Download Mutations in the conserved carboxy-terminal hydrophobic region of

Journal
of General Virology (1999), 80, 3189–3198. Printed in Great Britain
...................................................................................................................................................................................................................................................................................
Mutations in the conserved carboxy-terminal hydrophobic
region of glycoprotein gB affect infectivity of herpes simplex
virus
Essam Wanas,† Sue Efler,‡ Kakoli Ghosh and Hara P. Ghosh
Department of Biochemistry, Health Sciences Centre, McMaster University, 1200 Main St W., Hamilton, Ontario, Canada L8N 3Z5
Glycoprotein gB is the most highly conserved glycoprotein in the herpesvirus family and plays a
critical role in virus entry and fusion. Glycoprotein gB of herpes simplex virus type 1 contains a
hydrophobic stretch of 69 aa near the carboxy terminus that is essential for its biological activity.
To determine the role(s) of specific amino acids in the carboxy-terminal hydrophobic region, a
number of amino acids were mutagenized that are highly conserved in this region within the gB
homologues of the family Herpesviridae. Three conserved residues in the membrane anchor
domain, namely A786, A790 and A791, as well as amino acids G743, G746, G766, G770 and
P774, that are non-variant in Herpesviridae, were mutagenized. The ability of the mutant proteins
to rescue the infectivity of the gB-null virus, K082, in trans was measured by a complementation
assay. All of the mutant proteins formed dimers and were incorporated in virion particles produced
in the complementation assay. Mutants G746N, G766N, F770S and P774L showed negligible
complementation of K082, whereas mutant G743R showed a reduced activity. Virion particles
containing these four mutant glycoproteins also showed a markedly reduced rate of entry
compared to the wild-type. The results suggest that non-variant residues in the carboxy-terminal
hydrophobic region of the gB protein may be important in virus infectivity.
Introduction
Herpes simplex virus type 1 (HSV-1) is an enveloped virus
whose genomic DNA encodes at least 11 glycoproteins
(Roizman & Sears, 1996). Four of these glycoproteins, namely
gB, gD, gH and gL, are essential for virus replication and are
required for virus entry and cell fusion (Cai et al., 1988 a ; Ligas
& Johnson, 1988 ; Roop et al., 1993). Glycoprotein gB is the
most highly conserved glycoprotein in the family Herpesviridae
(Pereira, 1994 ; Roizman & Sears, 1996). Homologues of gB
have been identified in all subfamilies of the Herpesviridae and
are essential for virus replication. Studies involving HSV-1 gB
glycoprotein (gB-1) have indicated essential roles of gB in virus
penetration, membrane fusion and cell-to-cell spreading (Cai et
al., 1988 a ; Little et al., 1981 ; Pereira, 1994 ; Spear, 1993). The
deduced sequence of gB-1 predicts the presence of a carboxyAuthor for correspondence : Hara Ghosh.
Fax j1 905 522 9033. e-mail ghosh!fhs.mcmaster.ca
† Present address : MBI Fermentas, Hamilton, ON, Canada.
‡ Present address : University of Ottawa, Ottawa, ON, Canada.
0001-6362 # 1999 SGM
terminal hydrophobic stretch of 69 aa which could serve as a
membrane anchor domain, a large cytoplasmic domain of
109 aa, an ectodomain of 696 residues containing N-linked
oligosaccharides and a cleavable signal sequence of 30 aa (Bzik
et al., 1984). The carboxy-terminal hydrophobic region was
proposed to have three segments containing 20–21 aa corresponding to residues 727–746 (segment 1), 752–772 (segment 2) and 775–795 (segment 3) which can traverse the
membrane three times (Pellett et al., 1985). Studies from our
laboratory using mutants with deletions in the predicted
membrane-anchoring sequence of the 69 aa residues in gB-1
protein showed that segment 3, encompassing residues
775–795, specified the membrane-anchoring domain and
segments 1 and 2 may be peripherally associated with the
membrane (Rasile et al., 1993). However, deletion of any of the
three hydrophobic segments individually or in combination
affected the intracellular transport and processing of the
mutant gB-1 proteins. The mutant glycoproteins were localized
in the nuclear envelope but failed to complement the gB-null
virus K082, indicating that the carboxy-terminal hydrophobic
region contains essential structural determinants of biologically
functional gB glycoprotein. Recent studies with gB glyco-
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
DBIJ
E. Wanas and others
proteins of human cytomegalovirus (HCMV) (Bold et al., 1996 ;
Reschke et al., 1995 ; Tugizov et al., 1995 ; Zheng et al., 1996)
and bovine herpesvirus-1 (BHV-1) (Li et al., 1997) also
identified that the most hydrophobic segment 3 functions as
the membrane anchor. However, truncation of any of the
hydrophobic segments affected intracellular transport and
processing. Segment 2 of BHV-1 gB protein, which includes
residues 785–771, and hydrophobic domain 1 of HCMV gB
protein, which includes residues 714–750, were also proposed
as fusogenic domains (Bold et al., 1996 ; Reschke et al., 1995).
Analyses of the amino acid sequences of gB homologues of
herpesviruses show that the carboxy-terminal hydrophobic
region is conserved and a number of residues are non-variant
within the Herpesviridae. The gB glycoproteins of the Alphaherpesvirinae, however, show a very high degree of homology
in this region and the membrane-anchoring segment 3 shows
the highest number of conserved amino acids (Pereira, 1994).
Complementation experiments showed that the gB glycoprotein of HSV-1 could be substituted with the corresponding
homologue from either BHV-1 (Misra & Blewett, 1991) or
pseudorabies virus (PrV) (Mettenleiter & Spear, 1994). Also,
gB-null PrV could be complemented by gB protein of BHV-1
(Kopp & Mettenleiter, 1992 ; Rauh et al., 1991). It was thus
suggested that homologues of gB may possess common
structural and functional domains. The highly conserved
residues in the carboxy-terminal hydrophobic region of gB
may, therefore, be essential for the biological activity of
herpesviruses.
In this report, we have attempted to determine the roles of
amino acids that are highly conserved within the carboxyterminal hydrophobic region of the gB homologues of
herpesviruses in virus infectivity by mutagenesis of these
residues. Conserved alanines in the membrane-anchoring
segment 3 of Alphaherpesvirinae were substituted by a number
of neutral polar residues. Two glycines in segment 1 as well as
glycine, phenylalanine and proline residues in segment 2, all of
which are non-variant in the gB homologues of Herpesviridae,
were also mutated. The mutant proteins were localized in the
nuclear envelope. Complementation with a gB null-virus
showed that mutants G746N, G766N, F770S and P774L
showed negligible infectivity whereas G743R showed reduced infectivity. Virus particles generated from the
complementation experiment containing these mutant glycoproteins also showed a markedly decreased rate of entry. The
results suggest that the non-variant residues present in the
carboxy-terminal hydrophobic domain of herpesvirus gB
protein may be important for infectivity.
Methods
Construction of mutant gB proteins. The gene encoding gB
protein of HSV-1 was cloned into the high efficiency eukaryotic
expression vector pXM (Yang et al., 1986) to produce the plasmid
pXMgB as described previously (Gilbert et al., 1994). The 2n1 kb
SalI–EcoRI fragment of pXMgB was cloned into M13 mp18 and was
DBJA
mutagenized following the procedure of Kunkel et al. (1987). The
oligonucleotides used for mutagenesis were GCCGGCCTGGCGGCAAGCTTCTTCGCCTTT, GGGCGTGTCCTCGAGCATGTCCAACCCTT, CTTCGAGGGGATGAGAGATCTGGGGCGCGCGGT, GATGGGCGACCTGAATCGCGCGGTCGGCAA, GTATCGGCCGTGTCGAACGTCTCCTCTCCTCCTTCA and CCTTCATGTCCAACCTCTTTGGGGCGCT for constructing mutants A791S, F770S, G743R,
G746N, G766N and P774L, respectively. Primers containing mixed
sequence oligonucleotides were synthesized by using a mixture of two
nucleotides at the specific mutagenesis position (Derbyshire et al., 1986).
The heterogeneous population of oligonucleotides was used in the
mutagenesis reaction to generate multiple substitution of specific residues.
The primers GCCGGCCTGGCGT(C)C(A)GGCCTTCTTCGCCTT and
CTGTTGGTCCTGA(T)A(C)CGGCCTGGCGGCGGCCTT were used
for mutagenesis of A790 and A786 to produce A790S or A790Q and
A786S, A786T, A786Y or A786N, respectively. The mutagenic
oligonucleotide was annealed to the template DNA and second-strand
synthesis was performed with Klenow DNA polymerase. The reaction
mixtures were used to transform competent Escherichia coli JM 109 cells.
The plaques were screened by nucleotide sequence analysis. The
replicative-form DNA from the mutant bacteriophage was digested with
SalI and EcoRI, and the fragment was ligated to the 6n8 kb fragment
obtained from EcoRI and SalI digestion of pXMgB DNA (pXM containing
the full-length gB-1 gene), thus regenerating pXMgB harbouring the
desired mutation in the gB gene. The mutants were also cloned into
pKBXX (Cai et al., 1988 b) with SnaBI and KpnI in order to perform the
complementation studies. The pKBXX plasmid was obtained from S.
Person (Johns Hopkins University, School of Medicine, Baltimore, MD,
USA).
Transfection, labelling and characterization of mutant
protein. Subconfluent monolayers of COS-1 cells were transfected by
the Ca (PO ) method, as described previously (Gilbert et al., 1994). The
$
%#
transfected cells were radiolabelled at 24 h post-transfection and the
mutant proteins were immunoprecipitated with a polyclonal anti-gB
antibody. Proteins were analysed by SDS–PAGE.
Intracellular transport and localization. Transport of the
mutant proteins from ER to the Golgi apparatus was determined by the
acquisition of endoglycosidase H (Endo H) resistance (Gilbert et al., 1994).
Transfected COS-1 cells were fixed with 2 % paraformaldehyde for cell
surface immunofluorescence. For internal immunofluorescence, cells were
fixed with 2 % paraformaldehyde and then treated with 1 % Triton X-100.
The cells were treated with a rabbit polyclonal anti-gB antibody and
stained with FITC-conjugated goat anti-rabbit IgG (Gilbert et al., 1994).
Oligomerization assay. The oligomeric state of wild-type and
mutant gB-1 proteins was determined by SDS–PAGE analysis of the
heat-dissociable, detergent-stable oligomers (Claesson-Welsh & Spear,
1986). Oligomeric forms of gB-1 were also detected by immunoprecipitation with a dimer-specific monoclonal antibody DL16 (Laquerre
et al., 1998).
Complementation assay. Complementation of the gB-null HSV1, K082, was carried out in Vero cells as described previously (Cai et al.,
1988 b ; Rasile et al., 1993). Briefly, 0n5–3n0 µg pKBXX plasmid encoding
the gB mutants was mixed with DEAE-dextran in a serum-free growth
medium. This mixture was added to 8i10& Vero cells and incubated at
37 mC for 2–4 h. After removal of DNA and washing, the cells were
incubated at 37 mC in regular growth medium. At 16–18 h posttransfection, the cells were infected with 2i10' p.f.u. of K082 virus and
incubated for 2 h at 37 mC. Virions remaining outside the cell were
removed by treatment with a glycine buffer (0n1 M glycine, pH 3n0). The
cells were incubated at 37 mC for 24 h and then harvested. Virus stocks
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
Mutations in HSV gB affect infectivity
were prepared and titres of the progeny virus particles were determined
on the gB-1-expressing VB38 cell line and Vero cells. The VB38 cells
(kindly donated by D. Johnson, Oregon Health Sciences University,
Portland, OR, USA) were constructed by integrating the HSV-1 gB gene
under the control of its own promoter into Vero cells using histidinol as
a selection marker.
Radiolabelling of progeny virus particles. Vero cells were
transfected with pKBXX plasmids followed by infection with K082 virus
as described for the complementation assay. Cells were labelled with
[$&S]methionine for 24 h and the virus was harvested. The labelled virus
stock was clarified by centrifugation at 3000 r.p.m. for 5 min. Virus
particles were pelleted through a cushion of 30 % sucrose solution by
centrifugation in a Beckman SW41 Ti rotor at 40 000 r.p.m. for 2 h at
4 mC. The pelleted virus was suspended in lysis buffer ; half of the
recovered radioactivity was immunoprecipitated with dimer-specific antigB antibody DL16 and analysed by SDS–PAGE.
Virus penetration assay. The rate of virus penetration was
determined by measuring the rate at which viruses adsorbed to cells
become resistant to inactivation by exposure to a low pH buffer
(Highlander et al., 1989). Confluent VB38 cells were incubated at 4 mC
with 250 p.f.u. progeny virus generated from the complementation
experiment. The cells were washed three times to remove unadsorbed
virus and incubated at 37 mC in the presence of complete medium when
the adsorbed viruses entered the cell. At various times after being shifted,
viruses that had not entered the cells were inactivated by exposure to
2 ml glycine buffer (0n1 M, pH 3n0) for 1 min while the control cells were
treated with Tris-buffered saline (TBS) (pH 7n4). The cells were washed
and overlaid with medium containing 0n5 % methyl cellulose and
incubated at 37 mC. After 36–48 h, cells were fixed and stained and the
plaques were counted. The percentage of penetrated virus was calculated
from the p.f.u. obtained with the sample treated with low pH buffer
versus the total plaque number (100 % entry) as obtained from the nonbuffer-treated sample.
Results
Rationale for mutagenesis in the carboxy-terminal
hydrophobic region of gB-1 glycoprotein
The amino acid sequence of the carboxy-terminal hydrophobic stretch encompassing residues 727–795 of HSV-1
glycoprotein gB-1 is shown in Fig. 1. Hydrophobic segments
of 20–21 aa corresponding to residues 727–746, 752–772 and
775–795 have been designated segments 1, 2 and 3, respectively (Rasile et al., 1993). A comparison of the sequence of
gB homologues of herpesviruses belonging to the Alpha-
Fig. 2. Expression of mutant gB glycoproteins. Subconfluent monolayers of
COS-1 cells were transfected with the mutant gB constructs. At 24 h posttransfection, the cells were starved in methionine-deficient medium for 1 h
and labelled with [35S]methionine for 2 h. Cell lysates were
immunoprecipitated with anti-gB antiserum and the immunoprecipitates
were subjected to electrophoresis on SDS–10 % polyacrylamide gels. The
gels were fluorographed, dried and exposed at k70 mC. The VSV marker
shows the G and N protein, molecular masses of 67 000 Da and 50 000
Da, respectively.
herpesvirinae shows a high degree of conservation of amino
acids in this region (Pereira, 1994). It may also be noted that a
number of residues, such as G743, G746, V764, G766, F770,
N773, P774 and F775, are non-variant in the gB homologues
of all herpesviruses. Maximum conservation is, however,
observed within segment 3 and within the Alphaherpesvirinae.
This segment is almost totally conserved suggesting a common
functional role. To determine whether these conserved residues
in segments 1, 2 and 3 of the hydrophobic region play a role
in the biological function of gB-1 glycoprotein, 13 amino acid
substitution mutants were constructed by site-directed mutagenesis (Fig. 1). The rationale behind the amino acid substitutions was to retain the hydrophobic character of the
particular region after mutagenesis. Thus, substitution of
alanine residues with serine, threonine or tyrosine did not
change the hydrophobicity markedly. Substitution of glycine
with asparagine or phenylalanine with serine reduced the
hydrophobicity slightly. All of these residues, however, are
present within the transmembrane anchor sequence of membrane proteins. In segment 1, the two non-variant glycines at
HSV-1
Fig. 1. Mutations in the hydrophobic carboxy-terminal regions of the HSV-1 glycoprotein B. Amino acids 725–798 are shown.
Boxed residues indicate the hydrophobic sequences corresponding to segment 1 (aa 727–746), segment 2 (aa 752–772),
and segment 3 (aa 775–795) (Rasile et al., 1993). Amino acids conserved in alphaherpesviruses are underlined. Residues
marked with an asterisk (*) are non-variant in gB glycoproteins of alpha-, beta- and gammaherpesviruses. Arrows indicate the
particular amino acid replacements with oligonucleotide-directed base changes. Mutants are designated according to the
corresponding wild-type residue, amino acid position and amino acid replacement, as indicated in the text.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
DBJB
E. Wanas and others
Fig. 3. Cell surface and intracellular localization of mutant gB proteins by immunofluorescence. COS-1 cells transfected with
mutant gB constructs were fixed with paraformaldehyde and processed for cell surface or internal immunofluorescence. For
internal immunofluorescence, cells were fixed with paraformaldehyde and then treated with 1 % Triton to permeabilize the cells.
DBJC
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
Mutations in HSV gB affect infectivity
positions 743 and 746 were changed to arginine and asparagine
to produce mutants G743R and G746N, respectively. Since
these glycine residues are located at the carboxy terminus of
segment 1, substitution with a charged polar residue or an
uncharged polar residue may affect the structural organization
of segments 1 and 2. In segment 2, the non-variant G766 and
F770 were changed to uncharged polar residues asparagine
and serine to generate mutants G766N and F770S, respectively. The non-variant proline-774 is located at the junction of
segments 2 and 3 and was substituted by a non-polar residue,
leucine. Within segment 3, A786 was mutated to serine,
threonine, asparagine or tyrosine to produce mutants A786S,
A786T, A786N or A786Y, whereas A790 was changed to
serine and glutamine to produce mutants A790S and A790Q.
Mutant A791S was obtained by changing A791 to serine. A
double mutant A786S\L788M was unexpectedly generated
during mutagenesis of A786, and was also used in this study.
It may be further noted that, in the case of mutants in segment
3, a non-polar residue was replaced with an uncharged polar
residue.
The hydrophobicities of each of the mutated segments
were determined by the Kyte–Doolittle algorithm (Kyte &
Doolittle, 1982) and the results show that the point mutations
did not significantly alter the hydrophobicities of the segments.
Determination of predicted secondary structures of the
substitution mutants in segment 3 using the Chou and Fasman
algorithm (Chou & Fasman, 1978) also did not show any
significant change in the α-helical nature of this segment.
Expression, intracellular transport and oligomerization
of mutant gB proteins
COS-1 cells transfected with pXM vector encoding the
mutant or the wild-type gB protein were metabolically labelled
with [$&S]methionine, and proteins immunoprecipitated with
anti-gB antiserum were analysed by PAGE. Fig. 2 shows that
all of the mutants of gB proteins were expressed and comigrated with wild-type gB which is 110–120 kDa.
The oligomeric states of the mutant gB glycoproteins were
examined by analyses of the heat-dissociable, detergent-stable
protein on SDS–polyacrylamide gels (Rasile et al., 1993). All of
the mutants similar to the wild-type gB showed the presence
of dimers which could be dissociated into monomers by
heating (data not presented). These results are in agreement
with the findings that the oligomerization domains of HSV-1
gB protein are localized in the ectodomain and not in the
carboxy-terminal hydrophobic region (Laquerre et al., 1996).
Intracellular localization of mutant glycoprotein by
immunofluorescence staining
The gB glycoprotein has been shown to be localized in the
ER, Golgi complex, cell surface and the nuclear envelope by
indirect immunofluorescence or immunoelectron microscopy
(Gilbert & Ghosh, 1993 ; Gilbert et al., 1994 ; Torrisi et al.,
1992). The intracellular localization of the mutant proteins was
determined by indirect immunofluorescence staining of COS1 cells transfected with wild-type or mutant gB gene. In
agreement with an earlier report, wild-type gB was localized in
the nuclear envelope and in the perinuclear structures representing Golgi complex and ER (Gilbert et al., 1994). All 13
mutant gB proteins showed similar distinct nuclear rim staining
(Fig. 3). The mutants also showed perinuclear labelling in
addition to the nuclear rim staining indicating ER and Golgi
localization. Examination for cell surface immunofluorescence
showed staining of the plasma membrane of cells expressing all
mutants except P774L. The mutants G743R and F770S showed
a much weaker staining at the cell surface. The rate of
intracellular transport was also determined by acquisition of
Endo H resistance. Results of Endo H digestion showed that
mutant P774L was completely sensitive to Endo H digestion
even after a chase of 2 h while mutants G743R and F770S
showed partial resistance. All of the other mutants showed
Endo H resistance pattern similar to wild-type gB protein (data
not shown).
Complementation of a gB-null virus by the gB-1
substitution mutants in the hydrophobic region
A trans complementation assay using wild-type or mutant
glycoproteins such as gB, gD or gH expressed from a
transfected plasmid and defective HSV virions lacking the
corresponding glycoprotein providing all other viral proteins,
has been extensively used to determine regions of the
glycoprotein that are essential for infectivity (Cai et al., 1988 a ;
Chiang et al., 1994 ; Wilson et al., 1994). The gB-null virus K082
has been used for complementation of mutant gB proteins to
delineate functional regions (Cai et al., 1988 a ; Rasile et al.,
1993). Functional complementation between gB proteins of
different herpesviruses using K082 virus as a complementing
virus have also been reported to determine their functional
homology (Mettenleiter & Spear, 1994). The abilities of the
mutant gB-1 proteins constructed by substitution of conserved
residues in the hydrophobic region to rescue the infectivity of
the gB-null virus, K082, were determined by the complementation assay. Vero cells were transfected with plasmid
pKBXX containing the wild-type gB-1 or the mutant constructs
and subsequently infected with K082 virus, which can grow
only on a gB-producing cell line such as D6 (Cai et al., 1988 a)
or VB38. The titres of progeny virus stock obtained from
transfected Vero cells after infection with K082 virus were
determined on both Vero and VB38 cells. The complementation efficiency was calculated as a percentage of plaquing
efficiency of the progeny virus obtained from mutant gB
transfected cells compared to the plaquing efficiency of the
progeny virus produced by transfection with wild-type gBcontaining plasmid. Plaquing efficiency of complemented virus
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
DBJD
E. Wanas and others
(a)
(b)
Fig. 5. Incorporation of mutant gB proteins into the virion. Vero cells
transfected with plasmids containing wild-type or mutant gB genes were
infected with K082 virus and labelled with [35S]methionine for 24 h.
Radioactive virus was isolated by pelleting through a 30 % sucrose
cushion. Radiolabelled viruses were suspended in lysis buffer,
immunoprecipitated and analysed by SDS–PAGE. Results shown in (a) and
(b) are from two separate experiments. WTgB, virus particles recovered
from cells transfected with wild-type gB gene. Virus particles recovered
from cells transfected with the gB mutants are indicated.
Fig. 4. Complementation of K082 virus by transfection with plasmids
containing mutant gB constructs. Vero cells were transfected with pKBXX
plasmid containing the wild-type gB or mutant gB constructs. After 24 h,
transfected cells were infected with K082 virus at an m.o.i. of 2. Virus
stocks were isolated 24 h later and titred in duplicate on both Vero and
VB38 cells. Virus produced by complementation of K082 with wild-type
gB showed titres of (5n2p1n5)i102 and (3n7p0n6)i106 p.f.u. per ml
in Vero and VB38 cells, respectively. The titres for virus produced in nontransfected Vero cells infected with K082 virus were (2n8p0n2)i102
and (6n4p0n8)i103 p.f.u. per ml in Vero and VB38 cells, respectively.
Titres are the average of three separate complementation experiments.
The titre on the non-complementing Vero cells could be due to a low level
contamination of wild-type virus in the K082 stock or from recombination
between transfected plasmid and K082 virus. Plaquing efficiency of
complemented virus was determined as the ratio of the titre on VB38 cells
to the titre on Vero cells. Complementation efficiency is expressed as the
percentage of plaquing efficiency of virus produced by transfection with
wild-type gB plasmid pKBXX. The error bars show standard deviation for
the three experiments.
is expressed as the ratio of the titre on VB38 cells to the titre
on Vero cells. The mutants A786S, A786T, A790S and A786S
L788M, could complement K082 virus as well as the wild-type
gB protein (Fig. 4). Mutants A786Y, A786N, A790Q, A791S
and G743R showed reduced complementation in the range
25–50 % of the wild-type. In contrast, mutants G746N,
DBJE
G766N, F770S and P774L showed negligible complementation
of K082 virus indicating that these non-variant residues may
be important for virus infectivity.
Incorporation of mutant gB proteins into virions
The negligibly low complementation efficiency of the
mutants G746N, G776N, F770S and P774L could be due to the
fact that although the mutants formed dimers and associated
with the nuclear envelope, they could not be incorporated into
the virion particles, suggesting that these conserved residues
may be required for the assembly of gB in the viral envelope.
Alternatively, the mutants were incorporated in the virion
particles, which were, however, non-infectious, suggesting the
possibility that particles containing mutant gB molecules were
incompetent for virus entry. The presence of mutant gB
molecules in the virion particles was, therefore, determined by
immunoprecipitation of the labelled proteins with a gB
antibody specific for dimer. Similar amounts of radioactivities
were recovered from pelleted virion particles generated from
the complementation experiments. SDS–PAGE analyses of the
same amount of the virion particles showed that the polypeptide profiles for the wild-type and the mutant virions were
very similar (data not presented). Results presented in Fig. 5
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
Mutations in HSV gB affect infectivity
Fig. 6. Rate of entry kinetics for progeny virion particles containing mutant
gB proteins. Virion particles obtained from complementation experiments
were adsorbed to cell monolayers at 4 mC for 2 h and then shifted to
37 mC. At indicated times, monolayers were treated with a glycine buffer
(0n1 M glycine, pH 3n0) or TBS for 1 min. The cell monolayers were then
washed three times with complete medium, overlaid with medium
containing methyl cellulose, and incubated at 37 mC to allow virus plaques
to develop. Plaques were counted after fixing and staining the cells. The
percentage survival represents the fraction of input virus that entered cells
at each time-point, compared with a control sample that received no acid
treatment. Results are averages from three separate experiments.
show that virion particles obtained from the complementation
experiments contained proteins which were immunoprecipitated with anti-gB antibody and co-migrated with gB
protein, indicating that mutant gB proteins were incorporated
in the recovered virion particles. Virion particles obtained from
Vero cells infected with K082 virus in the absence of any
transfecting plasmid did not show the presence of any protein
band corresponding to the gB band.
Effect of substitution of conserved residues in the
hydrophobic region of gB protein on virus penetration
The entry of HSV-1 into the host cell depends on initial
binding of the virus particles to the cell surface followed by
fusion of the viral envelope with the cell membrane. Since gB1 was shown not to be essential for virus attachment (Cai et al.,
1988 a ; Herold et al., 1991) the observed lack of complementation by the mutant gB-1 proteins could not be due to lack of
binding of the virus to the host cell plasma membrane. Thus,
the substitution of conserved residues in the hydrophobic
region of gB-1 could affect its entry. We, therefore, measured
the rate of virus entry by determining the rate at which the
virus attached to the cell surface becomes resistant to treatment
with low pH buffer as a result of penetration of the virus into
the cell as compared to controls not exposed to acidic pH
(Highlander et al., 1989). The rate of entry of the progeny
virion particles was determined by using the gB-producing
VB38 cell line, which allows replication of the penetrated
virion particles. Analogous studies to assay the rate of entry of
virus particles containing mutant gB or gH protein using gBor gH-producing cell lines have been described (Desai et al.,
1994 ; Wilson et al., 1994). The results presented in Fig. 6 show
that mutants A786S, A786T, A790S and A786S\L788M,
which were complementation-competent, showed rates of
entry that were similar to that of the wild-type gB. Mutants
A791S and A790Q, which showed diminished complementation of about 50 and 25 %, respectively, also showed kinetics of
virus entry similar to that of the wild-type. The rate of entry of
the remainder of the mutants which showed reduced or
negligible complementation activities was, however, markedly
reduced compared to the wild-type (Fig. 6). The mutant P774L,
which failed to show any complementation and was also
compromised in its transport to the cell surface, was extremely
slow in entering the cells. In this case, 50 % of virus particles
containing P774L were resistant to acid-treatment after
150 min compared to 20 min required for 50 % survival of
virus particles containing wild-type gB-1 protein.
Discussion
In the present report, we have investigated the role(s)
played by a number of highly conserved amino acids present
in the carboxy-terminal hydrophobic region of gB, which is
essential for its infectivity (Rasile et al., 1993). A complementation assay measuring the ability of mutant proteins to
rescue the infectivity of gB-null virus, K082, in trans showed
that the mutants could be grouped under three categories : (i)
mutants that were fully infectious as the wild-type gB included
A786S, A786T, A790S and A786S\L788M ; (ii) mutants that
showed reduced infectivity of 50–20 % included A791S,
A786Y, A786N, A790Q and G743R ; and (iii) mutants that
showed negligible infectivity of less than 10 % included
G746N, G766N, F770S and P774L. The mutation sites in the
first two groups, except for G743R, are present in the
membrane anchor region of gB. The mutation sites of the last
group are located in segments 1 and 2 of gB and represent
residues that are non-variant in the family Herpesviridae. Except
for A790Q and A791S, mutants which showed reduced
infectivity also showed decreased rate of entry. Mutants which
were negligibly infectious also showed drastically reduced rate
of entry. Mutants that showed reduced or negligible infectivity
contained mutant gB proteins in the envelope of the virions in
amounts comparable to the amounts of mutant proteins present
in progeny virions that were fully infectious. Thus, the
observed loss of infectivity due to substitution of the nonvariant residues in segments 1 and 2 of gB protein may not be
due to reduced incorporation in the virion envelope. Mutant
G743R which exhibited reduced infectivity also showed a
slower intracellular transport suggesting that replacement of
glycine with arginine affected the folding pattern. Substitution
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
DBJF
E. Wanas and others
of the non-variant residues in segment 2, namely F770 and
P774, also affected their intracellular transport and hence
folding pattern. Proline-774 is a non-variant residue which is
located between segment 2 and the membrane-anchoring
segment 3 and thus may separate the two domains. Replacement of this residue with hydrophobic leucine could thus
induce a drastic conformational change as evidenced by its
defective intracellular transport. The observed loss of the
complementation ability and 7-fold reduction in its rate of
entry could, therefore, be due to this conformational change.
This is in agreement with the observation that replacement of
the tripeptide KNP containing non-variant residues N749 and
P750 present in segment 2 of HCMV gB protein with a
hydrophobic tripeptide VAI caused misfolding as shown by
blocked cell surface expression and arrested transport in the
endoplasmic reticulum (Zheng et al., 1996). However, the
mutant protein formed oligomers and was recognized by
conformational-specific monoclonal antibodies. The biological
activity of this mutant was not tested.
Significant reduction in the rate of entry of viruses
containing mutations in segment 1 and 2 suggests the
involvement of non-variant residues in virus penetration. In
the case of gB glycoprotein of HCMV (Bold et al., 1996 ;
Tugizov et al., 1995) or BHV-1 (Li et al., 1997), putative
fusogenic domains spanning segments 1 and 2 or segment 2
have been proposed. However, in the case of HSV-1 gB
protein, no fusogenic domain has yet been established. Since
the non-variant residues in gB protein that affect the entry of
HSV-1 are also conserved in the fusogenic domains of HCMV
or BHV-1 gB protein it may be hypothesized that hydrophobic
segment 2 either alone or in combination with segment 1 may
serve as an internal fusogenic domain of HSV-1 gB. Segments
1 and 2 are not embedded in the viral envelope but peripherally
associated with the membrane and thus available for insertion
into a target membrane. The presence of internal fusion
peptide in viral fusion protein such as vesicular stomatitis virus
G protein (Zhang & Ghosh, 1994) or Semliki Forest virus E1
glycoprotein (Levy-Mintz & Kielian, 1992) has already been
established. Since glycine residues present in the fusion
peptides of a number of viral fusion proteins (Hernandez et al.,
1996), namely influenza virus HA (Skehel et al., 1995), Semliki
Forest virus E1 (Levy-Mintz & Kielian, 1992), vesicular
stomatitis virus G (Zhang & Ghosh, 1994), human immunodeficiency virus gp 41 (Freed & Martin, 1995) and paramyxovirus F1 (Sergel-Germans et al., 1994), were shown to be
required for fusogenic activity, the non-variant glycines in
segments 1 and 2 of the hydrophobic domain of gB protein
may be important for membrane fusion. Proline and phenylalanine are also present in fusion peptides and have been
implicated in fusogenic activity (Hernandez et al., 1996).
Studies involving site-specific monoclonal antibodies of HSV1 (Highlander et al., 1988 ; Navarro et al., 1992) and HCMV
(Zheng et al., 1996) gB protein suggest that the mid-region of
the ectodomains, for example, residues 241–441 of HSV-1 gB,
DBJG
may be required for virus penetration and cell fusion. It was
further shown that the cytoplasmic region of HSV-1 and
HCMV gB protein also contained important determinants for
virus entry and membrane fusion (syncytia induction) (Gage et
al., 1993 ; Highlander et al., 1988 ; Zheng et al., 1996). It was
suggested that transmembrane region of gB protein may
participate in transduction of signals from fusogenic domains
in the cytoplasmic tail to the fusogenic regions in the
ectodomain. Thus, the substitution of the non-variant residues
within the hydrophobic region can affect the transduction of
signals involved in fusogenic activity.
The entry of herpesviruses requires the involvement of four
transmembrane glycoproteins gB, gD, gH and gL (Cai et al.,
1988 a ; Davis-Poynter et al., 1994 ; Ligas & Johnson, 1988 ;
Roop et al., 1993). It is suggested that in the viral envelope,
they may form hetero-oligomers (Handler et al., 1996 a, b ; Zhu
& Courtney, 1988) which are involved in virus entry. The
multi-subunit complex containing gB protein involved in virus
entry and cell fusion could further interact with cellular coreceptors (Montgomery et al., 1996 ; Terry-Allison et al., 1998)
or with specific cellular proteins which would induce conformational change of the fusogenic region. Changes in conformation
from a non-fusogenic to fusogenic state by exposure to low pH
(Gaudin et al., 1995 ; Hernandez et al., 1996) or binding to coreceptors (Berger, 1997) have been documented for other viral
fusion proteins. Thus, one can hypothesize that, in the case of
herpesviruses, the multi-subunit complex involved in entry
and fusion may be formed by interactions via the transmembrane segment as well as the ecto- and cytoplasmic
domains of gB protein. Recent studies have indeed shown that
interactions between the transmembrane segments within lipid
bilayers are essential for functional assembly of integral
membrane proteins (Casson & Bonfacino, 1992 ; Shai, 1995).
Disruption of the specific amino acid sequence or local peptide
structure of gB protein within the viral membrane may thus
affect the biological activity. Recently a system using gB, gD,
gH and gL proteins of HSV-1 has been used to demonstrate in
vitro fusion of cells (Turner et al., 1998). Using this system, it
may be possible to test if mutations of non-variant residues
present in the hydrophobic region of gB-1 protein also affect
fusion. Alternately, one can introduce these specific mutations
in the fusogenic domains of gB protein of BHV-1 (Li et al.,
1997) or HCMV (Bold et al., 1996 ; Tugizov et al., 1995) and
determine the fusogenic activity of the mutant proteins.
This work was supported by the Medical Research Council of Canada.
We thank L. Gerace and M. J. Matunis for anti-LAP-2 and monoclonal
9F9 antibodies, respectively, G. Cohen and R. Eisenberg for the DL16
anti-gB antibody, D. Johnson for the VB38 cell line, J. Capone for critical
reading of the manuscript and M.M. Strong for manuscript preparation.
References
Berger, E. A. (1997). HIV entry and tropism : the chemokine receptor
connection. AIDS 11 (Suppl. A), S3–16.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
Mutations in HSV gB affect infectivity
Bold, S., Ohlin, M., Garten, W. & Radsak, K. (1996). Structural domains
involved in human cytomegalovirus glycoprotein B-mediated cell fusion.
Journal of General Virology 77, 2297–2302.
Bzik, D. J., Fox, B. A., DeLuca, N. A. & Person, S. (1984). Nucleotide
sequence specifying the glycoprotein gene gB of herpes simplex virus
type 1. Virology 133, 301–314.
Cai, W., Gu, B. & Person, S. (1988 a). Role of glycoprotein B of herpes
simplex virus type 1 in viral entry and cell fusion. Journal of Virology 62,
2596–2604.
Cai, W., Person, S., DebRoy, C. & Gu, B. (1988 b). Functional regions
and structural features of the gB glycoprotein of herpes simplex virus
type 1. Journal of Molecular Biology 201, 575–588.
Casson, P. & Bonfacino, N. A. (1992). Role of transmembrane domain
interactions in the assembly of class II MHC molecules. Science 258,
659–662.
Chiang, H.-Y., Cohen, G. H. & Eisenberg, R. J. (1994). Identification of
functional regions of herpes simplex virus glycoprotein gD by using
linker-insertion mutagenesis. Journal of Virology 68, 2529–2543.
Chou, P. Y. & Fasman, G. D. (1978). Prediction of the secondary
structure of proteins from their amino acid sequence. Advances in Protein
Chemistry 47, 145–148.
Claesson-Welsh, L. & Spear, P. G. (1986). Oligomerization of herpes
simplex virus glycoprotein B. Journal of Virology 60, 803–806.
Davis-Poynter, N., Bell, S., Minson, T. & Browne, H. (1994). Analysis
of the contributions of herpes simplex virus type 1 membrane proteins to
the induction of the cell-cell fusion. Journal of Virology 68, 7586–7590.
Derbyshire, K. M., Salvo, J. J. & Grindley, N. D. F. (1986). A simple and
efficient procedure for saturation mutagenesis using mixed oligonucleotides. Gene 46, 145–152.
Desai, P., Homa, F. L., Person, S. & Glorioso, J. C. (1994). A genetic
selection method for the transfer of HSV-1 glycoprotein B mutations
from plasmid to the viral genome : preliminary characterization of
transdominance and entry kinetics of mutant viruses. Virology 204,
312–322.
Freed, E. O. & Martin, M. A. (1995). The role of human immunodeficiency virus type 1 envelope glycoproteins in virus infection. Journal
of Biological Chemistry 270, 23883–23886.
Gage, P. J., Levine, M. & Glorioso, J. (1993). Syncytium inducing
mutations localize to discrete regions within the cytoplasmic domain of
herpes simplex virus type 1 glycoprotein B. Journal of Virology 67,
2191–2201.
Gaudin, Y., Ruigrok, R. W. H. & Brunner, J. (1995). Low-pH induced
conformational changes in viral fusion proteins : implications for the
fusion mechanism. Journal of General Virology 76, 1541–1556.
Gilbert, R. & Ghosh, H. P. (1993). Immunoelectron microscopic
localization of herpes simplex virus glycoprotein gB in the nuclear
envelope of infected cells. Virus Research 28, 217–231.
Gilbert, R., Ghosh, K., Rasile, L. & Ghosh, H. P. (1994). Membrane
anchoring domain of herpes simplex virus glycoprotein gB is sufficient
for nuclear envelope localization. Journal of Virology 68, 2272–2285.
Handler, C. G., Cohen, G. H. & Eisenberg, R. J. (1996 a). Cross-linking
of glycoprotein oligomers during herpes simplex virus type 1 entry.
Journal of Virology 70, 6076–6082.
Handler, C. G., Eisenberg, R. J. & Cohen, G. H. (1996 b). Oligomeric
structure of glycoproteins in herpes simplex virus type 1. Journal of
Virology 70, 6067–6075.
Hernandez, L. D., Hoffman, L. R., Wolfsberg, T. G. & White, J. M.
(1996). Virus-cell and cell-cell fusion. Annual Review of Cell and
Developmental Biology 12, 627–661.
Herold, B. C., WuDunn, D., Soltys, S. & Spear, P. G. (1991).
Glycoprotein C of herpes simplex virus type 1 plays a principal role in
the adsorption of virus to cells and infectivity. Journal of Virology 65,
1090–1098.
Highlander, S. L., Cai, W. H., Person, S., Levine, M. & Glorioso, J. C.
(1988). Monoclonal antibodies define a domain on herpes simplex virus
glycoprotein B involved in virus penetration. Journal of Virology 62,
1881–1888.
Highlander, S. L., Dorney, D. J., Gage, P. J., Holland, T. C., Cai, H.,
Person, S., Levine, M. & Glorioso, J. C. (1989). Identification of mar
mutations in herpes simplex virus type 1 glycoprotein B which alter
antigenic structure and function in virus penetration. Journal of Virology
63, 730–738.
Kopp, A. & Mettenleiter, T. C. (1992). Stable rescue of a glycoprotein
gII deletion mutant of pseudorabies virus by glycoprotein gI of bovine
herpes virus 1. Journal of Virology 66, 2754–2764.
Kunkel, T., Roberts, J. D. & Zakour, R. A. (1987). Rapid and efficient
site-specific mutagenesis without phenotypic selection. Methods in
Enzymology 154, 367–382.
Kyte, J. & Doolittle, R. F. (1982). A simple method for displaying the
hydropathic character of a protein. Journal of Molecular Biology 157,
105–120.
Laquerre, S., Person, S. & Glorioso, J. C. (1996). Glycoprotein B of
herpes simplex virus type 1 oligomerizes through the intermolecular
interaction of a 28-amino acid domain. Journal of Virology 70, 1640–1650.
Laquerre, S., Anderson, D. B., Argnani, R. & Glorioso, J. C. (1998).
Herpes simplex virus type 1 glycoprotein B requires a cysteine residue at
position 633 for folding, processing and incorporation into mature
infectious virus particles. Journal of Virology 72, 4940–4949.
Levy-Mintz, P. & Kielian, M. (1992). Mutagenesis of the putative fusion
domain of Semliki Forest virus spike protein. Journal of Virology 65,
4592–4300.
Li, Y., van Drunen Littel-van den Hurk, S., Liang, X. & Babiuk, L. A.
(1997). Functional analysis of the transmembrane anchor region of
bovine herpesvirus 1 glycoprotein gB. Virology 228, 39–54.
Ligas, M. W. & Johnson, D. C. (1988). A herpes simplex virus mutant
in which glycoprotein D sequences are replaced by β-galactosidase
sequences binds to but is unable to penetrate into cells. Journal of Virology
62, 1486–1494.
Little, S. P., Jofre, J. T., Courtney, R. J. & Schaffer, P. A. (1981). A
virion-associated glycoprotein essential for infectivity of herpes simplex
virus type-1. Virology 114, 149–160.
Mettenleiter, T. C. & Spear, P. G. (1994). Glycoprotein B gB (gII) of
pseudorabies virus can functionally substitute for glycoprotein gB in
herpes simplex virus type 1. Journal of Virology 68, 500–504.
Misra, V. & Blewett, E. L. (1991). Construction of herpes simplex
viruses that are pseudodiploid for the glycoprotein B gene : a strategy for
studying the function of an essential herpesvirus gene. Journal of General
Virology 72, 385–392.
Montgomery, R. I., Warner, M. S., Lum, B. J. & Spear, P. G. (1996).
Herpes simplex virus-1 entry into cells mediated by a novel member of
the TNF\NGF receptor family. Cell 87, 427–436.
Navarro, D., Paz, P. & Pereira, L. (1992). Domains of herpes simplex
virus I glycoprotein B that function in virus penetration, cell-to-cell
spread, and cell fusion. Virology 186, 99–112.
Pellett, P. E., Kousoulas, K. G., Pereira, L. & Roizman, B. (1985).
Anatomy of the herpes simplex virus 1 strain F glycoprotein B gene :
primary sequence and predicted protein structure of the wild type and
monoclonal antibody-resistant mutants. Journal of Virology 53, 243–253.
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24
DBJH
E. Wanas and others
Pereira, L. (1994). Function of glycoprotein B homologues of the family
Herpesviridae. Infectious Agents of Disease 3, 9–28.
Rasile, L., Ghosh, K., Raviprakash, K. & Ghosh, H. P. (1993). Effects of
deletions in the carboxy-terminal hydrophobic region of herpes simplex
virus glycoprotein gB on intracellular transport and membrane anchoring.
Journal of Virology 67, 4856–4866.
Terry-Allison, T., Montgomery, R. I., Whitbeck, J. C., Xu, R., Cohen,
G. H., Eisenberg, R. & Spear, P. G. (1998). HveA (herpes virus entry
Rauh, I., Weiland, F., Fehler, F., Keil, G. & Mettenleiter, T. C. (1991).
studies by fracture label. Journal of Virology 66, 554–561.
Pseudorabies virus mutants lacking the essential glycoprotein gII can be
complemented by glycoprotein gI of bovine herpes virus 1. Journal of
Virology 65, 621–631.
Tugizov, S., Wang, Y., Quadri, I., Navarro, D., Maidji, E. & Pereira, L.
(1995). Mutated forms of human cytomegalovirus glycoprotein B are
Reschke, M., Reis, B., No$ ding, K., Rohsiepe, D., Richter, A.,
Mockenhaupt, T., Garten, W. & Radsak, K. (1995). Constitutive
expression of human cytomegalovirus glycoprotein B (gpUL55) with
mutagenized carboxy-terminal hydrophobic domains. Journal of General
Virology 76, 113–122.
Roizman, B. & Sears, A. (1996). Herpes simplex viruses and their
replication. In Fields Virology, 3rd edn, pp. 2231–2295. Edited by B. N.
Fields, D. M. Knipe & P. M. Howley. Philadelphia : Lippincott–Raven
Publishers.
Roop, C., Hutchinson, L. & Johnson, D. C. (1993). A mutant herpes
simplex virus type 1 unable to express glycoprotein L cannot enter cells,
and its particles lack glycoprotein H. Journal of Virology 67, 2285–2297.
Sergel-Germans, T., McQuain, C. & Morrison, T. (1994). Mutations in
the fusion peptide and heptad repeat regions of the Newcastle disease
virus fusion protein that block fusion. Journal of Virology 68, 7654–7658.
Shai, Y. (1995). Molecular recognition between membrane-spanning
polypeptides. Trends in Biochemical Sciences 20, 460–464.
Skehel, J. J., Bizebard, T., Bullough, P. A., Hughson, F. M., Knossow,
M., Steinhauer, D. A., Wharton, S. A. & Wiley, D. C. (1995). Membrane
fusion by influenza hemagglutinin. Cold Spring Harbor Symposia on
Quantitative Biology 60, 573–580.
Spear, P. G. (1993). Membrane fusion induced by herpes simplex virus.
In Viral Fusion Mechanisms, pp. 201–232. Edited by J. Bentz. Boca Raton :
CRC Press.
DBJI
mediator A), a coreceptor for herpes simplex virus entry also participates
in virus-induced cell fusion. Journal of Virology 72, 5802–5810.
Torrisi, M. R., DiLazzaro, C., Pavan, A., Pereira, L. & CampadelliFiume, G. (1992). Herpes simplex virus envelopment and maturation
impaired in inducing syncytium formation. Virology 209, 580–591.
Turner, A., Brunn, B., Minson, T. & Browne, H. (1998). Glycoproteins
gB, gD, and gHgL of herpes simplex virus type 1 are necessary and
sufficient to mediate membrane fusion in a COS cell transfection system.
Journal of Virology 72, 873–875.
Wilson, D. W., Davis-Poynter, N. & Minson, A. C. (1994). Mutation in
the cytoplasmic tail of herpes simplex virus glycoprotein H suppress cell
fusion by a syncytial strain. Journal of Virology 68, 6985–6993.
Yang, Y.-C., Ciarletta, A. B., Temple, P. A., Chung, M. P., Kovacic, S.,
Witek-Giannoti, J. S., Leary, A. C., Kriz, R., Donahue, R. E., Wong, G. &
Clark, S. C. (1986). Human Il-3 (multi-CSF) : identification by expression
cloning of a novel hematopoietic growth factor related to murine IL-3.
Cell 47, 3–10.
Zhang, L. & Ghosh, H. P. (1994). Characterization of the putative
fusogenic domain in vesicular stomatitis virus glycoprotein G. Journal of
Virology 68, 2186–2193.
Zheng, Z., Maidji, E., Tugizov, S. & Pereira, L. (1996). Mutations in the
carboxy-terminal hydrophobic sequence of human cytomegalovirus
glycoprotein B alter transport and protein chaperone binding. Journal of
Virology 70, 8029–8040.
Zhu, Q. & Courtney, R. J. (1988). Chemical crosslinking of glycoproteins
on the envelope of herpes simplex virus. Virology 167, 377–384.
Received 7 April 1999 ; Accepted 2 September 1999
Downloaded from www.microbiologyresearch.org by
IP: 88.99.165.207
On: Mon, 15 May 2017 02:51:24