Type III secretion: The bacteria-eukaryotic cell
... 2. The injectisome nanomachine The electron microscopy (EM) visualization of the first injectisome, from Salmonella enterica, was reported in 1998 [1]. Afterwards, EM studies allowed the visualization of the complete injectisomes from Shigella flexneri [2] and EPEC [3]. Recently, cryo-EM analyses allo ...
... 2. The injectisome nanomachine The electron microscopy (EM) visualization of the first injectisome, from Salmonella enterica, was reported in 1998 [1]. Afterwards, EM studies allowed the visualization of the complete injectisomes from Shigella flexneri [2] and EPEC [3]. Recently, cryo-EM analyses allo ...
Tan2
... animal and plant kingdoms suggests that antimicrobial peptides have served a fundamental role in the successful evolution of complex multicellular organisms. The fundamental structural principle underlying all classes is the ability of the molecule to adopt a shape in which clusters of hydrophobic a ...
... animal and plant kingdoms suggests that antimicrobial peptides have served a fundamental role in the successful evolution of complex multicellular organisms. The fundamental structural principle underlying all classes is the ability of the molecule to adopt a shape in which clusters of hydrophobic a ...
Integrin modulation of signaling to transcription factors
... transactivation potential (Aplin et al., 2001). ERK import into the nucleus is dependent upon both its phosphorylation and homodimerization (Khokhlatchev et al., 1998). The GTPase Ran is important for the transport of a wide variety of molecules in and out of the nucleus (Gorlich and Kutay, 1999). I ...
... transactivation potential (Aplin et al., 2001). ERK import into the nucleus is dependent upon both its phosphorylation and homodimerization (Khokhlatchev et al., 1998). The GTPase Ran is important for the transport of a wide variety of molecules in and out of the nucleus (Gorlich and Kutay, 1999). I ...
A biofilm-forming marine bacterium producing proteins
... another cell bound fraction, non soluble in a salt solution (36g/l). None of them is pure. EPS1 consists mainly in a majority of carbohydrates while the two others consist mainly in a majority of proteins. Gel electrophoresis analysis showed different EPS proteins composition with molecular weight ...
... another cell bound fraction, non soluble in a salt solution (36g/l). None of them is pure. EPS1 consists mainly in a majority of carbohydrates while the two others consist mainly in a majority of proteins. Gel electrophoresis analysis showed different EPS proteins composition with molecular weight ...
Measuring the stiffness of bacterial cells from growth
... extendable platform that accommodates the assaying of cellular mechanical properties in a wide variety of bacteria and other organisms, including yeast and fungi. We used agarose as the polymer for encapsulating bacteria for several reasons, including: (i) it is biocompatible and has been used previ ...
... extendable platform that accommodates the assaying of cellular mechanical properties in a wide variety of bacteria and other organisms, including yeast and fungi. We used agarose as the polymer for encapsulating bacteria for several reasons, including: (i) it is biocompatible and has been used previ ...
Plant mitochondria move on F-actin, but their positioning in the
... for a movie). No particular positioning of these cortical mitochondria was observed besides an association with chloroplasts. In the protoplasts, latrunculin B causes all mitochondria to cluster around chloroplasts and small disc-shaped structures (Fig. 3F). In the young cells part of the mitochondr ...
... for a movie). No particular positioning of these cortical mitochondria was observed besides an association with chloroplasts. In the protoplasts, latrunculin B causes all mitochondria to cluster around chloroplasts and small disc-shaped structures (Fig. 3F). In the young cells part of the mitochondr ...
Functional Anthology of Intrinsic Disorder. 1. Biological Processes
... in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quali ...
... in the Swiss-Prot database that correlate with intrinsic disorder. A statistical evaluation is employed to rank the significance of these correlations. Protein sequence data redundancy and the relationship between protein length and protein structure were taken into consideration to ensure the quali ...
Translocation of Magnaporthe oryzae Effectors into
... fluorescent protein. These proteins accumulated in a novel structure, the biotrophic interfacial complex (BIC). BIC development is coupled to hyphal differentiation from filamentous to pseudohyphal (Veses and Gow, 2009) bulbous IH growth, which is required for disease development. PWL2 and BAS1, pat ...
... fluorescent protein. These proteins accumulated in a novel structure, the biotrophic interfacial complex (BIC). BIC development is coupled to hyphal differentiation from filamentous to pseudohyphal (Veses and Gow, 2009) bulbous IH growth, which is required for disease development. PWL2 and BAS1, pat ...
Electron Tomographic Analysis of Somatic Cell
... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
Extensive Involvement of Autophagy In Alzheimer`s Disease: An
... particular morphologic type, e.g., multilamellar bodies (inset arrows), or double-membranelimited dense vesicles (arrowheads), often characterized specific abnormal neurites (Fig. 2). Immuno-electron microscopy of autophagic vacuole subtypes Using immunogold electron microscopy, we further distingui ...
... particular morphologic type, e.g., multilamellar bodies (inset arrows), or double-membranelimited dense vesicles (arrowheads), often characterized specific abnormal neurites (Fig. 2). Immuno-electron microscopy of autophagic vacuole subtypes Using immunogold electron microscopy, we further distingui ...
FYB Sc. Biotechnology
... Plant cell biology – Unique features of a plant cell b) Functional Principles and fundamental processes of plant growth and development, In vivo morphogenesis, Introduction to in vitro morphogenesis Pigments in plant growth and development, Major pathways in plant metabolism. Introduction to physiol ...
... Plant cell biology – Unique features of a plant cell b) Functional Principles and fundamental processes of plant growth and development, In vivo morphogenesis, Introduction to in vitro morphogenesis Pigments in plant growth and development, Major pathways in plant metabolism. Introduction to physiol ...
Research Interests
... circumblastoporally, but rather than this convergence producing extension along the anterior-posterior axis, the convergence is channeled into thickening in the radial direction. Convergent thickening occurs around the ventral blastopore lip of Xenopus (Keller and Danilchik, 1988) and generates a co ...
... circumblastoporally, but rather than this convergence producing extension along the anterior-posterior axis, the convergence is channeled into thickening in the radial direction. Convergent thickening occurs around the ventral blastopore lip of Xenopus (Keller and Danilchik, 1988) and generates a co ...
Mutations in the conserved carboxy-terminal hydrophobic region of
... mutagenized following the procedure of Kunkel et al. (1987). The oligonucleotides used for mutagenesis were GCCGGCCTGGCGGCAAGCTTCTTCGCCTTT, GGGCGTGTCCTCGAGCATGTCCAACCCTT, CTTCGAGGGGATGAGAGATCTGGGGCGCGCGGT, GATGGGCGACCTGAATCGCGCGGTCGGCAA, GTATCGGCCGTGTCGAACGTCTCCTCTCCTCCTTCA and CCTTCATGTCCAACCTCTTTG ...
... mutagenized following the procedure of Kunkel et al. (1987). The oligonucleotides used for mutagenesis were GCCGGCCTGGCGGCAAGCTTCTTCGCCTTT, GGGCGTGTCCTCGAGCATGTCCAACCCTT, CTTCGAGGGGATGAGAGATCTGGGGCGCGCGGT, GATGGGCGACCTGAATCGCGCGGTCGGCAA, GTATCGGCCGTGTCGAACGTCTCCTCTCCTCCTTCA and CCTTCATGTCCAACCTCTTTG ...
PDF
... Histochemical localization of cholinesterase activity in developing limb From stage-16H.H. embryos, cholinesterase activity is localized in the whole ectodermal layer, mainly in the dorsal side of the limb (Fig. 1). The positive reaction is found in most of the ectodermal cells, either in the outer ...
... Histochemical localization of cholinesterase activity in developing limb From stage-16H.H. embryos, cholinesterase activity is localized in the whole ectodermal layer, mainly in the dorsal side of the limb (Fig. 1). The positive reaction is found in most of the ectodermal cells, either in the outer ...
The role of histidine residues in low-pH-mediated viral
... structure. His244 does not form a salt bridge in the post-fusion structure of the dengue viral E protein, but in the tick borne encephalitis (TBE) viral E protein the equivalent residue His248 does form a salt bridge with Asp253. These histidine residues are located at molecular interfaces, His317 a ...
... structure. His244 does not form a salt bridge in the post-fusion structure of the dengue viral E protein, but in the tick borne encephalitis (TBE) viral E protein the equivalent residue His248 does form a salt bridge with Asp253. These histidine residues are located at molecular interfaces, His317 a ...
The Sad1-UNC-84 homology domain in Mps3 interacts with Mps2 to
... of its structure and function at a molecular level are only beginning to emerge. Four proteins are found at the half-bridge: Cdc31, Kar1, Mps3, and Sfi1. Kar1 and Mps3 are integral membrane proteins that localize to the cytoplasmic and nuclear sides of the half-bridge, respectively (Spang et al., 19 ...
... of its structure and function at a molecular level are only beginning to emerge. Four proteins are found at the half-bridge: Cdc31, Kar1, Mps3, and Sfi1. Kar1 and Mps3 are integral membrane proteins that localize to the cytoplasmic and nuclear sides of the half-bridge, respectively (Spang et al., 19 ...
Electron Tomographic Analysis of Somatic Cell Plate Formation in
... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
Cytochrome c Is Released in a Reactive Oxygen
... Cyt c release from mitochondria was investigated by immunoblot analysis using a monoclonal antibody against cyt c. Both cytosolic and mitochondrial fractions, obtained from TBY-2 cells subjected to HS (cells in these conditions will be referred to as HS cells), were examined. Typical immunoblots are ...
... Cyt c release from mitochondria was investigated by immunoblot analysis using a monoclonal antibody against cyt c. Both cytosolic and mitochondrial fractions, obtained from TBY-2 cells subjected to HS (cells in these conditions will be referred to as HS cells), were examined. Typical immunoblots are ...
Severe osmotic compression triggers a slowdown of
... association rates of several proteins inside the cell. Molecular crowding has received little attention in living cells, although it is usually invoked to explain why biochemical reactions rates may vary in vivo and in vitro (26–29). For instance, the diffusion coefficient of the green fluorescent pro ...
... association rates of several proteins inside the cell. Molecular crowding has received little attention in living cells, although it is usually invoked to explain why biochemical reactions rates may vary in vivo and in vitro (26–29). For instance, the diffusion coefficient of the green fluorescent pro ...
Quantification of gap junction selectivity
... the measured single-channel conductance (␥j), suggesting that they impede the flow of cations when present. Whether the cation/anion preference of gap junction channels is more extreme for molecules near the size limit of the channel’s pore has not been explored quantitatively, but were this the cas ...
... the measured single-channel conductance (␥j), suggesting that they impede the flow of cations when present. Whether the cation/anion preference of gap junction channels is more extreme for molecules near the size limit of the channel’s pore has not been explored quantitatively, but were this the cas ...
Electron Tomographic Analysis of Somatic Cell Plate Formation in
... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
... network (TN) stage and thereafter, the percentage of large-light vesicles increases to 60%, and the number of small-dark vesicles decreases to 40%. To determine the origin of the two types of vesicles, we compared the vesicles in the vicinity of the Golgi stacks near the spindle poles with those c ...
Membrane Bistability in Olfactory Bulb Mitral Cells
... remain unclear. The present study therefore further investigated the membrane properties of mitral cells. The results show that mitral cells are bistable, maintaining two levels of membrane potential with different responsiveness to ON input. Active properties of the mitral cell membrane, operating ...
... remain unclear. The present study therefore further investigated the membrane properties of mitral cells. The results show that mitral cells are bistable, maintaining two levels of membrane potential with different responsiveness to ON input. Active properties of the mitral cell membrane, operating ...