• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Type III secretion: The bacteria-eukaryotic cell
Type III secretion: The bacteria-eukaryotic cell

... 2. The injectisome nanomachine The electron microscopy (EM) visualization of the first injectisome, from Salmonella enterica, was reported in 1998 [1]. Afterwards, EM studies allowed the visualization of the complete injectisomes from Shigella flexneri [2] and EPEC [3]. Recently, cryo-EM analyses allo ...
Tan2
Tan2

... animal and plant kingdoms suggests that antimicrobial peptides have served a fundamental role in the successful evolution of complex multicellular organisms. The fundamental structural principle underlying all classes is the ability of the molecule to adopt a shape in which clusters of hydrophobic a ...
Integrin modulation of signaling to transcription factors
Integrin modulation of signaling to transcription factors

... transactivation potential (Aplin et al., 2001). ERK import into the nucleus is dependent upon both its phosphorylation and homodimerization (Khokhlatchev et al., 1998). The GTPase Ran is important for the transport of a wide variety of molecules in and out of the nucleus (Gorlich and Kutay, 1999). I ...
A biofilm-forming marine bacterium producing proteins
A biofilm-forming marine bacterium producing proteins

... another cell bound fraction, non soluble in a salt solution (36g/l). None of them is pure. EPS1 consists mainly in a majority of carbohydrates while the two others consist mainly in a majority of proteins. ™Gel electrophoresis analysis showed different EPS proteins composition with molecular weight ...
Measuring the stiffness of bacterial cells from growth
Measuring the stiffness of bacterial cells from growth

... extendable platform that accommodates the assaying of cellular mechanical properties in a wide variety of bacteria and other organisms, including yeast and fungi. We used agarose as the polymer for encapsulating bacteria for several reasons, including: (i) it is biocompatible and has been used previ ...
Plant mitochondria move on F-actin, but their positioning in the
Plant mitochondria move on F-actin, but their positioning in the

... for a movie). No particular positioning of these cortical mitochondria was observed besides an association with chloroplasts. In the protoplasts, latrunculin B causes all mitochondria to cluster around chloroplasts and small disc-shaped structures (Fig. 3F). In the young cells part of the mitochondr ...
Functional Anthology of Intrinsic Disorder. 1. Biological Processes
Functional Anthology of Intrinsic Disorder. 1. Biological Processes

... in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quali ...
Translocation of Magnaporthe oryzae Effectors into
Translocation of Magnaporthe oryzae Effectors into

... fluorescent protein. These proteins accumulated in a novel structure, the biotrophic interfacial complex (BIC). BIC development is coupled to hyphal differentiation from filamentous to pseudohyphal (Veses and Gow, 2009) bulbous IH growth, which is required for disease development. PWL2 and BAS1, pat ...
Electron Tomographic Analysis of Somatic Cell
Electron Tomographic Analysis of Somatic Cell

... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
Extensive Involvement of Autophagy In Alzheimer`s Disease: An
Extensive Involvement of Autophagy In Alzheimer`s Disease: An

... particular morphologic type, e.g., multilamellar bodies (inset arrows), or double-membranelimited dense vesicles (arrowheads), often characterized specific abnormal neurites (Fig. 2). Immuno-electron microscopy of autophagic vacuole subtypes Using immunogold electron microscopy, we further distingui ...
FYB Sc. Biotechnology
FYB Sc. Biotechnology

... Plant cell biology – Unique features of a plant cell b) Functional Principles and fundamental processes of plant growth and development, In vivo morphogenesis, Introduction to in vitro morphogenesis Pigments in plant growth and development, Major pathways in plant metabolism. Introduction to physiol ...
Cell cycle: Checkpoint proteins and kinetochores
Cell cycle: Checkpoint proteins and kinetochores

Research Interests
Research Interests

... circumblastoporally, but rather than this convergence producing extension along the anterior-posterior axis, the convergence is channeled into thickening in the radial direction. Convergent thickening occurs around the ventral blastopore lip of Xenopus (Keller and Danilchik, 1988) and generates a co ...
Mutations in the conserved carboxy-terminal hydrophobic region of
Mutations in the conserved carboxy-terminal hydrophobic region of

... mutagenized following the procedure of Kunkel et al. (1987). The oligonucleotides used for mutagenesis were GCCGGCCTGGCGGCAAGCTTCTTCGCCTTT, GGGCGTGTCCTCGAGCATGTCCAACCCTT, CTTCGAGGGGATGAGAGATCTGGGGCGCGCGGT, GATGGGCGACCTGAATCGCGCGGTCGGCAA, GTATCGGCCGTGTCGAACGTCTCCTCTCCTCCTTCA and CCTTCATGTCCAACCTCTTTG ...
PDF
PDF

... Histochemical localization of cholinesterase activity in developing limb From stage-16H.H. embryos, cholinesterase activity is localized in the whole ectodermal layer, mainly in the dorsal side of the limb (Fig. 1). The positive reaction is found in most of the ectodermal cells, either in the outer ...
The role of histidine residues in low-pH-mediated viral
The role of histidine residues in low-pH-mediated viral

... structure. His244 does not form a salt bridge in the post-fusion structure of the dengue viral E protein, but in the tick borne encephalitis (TBE) viral E protein the equivalent residue His248 does form a salt bridge with Asp253. These histidine residues are located at molecular interfaces, His317 a ...
The Sad1-UNC-84 homology domain in Mps3 interacts with Mps2 to
The Sad1-UNC-84 homology domain in Mps3 interacts with Mps2 to

... of its structure and function at a molecular level are only beginning to emerge. Four proteins are found at the half-bridge: Cdc31, Kar1, Mps3, and Sfi1. Kar1 and Mps3 are integral membrane proteins that localize to the cytoplasmic and nuclear sides of the half-bridge, respectively (Spang et al., 19 ...
Electron Tomographic Analysis of Somatic Cell Plate Formation in
Electron Tomographic Analysis of Somatic Cell Plate Formation in

... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
Cytochrome c Is Released in a Reactive Oxygen
Cytochrome c Is Released in a Reactive Oxygen

... Cyt c release from mitochondria was investigated by immunoblot analysis using a monoclonal antibody against cyt c. Both cytosolic and mitochondrial fractions, obtained from TBY-2 cells subjected to HS (cells in these conditions will be referred to as HS cells), were examined. Typical immunoblots are ...
Severe osmotic compression triggers a slowdown of
Severe osmotic compression triggers a slowdown of

... association rates of several proteins inside the cell. Molecular crowding has received little attention in living cells, although it is usually invoked to explain why biochemical reactions rates may vary in vivo and in vitro (26–29). For instance, the diffusion coefficient of the green fluorescent pro ...
Document
Document

... SPEARE -SHAKE ...
Quantification of gap junction selectivity
Quantification of gap junction selectivity

... the measured single-channel conductance (␥j), suggesting that they impede the flow of cations when present. Whether the cation/anion preference of gap junction channels is more extreme for molecules near the size limit of the channel’s pore has not been explored quantitatively, but were this the cas ...
Apoptotic cell removal
Apoptotic cell removal

Electron Tomographic Analysis of Somatic Cell Plate Formation in
Electron Tomographic Analysis of Somatic Cell Plate Formation in

... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
Membrane Bistability in Olfactory Bulb Mitral Cells
Membrane Bistability in Olfactory Bulb Mitral Cells

... remain unclear. The present study therefore further investigated the membrane properties of mitral cells. The results show that mitral cells are bistable, maintaining two levels of membrane potential with different responsiveness to ON input. Active properties of the mitral cell membrane, operating ...
< 1 ... 79 80 81 82 83 84 85 86 87 ... 1009 >

Endomembrane system

The endomembrane system is composed of the different membranes that are suspended in the cytoplasm within a eukaryotic cell. These membranes divide the cell into functional and structural compartments, or organelles. In eukaryotes the organelles of the endomembrane system include: the nuclear membrane, the endoplasmic reticulum, the Golgi apparatus, lysosomes, vesicles, endosomes and the cell membrane. The system is defined more accurately as the set of membranes that form a single functional and developmental unit, either being connected directly, or exchanging material through vesicle transport. Importantly, the endomembrane system does not include the membranes of mitochondria or chloroplasts.The nuclear membrane contains two lipid bilayers that encompass the contents of the nucleus. The endoplasmic reticulum (ER) is a synthesis and transport organelle that branches into the cytoplasm in plant and animal cells. The Golgi apparatus is a series of multiple compartments where molecules are packaged for delivery to other cell components or for secretion from the cell. Vacuoles, which are found in both plant and animal cells (though much bigger in plant cells), are responsible for maintaining the shape and structure of the cell as well as storing waste products. A vesicle is a relatively small, membrane-enclosed sac that stores or transports substances. The cell membrane, is a protective barrier that regulates what enters and leaves the cell. There is also an organelle known as the Spitzenkörper that is only found in fungi, and is connected with hyphal tip growth.In prokaryotes endomembranes are rare, although in many photosynthetic bacteria the plasma membrane is highly folded and most of the cell cytoplasm is filled with layers of light-gathering membrane. These light-gathering membranes may even form enclosed structures called chlorosomes in green sulfur bacteria.The organelles of the endomembrane system are related through direct contact or by the transfer of membrane segments as vesicles. Despite these relationships, the various membranes are not identical in structure and function. The thickness, molecular composition, and metabolic behavior of a membrane are not fixed, they may be modified several times during the membrane's life. One unifying characteristic the membranes share is a lipid bilayer, with proteins attached to either side or traversing them.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report