in vitro challenge of PBMC and monocytes
elicited the heightened expression of a similar panel of immunomodulatory genes favors the former interpretation. Lastly, the decline in the percentage of alveolar macrophages expressing NOS2,
a potent microbicidal effector, further support the assertion that
these genes are responding to the presence of M. tuberculosis and
that the killing by anti-TB drugs led to diminishing expression of
these genes during treatment (Fig. 8).
We also noted in this study that despite the completion of antiTB treatment, the levels of expression of SOCS1 and IRAK-M (the
intracellular suppressors of TLR and IFN-␥R signaling, respectively) as well as that of TLR2 remained elevated compared with
that of HCW even though all TB patients were cured (based on
clinical and radiological evidence). The residual heightened presence of these intracellular negative regulators of innate immunity
and cellular activation may reflect continued lung repair, modulation by residual M. tuberculosis Ags, and/or dormant bacilli. Persistence of a down-modulatory state may increase the risk for new
infection by another strain of M. tuberculosis. A similar immunesuppressed state has been shown subsequent to infection by influenza and the measles virus (26, 76, 77) and results in increased risk
for bacterial pneumonia. Recently, Verver et al. observed a 7-fold
higher risk for subsequent TB in those successfully treated for TB
(78), which led the authors to speculate that M. tuberculosis modified the lung environment to be permissive for reinfection. Our
729
730
PREDOMINANCE OF DOWN-MODULATORY LUNG IMMUNE RESPONSES IN TB
36. Bonecini-Almeida, M. G., S. Chitale, I. Boutsikakis, J. Geng, H. Doo, S. He, and
J. L. Ho. 1998. Induction of in vitro human macrophage anti-Mycobacterium
tuberculosis activity: requirement for IFN-␥ and primed lymphocytes. J. Immunol. 160: 4490 – 4499.
37. Huard, R. C., S. Chitale, M. Leung, L. C. Lazzarini, H. Zhu, E. Shashkina,
S. Laal, M. B. Conde, A. L. Kritski, J. T. Belisle, et al. 2003. The Mycobacterium
tuberculosis complex-restricted gene cfp32 encodes an expressed protein that is
detectable in tuberculosis patients and is positively correlated with pulmonary
interleukin-10. Infect. Immun. 71: 6871– 6883.
38. Freeman, G. H., and J. H. Halton. 1951. Note on an exact treatment of contingency, goodness of fit and other problems of significance. Biometrika 38:
141–149.
39. Verbeke, G., and G. Molenberghs. 2000. Linear Mixed Models for Longitudinal
Data. Springer, New York.
40. Diggle, P. J., P. Heagerty, K. Y. Liang, and S. L. Zeger. 2002. The Analysis of
Longitudinal Data, 2nd Ed. Oxford University Press, Oxford.
41. Sahiratmadja, E., B. Alisjahbana, T. de Boer, I. Adnan, A. Maya,
H. Danusantoso, R. H. Nelwan, S. Marzuki, J. W. van der Meer, R. van Crevel,
et al. 2007. Dynamic changes in pro- and anti-inflammatory cytokine profiles and
␥ interferon receptor signaling integrity correlate with tuberculosis disease activity and response to curative treatment. Infect. Immun. 75: 820 – 829.
42. Schwander, S. K., M. Torres, C. C. Carranza, D. Escobedo, M. Tary-Lehmann,
P. Anderson, Z. Toossi, J. J. Ellner, E. A. Rich, and E. Sada. 2000. Pulmonary
mononuclear cell responses to antigens of Mycobacterium tuberculosis in healthy
household contacts of patients with active tuberculosis and healthy controls from
the community. J. Immunol. 165: 1479 –1485.
43. Taha, R. A., T. C. Kotsimbos, Y. L. Song, D. Menzies, and Q. Hamid. 1997.
IFN-␥ and IL-12 are increased in active compared with inactive tuberculosis.
Am. J. Respir. Crit. Care. Med. 155: 1135–1139.
44. Grassi, M., M. Bocchino, A. Marruchella, E. Volpe, C. Saltini, V. Colizzi, and
F. Mariani. 2006. Transcriptional profile of the immune response in the lungs of
patients with active tuberculosis. Clin. Immunol. 1201: 100 –107.
45. Weiner, H. L. 2001. The mucosal milieu creates tolerogenic dendritic cells and
TR1 and TH3 regulatory cells. Nat. Immunol. 2: 671– 672.
46. Zeller, J. C., A. Panoskaltsis-Mortari, W. J. Murphy, F. W. Ruscetti, S. Narula,
M. G. Roncarolo, and B. R. Blazar. 1999. Induction of CD4⫹ T cell alloantigenspecific hyporesponsiveness by IL-10 and TGF-␤. J. Immunol. 163: 3684 –3691.
47. Roque, S., C. Nobrega, R. Appelberg, and M. Correia-Neves. 2007. IL-10 underlies distinct susceptibility of BALB/c and C57BL/6 mice to Mycobacterium
avium infection and influences efficacy of antibiotic therapy. J. Immunol. 178:
8028 – 8035.
48. Hirsch, C. S., R. Hussain, Z. Toossi, G. Dawood, F. Shahid, and J. J. Ellner. 1996.
Cross-modulation by transforming growth factor ␤ in human tuberculosis: suppression of antigen-driven blastogenesis and interferon ␥ production. Proc. Natl.
Acad. Sci. USA 93: 3193–3198.
49. Maeda, H., and A. Shiraishi. 1996. TGF-␤ contributes to the shift toward Th2type responses through direct and IL-10-mediated pathways in tumor-bearing
mice. J. Immunol. 156: 73–78.
50. Othieno, C., C. S. Hirsch, B. D. Hamilton, K. Wilkinson, J. J. Ellner, and
Z. Toossi. 1999. Interaction of Mycobacterium tuberculosis-induced transforming growth factor ␤1 and interleukin-10. Infect. Immun. 67: 5730 –5735.
51. Rojas, R. E., K. N. Balaji, A. Subramanian, and W. H. Boom. 1999. Regulation
of human CD4⫹ ␣␤ T-cell-receptor-positive (TCR⫹) and ␥␦ TCR⫹ T-cell responses to Mycobacterium tuberculosis by interleukin-10 and transforming
growth factor ␤. Infect. Immun. 67: 6461– 6472.
52. Hirsch, C. S., J. J. Ellner, R. Blinkhorn, and Z. Toossi. 1997. In vitro restoration
of T cell responses in tuberculosis and augmentation of monocyte effector function against Mycobacterium tuberculosis by natural inhibitors of transforming
growth factor ␤. Proc. Natl. Acad. Sci. USA 94: 3926 –3931.
53. Olobo, J. O., M. Geletu, A. Demissie, T. Eguale, K. Hiwot, G. Aderaye, and
S. Britton. 2001. Circulating TNF-␣, TGF-␤, and IL-10 in tuberculosis patients
and healthy contacts. Scand. J. Immunol. 53: 85–91.
54. Torres, M., T. Herrera, H. Villareal, E. A. Rich, and E. Sada. 1998. Cytokine
profiles for peripheral blood lymphocytes from patients with active pulmonary
tuberculosis and healthy household contacts in response to the 30-kilodalton antigen of Mycobacterium tuberculosis. Infect. Immun. 66: 176 –180.
55. Fulton, S. A., J. V. Cross, Z. T. Toossi, and W. H. Boom. 1998. Regulation of
interleukin-12 by interleukin-10, transforming growth factor-␤, tumor necrosis
factor-␣, and interferon-␥ in human monocytes infected with Mycobacterium
tuberculosis H37Ra. J. Infect. Dis. 178: 1105–1114.
56. Hirsch, C. S., T. Yoneda, L. Averill, J. J. Ellner, and Z. Toossi. 1994. Enhancement of intracellular growth of Mycobacterium tuberculosis in human monocytes
by transforming growth factor-␤1. J. Infect. Dis. 170: 1229 –1237.
57. Cho, M. L., J. W. Kang, Y. M. Moon, H. J. Nam, J. Y. Jhun, S. B. Heo, H. T. Jin,
S. Y. Min, J. H. Ju, K. S. Park, et al. 2006. STAT3 and NF-␬B signal pathway
is required for IL-23-mediated IL-17 production in spontaneous arthritis animal
model IL-1 receptor antagonist-deficient mice. J. Immunol. 176: 5652–5661.
58. Juffermans, N. P., A. Verbon, J. T. Belisle, P. J. Hill, P. Speelman,
S. J. van Deventer, and T. van der Poll. 2000. Mycobacterial lipoarabinomannan
induces an inflammatory response in the mouse lung: a role for interleukin-1.
Am. J. Respir. Crit. Care. Med. 162: 486 – 489.
59. Chaussabel, D., R. T. Semnani, M. A. McDowell, D. Sacks, A. Sher, and
T. B. Nutman. 2003. Unique gene expression profiles of human macrophages and
dendritic cells to phylogenetically distinct parasites. Blood 102: 672– 681.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
9. Nicholson, S., G. Bonecini-Almeida, J. R. Lapa e Silva, C. Nathan, Q. W. Xie,
R. Mumford, J. R. Weidner, J. Calaycay, J. Geng, N. Boechat, et al. 1996. Inducible nitric oxide synthase in pulmonary alveolar macrophages from patients
with tuberculosis. J. Exp. Med. 183: 2293–2302.
10. Wang, C. H., C. Y. Liu, H. C. Lin, C. T. Yu, K. F. Chung, and H. P. Kuo. 1998.
Increased exhaled nitric oxide in active pulmonary tuberculosis due to inducible
NO synthase upregulation in alveolar macrophages. Eur. Respir. J. 11: 809 – 815.
11. Rich, E. A., M. Torres, E. Sada, C. K. Finegan, B. D. Hamilton, and Z. Toossi.
1997. Mycobacterium tuberculosis (MTB)-stimulated production of nitric oxide
by human alveolar macrophages and relationship of nitric oxide production to
growth inhibition of MTB. Tuber. Lung Dis. 78: 247–255.
12. Boussiotis, V. A., E. Y. Tsai, E. J. Yunis, S. Thim, J. C. Delgado, C. C. Dascher,
A. Berezovskaya, D. Rousset, J. M. Reynes, and A. E. Goldfeld. 2000. IL-10producing T cells suppress immune responses in anergic tuberculosis patients.
J. Clin. Invest. 105: 1317–1325.
13. Toossi, Z., M. E. Kleinhenz, and J. J. Ellner. 1986. Defective interleukin 2 production and responsiveness in human pulmonary tuberculosis. J. Exp. Med. 163:
1162–1172.
14. Gorelik, L., and R. A. Flavell. 2002. Transforming growth factor-␤ in T-cell
biology. Nat. Rev. Immunol. 2: 46 –53.
15. Moore, K. W., R. de Waal Malefyt, R. L. Coffman, and A. O’Garra. 2001. Interleukin-10 and the interleukin-10 receptor. Annu. Rev. Immunol. 19: 683–765.
16. Jacobs, M., N. Brown, N. Allie, R. Gulert, and B. Ryffel. 2000. Increased resistance to mycobacterial infection in the absence of interleukin-10. Immunology
100: 494 –501.
17. Turner, J., M. Gonzalez-Juarrero, D. L. Ellis, R. J. Basaraba, A. Kipnis,
I. M. Orme, and A. M. Cooper. 2002. In vivo IL-10 production reactivates
chronic pulmonary tuberculosis in C57BL/6 mice. J. Immunol. 169: 6343– 6351.
18. Bonecini-Almeida, M. G., J. L. Ho, N. Boechat, R. C. Huard, S. Chitale, H. Doo,
J. Geng, L. Rego, L. C. Lazzarini, A. L. Kritski, et al. 2004. Down-modulation
of lung immune responses by interleukin-10 and transforming growth factor ␤
(TGF-␤) and analysis of TGF-␤ receptors I and II in active tuberculosis. Infect.
Immun. 72: 2628 –2634.
19. Cunha, F. Q., S. Moncada, and F. Y. Liew. 1992. Interleukin-10 (IL-10) inhibits
the induction of nitric oxide synthase by interferon-␥ in murine macrophages.
Biochem. Biophys. Res. Commun. 182: 1155–1159.
20. Ding, A., C. F. Nathan, J. Graycar, R. Derynck, D. J. Stuehr, and S. Srimal. 1990.
Macrophage deactivating factor and transforming growth factors-␤1, -␤2, and
-␤3 inhibit induction of macrophage nitrogen oxide synthesis by IFN-␥. J. Immunol. 145: 940 –944.
21. Dinarello, C. A. 2005. Blocking IL-1 in systemic inflammation. J. Exp. Med. 201:
1355–1359.
22. Nambu, A., S. Nakae, and Y. Iwakura. 2006. IL-1␤, but not IL-1␣, is required for
antigen-specific T cell activation and the induction of local inflammation in the
delayed-type hypersensitivity responses. Int. Immunol. 18: 701–712.
23. Odemuyiwa, S. O., A. Ghahary, Y. Li, L. Puttagunta, J. E. Lee, S. Musat-Marcu,
A. Ghahary, and R. Moqbel. 2004. Cutting edge: human eosinophils regulate T
cell subset selection through indoleamine 2,3-dioxygenase. J. Immunol. 173:
5909 –5913.
24. Mellor, A. 2005. Indoleamine 2,3 dioxygenase and regulation of T cell immunity.
Biochem. Biophys. Res. Commun. 338: 20 –24.
25. Mellor, A. L., and D. H. Munn. 2004. IDO expression by dendritic cells: tolerance and tryptophan catabolism. Nat. Rev. Immunol. 4: 762–774.
26. van der Sluijs, K. F., M. Nijhuis, J. H. Levels, S. Florquin, A. L. Mellor,
H. M. Jansen, T. van der Poll, and R. Lutter. 2006. Influenza-induced expression
of indoleamine 2,3-dioxygenase enhances interleukin-10 production and bacterial
outgrowth during secondary pneumococcal pneumonia. J. Infect. Dis. 193:
214 –222.
27. Koh, W. L., and M. L. Ng. 2005. Molecular mechanisms of West Nile virus
pathogenesis in brain cell. Emerg. Infect. Dis. 11: 629 – 632.
28. Yoshimura, A., T. Naka, and M. Kubo. 2007. SOCS proteins, cytokine signaling
and immune regulation. Nat. Rev. Immunol. 7: 454 – 465.
29. Alexander, W. S., and D. J. Hilton. 2004. The role of suppressors of cytokine
signaling (SOCS) proteins in regulation of the immune response. Annu. Rev.
Immunol. 22: 503–529.
30. Imai, K., T. Kurita-Ochiai, and K. Ochiai. 2003. Mycobacterium bovis bacillus
Calmette-Guerin infection promotes SOCS induction and inhibits IFN-␥-stimulated JAK/STAT signaling in J774 macrophages. FEMS Immunol. Med. Microbiol. 39: 173–180.
31. Kobayashi, K., L. D. Hernandez, J. E. Galan, C. A. Janeway, Jr., R. Medzhitov,
and R. A. Flavell. 2002. IRAK-M is a negative regulator of Toll-like receptor
signaling. Cell 110: 191–202.
32. Nakayama, K., S. Okugawa, S. Yanagimoto, T. Kitazawa, K. Tsukada,
M. Kawada, S. Kimura, K. Hirai, Y. Takagaki, and Y. Ota. 2004. Involvement of
IRAK-M in peptidoglycan-induced tolerance in macrophages. J. Biol. Chem. 279:
6629 – 6634.
33. Moodley, Y. P., T. Dorasamy, S. Venketasamy, V. Naicker, and U. G. Lalloo.
2000. Correlation of CD4:CD8 ratio and tumor necrosis factor (TNF) ␣ levels in
induced sputum with bronchoalveolar lavage fluid in pulmonary sarcoidosis. Thorax 55: 696 – 699.
34. Henig, N. R., M. R. Tonelli, M. V. Pier, J. L. Burns, and M. L. Aitken. 2001.
Sputum induction as a research tool for sampling the airways of subjects with
cystic fibrosis. Thorax 56: 306 –311.
35. Conde, M. B., A. C. Loivos, V. M. Rezende, S. L. Soares, F. C. Mello,
A. L. Reingold, C. L. Daley, and A. L. Kritski. 2003. Yield of sputum induction
in the diagnosis of pleural tuberculosis. Am. J. Respir. Crit. Care Med. 167:
723–725.
The Journal of Immunology
70.
71.
72.
73.
74.
75.
76.
77.
78.
79.
80.
ated pathogen recognition in resistance to airborne infection with Mycobacterium
tuberculosis. J. Immunol. 169: 3480 –3484.
Abel, B., N. Thieblemont, V. J. Quesniaux, N. Brown, J. Mpagi, K. Miyake,
F. Bihl, and B. Ryffel. 2002. Toll-like receptor 4 expression is required to control
chronic Mycobacterium tuberculosis infection in mice. J. Immunol. 169:
3155–3162.
Noss, E. H., R. K. Pai, T. J. Sellati, J. D. Radolf, J. Belisle, D. T. Golenbock,
W. H. Boom, and C. V. Harding. 2001. Toll-like receptor 2-dependent inhibition
of macrophage class II MHC expression and antigen processing by 19-kDa lipoprotein of Mycobacterium tuberculosis. J. Immunol. 167: 910 –918.
Pathak, S. K., S. Basu, K. K. Basu, A. Banerjee, S. Pathak, A. Bhattacharyya,
T. Kaisho, M. Kundu, and J. Basu. 2007. Direct extracellular interaction between
the early secreted antigen ESAT-6 of Mycobacterium tuberculosis and TLR2
inhibits TLR signaling in macrophages. Nat. Immunol. 8: 610 – 618.
Jang, S., S. Uematsu, S. Akira, and P. Salgame. 2004. IL-6 and IL-10 induction
from dendritic cells in response to Mycobacterium tuberculosis is predominantly
dependent on TLR2-mediated recognition. J. Immunol. 173: 3392–3397.
Re, F., and J. L. Strominger. 2001. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells. J. Biol. Chem. 276: 37692–37699.
Salgame, P. 2005. Host innate and Th1 responses and the bacterial factors that
control Mycobacterium tuberculosis infection. Curr. Opin. Immunol. 17:
374 –380.
Moss, W. J., M. O. Ota, and D. E. Griffin. 2004. Measles: immune suppression
and immune responses. Int. J. Biochem. Cell Biol. 36: 1380 –1385.
Kerdiles, Y. M., C. I. Sellin, J. Druelle, and B. Horvat. 2006. Immunosuppression
caused by measles virus: role of viral proteins. Rev. Med. Virol. 16: 49 – 63.
Verver, S., R. M. Warren, N. Beyers, M. Richardson, G. D. van der Spuy,
M. W. Borgdorff, D. A. Enarson, M. A. Behr, and P. D. van Helden. 2005. Rate
of reinfection tuberculosis after successful treatment is higher than rate of new
tuberculosis. Am. J. Respir. Crit. Care Med. 171: 1430 –1435.
Perrin, F. M., M. C. Lipman, T. D. McHugh, and S. H. Gillespie. 2007. Biomarkers of treatment response in clinical trials of novel antituberculosis agents. Lancet Infect. Dis. 7: 481– 490.
Wallis, R. S. 2007. Surrogate markers to assess new therapies for drug-resistant
tuberculosis. Expert. Rev. Anti Infect. Ther. 5: 163–168.
Downloaded from http://www.jimmunol.org/ by guest on June 15, 2017
60. Vijayakrishnan, L., K. Natarajan, V. Manivel, S. Raisuddin, and K. V. Rao. 2000.
B cell responses to a peptide epitope. IX. The kinetics of antigen binding differentially regulates costimulatory capacity of activated B cells. J. Immunol. 164:
5605–5614.
61. Balkhi, M. Y., V. K. Latchumanan, B. Singh, P. Sharma, and K. Natarajan. 2004.
Cross-regulation of CD86 by CD80 differentially regulates T helper responses
from Mycobacterium tuberculosis secretory antigen-activated dendritic cell subsets. J. Leukocyte. Biol. 75: 874 – 883.
62. Balkhi, M. Y., A. Sinha, and K. Natarajan. 2004. Dominance of CD86, transforming growth factor-␤1, and interleukin-10 in Mycobacterium tuberculosis secretory antigen-activated dendritic cells regulates T helper 1 responses to mycobacterial antigens. J. Infect. Dis. 189: 1598 –1609.
63. Manca, C., L. Tsenova, S. Freeman, A. K. Barczak, M. Tovey, P. J. Murray,
C. Barry, and G. Kaplan. 2005. Hypervirulent M. tuberculosis W/Beijing strains
upregulate type I IFNs and increase expression of negative regulators of the
Jak-Stat pathway. J. Interferon Cytokine Res. 25: 694 –701.
64. Chong, M. M., D. Metcalf, E. Jamieson, W. S. Alexander, and T. W. Kay. 2005.
Suppressor of cytokine signaling-1 in T cells and macrophages is critical for
preventing lethal inflammation. Blood 106: 1668 –1675.
65. Seki, Y., H. Inoue, N. Nagata, K. Hayashi, S. Fukuyama, K. Matsumoto,
O. Komine, S. Hamano, K. Himeno, K. Inagaki-Ohara, et al. 2003. SOCS-3
regulates onset and maintenance of TH2-mediated allergic responses. Nat. Med.
9: 1047–1054.
66. Song, X. T., K. Evel-Kabler, L. Rollins, M. Aldrich, F. Gao, X. F. Huang, and
S. Y. Chen. 2006. An alternative and effective HIV vaccination approach based
on inhibition of antigen presentation attenuators in dendritic cells. PLoS. Med.
3: e11.
67. Fremond, C. M., V. Yeremeev, D. M. Nicolle, M. Jacobs, V. F. Quesniaux, and
B. Ryffel. 2004. Fatal Mycobacterium tuberculosis infection despite adaptive
immune response in the absence of MyD88. J. Clin. Invest. 114: 1790 –1799.
68. Bafica, A., C. A. Scanga, C. G. Feng, C. Leifer, A. Cheever, and A. Sher. 2005.
TLR9 regulates Th1 responses and cooperates with TLR2 in mediating optimal
resistance to Mycobacterium tuberculosis. J. Exp. Med. 202: 1715–1724.
69. Reiling, N., C. Holscher, A. Fehrenbach, S. Kroger, C. J. Kirschning, S. Goyert,
and S. Ehlers. 2002. Cutting edge: Toll-like receptor (TLR)2- and TLR4-medi-
731