Ethanol Neurotoxicity in the Developing Cerebellum
... of embryos and their central nervous system, and impairment in retinoic acid metabolism leads to various neurological disorders [35–37]. During retinoic acid metabolism, retinol released by the liver circulates in plasma in a bound form with retinol binding protein (RBP); RBP then releases retinol w ...
... of embryos and their central nervous system, and impairment in retinoic acid metabolism leads to various neurological disorders [35–37]. During retinoic acid metabolism, retinol released by the liver circulates in plasma in a bound form with retinol binding protein (RBP); RBP then releases retinol w ...
Cortical and basal ganglia contributions to habit learning and
... The role of the sensorimotor striatum in habit learning and automaticity Whereas the associative striatum seems more critical to early than late stages of learning, the sensorimotor striatum shows the opposite pattern. For example, Miyachi et al. [14] found that most striatal neurons that responded ...
... The role of the sensorimotor striatum in habit learning and automaticity Whereas the associative striatum seems more critical to early than late stages of learning, the sensorimotor striatum shows the opposite pattern. For example, Miyachi et al. [14] found that most striatal neurons that responded ...
Calculating Consequences - Human Reward and Decision Making lab
... illness. All subjects gave informed consent, and the study was approved in the medial orbitofrontal cortex (mOFC) (O’Doherty et al., 2002), each by the Institutional Review Board of the California Institute of Technolhorizontal section was acquired at 30° to the anterior commissure–posogy. One subje ...
... illness. All subjects gave informed consent, and the study was approved in the medial orbitofrontal cortex (mOFC) (O’Doherty et al., 2002), each by the Institutional Review Board of the California Institute of Technolhorizontal section was acquired at 30° to the anterior commissure–posogy. One subje ...
Historical analysis of the neural control of movement from the
... beginning of the 19th century. Particular emphasis is placed on the opening up of new possibilities by the development of new techniques, from chronophotography to magnetic brain stimulation, all of which have exploited developments in technology. Extrapolating from history, future advance in physio ...
... beginning of the 19th century. Particular emphasis is placed on the opening up of new possibilities by the development of new techniques, from chronophotography to magnetic brain stimulation, all of which have exploited developments in technology. Extrapolating from history, future advance in physio ...
Evolution of Time-Coding Systems in Weakly Electric Fishes
... from the precisely timed electric organ discharges (EODs) that these fish emit from the electric organ in the tail. The time precision of EODs is on the order of microseconds. The feedback signals of EODs are sensed by a fish’s own electrosensory system for electrolocation or that of other individua ...
... from the precisely timed electric organ discharges (EODs) that these fish emit from the electric organ in the tail. The time precision of EODs is on the order of microseconds. The feedback signals of EODs are sensed by a fish’s own electrosensory system for electrolocation or that of other individua ...
Local network regulation of orexin neurons in the lateral hypothalamus
... doi:10.1152/ajpregu.00674.2010.—Obesity and inadequate sleep are among the most common causes of health problems in modern society. Thus, the discovery that orexin (hypocretin) neurons play a pivotal role in sleep/wake regulation, energy balance, and consummatory behaviors has sparked immense intere ...
... doi:10.1152/ajpregu.00674.2010.—Obesity and inadequate sleep are among the most common causes of health problems in modern society. Thus, the discovery that orexin (hypocretin) neurons play a pivotal role in sleep/wake regulation, energy balance, and consummatory behaviors has sparked immense intere ...
Basal Ganglia Functional Connectivity Based on
... a specific set of motor or cognitive tasks, depending on the cortical area that belongs to it. Modifications of this model and further subdivisions of specific loops have been proposed (Fig. 1B) (Lawrence and others 1998; Nakano and others 2000). Other investigators have divided the striatum into 3 fun ...
... a specific set of motor or cognitive tasks, depending on the cortical area that belongs to it. Modifications of this model and further subdivisions of specific loops have been proposed (Fig. 1B) (Lawrence and others 1998; Nakano and others 2000). Other investigators have divided the striatum into 3 fun ...
Spatial Responsiveness of Monkey Hippocampal Neurons to
... experimenter. The range that the monkey could see was restricted to about 280” from the center by attaching opaque acrylic plates at the sides of its face. Usually each object was presented by the experimenter putting it on the stage behind the window for about 2.0 seconds. The distance between the ...
... experimenter. The range that the monkey could see was restricted to about 280” from the center by attaching opaque acrylic plates at the sides of its face. Usually each object was presented by the experimenter putting it on the stage behind the window for about 2.0 seconds. The distance between the ...
Glycemic State Regulates Brain-Derived Neurotrophic Factor
... system (CNS) (43; 115) and particular peripheral tissues including muscles (128), adipose (197), and liver (38). As a result, both proteins are widely distributed throughout the nervous system(43; 217) while, at the cellular level, BDNF and its receptors, TrkB and p75, can be located in both the axo ...
... system (CNS) (43; 115) and particular peripheral tissues including muscles (128), adipose (197), and liver (38). As a result, both proteins are widely distributed throughout the nervous system(43; 217) while, at the cellular level, BDNF and its receptors, TrkB and p75, can be located in both the axo ...
View the Program Guide - International Society for Stem Cell Research
... The Stem Cell Models of Neural Regeneration and Disease International Symposium is located in the Center for Regenerative Therapies Dresden (CRTD) Research Center and Cluster of Excellence at the TU Dresden. All program sessions will be in The Auditorium, Ground Floor. The Tuesday, 2 February Break- ...
... The Stem Cell Models of Neural Regeneration and Disease International Symposium is located in the Center for Regenerative Therapies Dresden (CRTD) Research Center and Cluster of Excellence at the TU Dresden. All program sessions will be in The Auditorium, Ground Floor. The Tuesday, 2 February Break- ...
Cerebellar control of visceral responses–possible mechanisms
... involving virtually all links of the parasympathetic and sympathetic adrenal systems and, consequently, their subordinated effector organs. However, these different autonomic effects, which can almost all be induced from the same electrode position in the ...
... involving virtually all links of the parasympathetic and sympathetic adrenal systems and, consequently, their subordinated effector organs. However, these different autonomic effects, which can almost all be induced from the same electrode position in the ...
STINGLESS BEES: THE NEUROBIOLOGY OF FORAGING Abstract
... In stingless bees, the product of the mandibular glands is associated with foraging, recruiting workers to search for food and defensive behaviors, alerting the colony against possible invaders (Lindauer and Kerr, 1958, 1960; Kerr and Cruz, 1961). The workers of Scaptotrigona postica use the secreti ...
... In stingless bees, the product of the mandibular glands is associated with foraging, recruiting workers to search for food and defensive behaviors, alerting the colony against possible invaders (Lindauer and Kerr, 1958, 1960; Kerr and Cruz, 1961). The workers of Scaptotrigona postica use the secreti ...
Categorical perception of somesthetic stimuli: psychophysical
... We have recorded the responses of neurons of SI cortex with receptive fields on the finger tips during the categorization of the stimulus speeds (Romo et al., 1996). The results indicate that a class of neurons of SI cortex respond by increasing their impulse rates as a function of the stimulus spee ...
... We have recorded the responses of neurons of SI cortex with receptive fields on the finger tips during the categorization of the stimulus speeds (Romo et al., 1996). The results indicate that a class of neurons of SI cortex respond by increasing their impulse rates as a function of the stimulus spee ...
13-1 CHAPTER 13 SYNAPSES The nervous system consists of
... and not an electrical synapse, or for that matter a synapse at all? (2) Is every gap junction an electrical synapse and not a chemical synapse, or for that matter a synapse at all? These questions are made important by the observations that vesicles (possibly synaptic vesicles) are found in conjunct ...
... and not an electrical synapse, or for that matter a synapse at all? (2) Is every gap junction an electrical synapse and not a chemical synapse, or for that matter a synapse at all? These questions are made important by the observations that vesicles (possibly synaptic vesicles) are found in conjunct ...
- Columbia University Medical Center
... are also expressed by proprioceptive sensory neurons, raising the possibility that cadherins regulate additional steps in the development of sensory-motor circuits. Introduction Many hundreds of neuronal cell types are generated during the development of the vertebrate central nervous system (CNS)—a ...
... are also expressed by proprioceptive sensory neurons, raising the possibility that cadherins regulate additional steps in the development of sensory-motor circuits. Introduction Many hundreds of neuronal cell types are generated during the development of the vertebrate central nervous system (CNS)—a ...
jeopardy review nervous system
... Connects the Central nervous system to the visceral organs such as the heart, vessels, blood, glands, intestines Template by Bill Arcuri, WCSD ...
... Connects the Central nervous system to the visceral organs such as the heart, vessels, blood, glands, intestines Template by Bill Arcuri, WCSD ...
HLH-14 is a C. elegans Achaete-Scute protein that
... 3′) and BG1GFP-R2 (5′ CCAAGGATCCATGGTGTGGATAATTGGAATATGA 3′) were used to amplify the promoter and coding regions of hlh-14, using the cosmid F22C7 as a template. The resulting 8.4 kb genomic product and the GFP vector pPD95.77 (A. Fire, S. Xu, J. Ahnn and G. Seydoux, unpublished) were double digest ...
... 3′) and BG1GFP-R2 (5′ CCAAGGATCCATGGTGTGGATAATTGGAATATGA 3′) were used to amplify the promoter and coding regions of hlh-14, using the cosmid F22C7 as a template. The resulting 8.4 kb genomic product and the GFP vector pPD95.77 (A. Fire, S. Xu, J. Ahnn and G. Seydoux, unpublished) were double digest ...
Abstract 1. Introduction Temporal dynamics of perception and the
... In any case, the main results from all of the experiments mentioned above have an essential feature in common: the initial eye movement is in the direction of the 1D component of stimulus motion and only some tens of ms later does it reflect the 2D direction. This temporal evolution appears to refle ...
... In any case, the main results from all of the experiments mentioned above have an essential feature in common: the initial eye movement is in the direction of the 1D component of stimulus motion and only some tens of ms later does it reflect the 2D direction. This temporal evolution appears to refle ...
The W cell pathway to cat primary visual cortex
... JOHN C. ANDERSON, NUNO MAÇARICO DA COSTA,* AND KEVAN A.C. MARTIN Institute for Neuroinformatics, University of Zürich, and ETH Zürich, 8057 Zürich, Switzerland ...
... JOHN C. ANDERSON, NUNO MAÇARICO DA COSTA,* AND KEVAN A.C. MARTIN Institute for Neuroinformatics, University of Zürich, and ETH Zürich, 8057 Zürich, Switzerland ...
Laminar Differences in Dendritic Structure of Pyramidal Neurons in
... glutamatergic synapses. In turn, pyramidal cell axons constitute the main source of these synapses. Thus, pyramidal cells can be ...
... glutamatergic synapses. In turn, pyramidal cell axons constitute the main source of these synapses. Thus, pyramidal cells can be ...
Nociceptors: the sensors of the pain pathway
... dorsal horn of the spinal cord or the trigeminal subnucleus caudalis (Vc) (13), respectively (Figure 1A). In this way, propagating electrical signals between periphery and spinal cord (or brainstem) follow a direct axonal pathway, thus reducing the risk of conduction failure (32). Nociceptors are ex ...
... dorsal horn of the spinal cord or the trigeminal subnucleus caudalis (Vc) (13), respectively (Figure 1A). In this way, propagating electrical signals between periphery and spinal cord (or brainstem) follow a direct axonal pathway, thus reducing the risk of conduction failure (32). Nociceptors are ex ...
Neural Mechanisms of Reward in Insects - Chittka Lab
... vertebrate neuroscience has identified reward learning, liking, and wanting as separate but interacting modules within the complete reward processing system. There are also extremely close interactions between the neural systems for pain and pleasure facilitating assessment of a balance of positive a ...
... vertebrate neuroscience has identified reward learning, liking, and wanting as separate but interacting modules within the complete reward processing system. There are also extremely close interactions between the neural systems for pain and pleasure facilitating assessment of a balance of positive a ...
Human Neural Systems for Face Recognition and Social
... superior temporal sulcus (Halgren et al 1999; Haxby et al 1999; Hoffman and Haxby 2000; Kanwisher et al 1997; Puce et al 1998) (Figure 1). Evoked potential studies using electrodes placed on the cortical surface in patients undergoing brain surgery for temporal lobe epilepsy have shown that sites in ...
... superior temporal sulcus (Halgren et al 1999; Haxby et al 1999; Hoffman and Haxby 2000; Kanwisher et al 1997; Puce et al 1998) (Figure 1). Evoked potential studies using electrodes placed on the cortical surface in patients undergoing brain surgery for temporal lobe epilepsy have shown that sites in ...
Sensory Pathways
... example, if many auditory sensory cells generate many action potentials in rapid succession, the resulting integrated signal is perceived as a single, loud sound. If only a few auditory sensory cells generate a few action potentials, the integrated signal is perceived as a quiet sound. Sensory neuro ...
... example, if many auditory sensory cells generate many action potentials in rapid succession, the resulting integrated signal is perceived as a single, loud sound. If only a few auditory sensory cells generate a few action potentials, the integrated signal is perceived as a quiet sound. Sensory neuro ...
Neuroanatomy
Neuroanatomy is the study of the anatomy and stereotyped organization of nervous systems. In contrast to animals with radial symmetry, whose nervous system consists of a distributed network of cells, animals with bilateral symmetry have segregated, defined nervous systems, and thus we can make much more precise statements about their neuroanatomy. In vertebrates, the nervous system is segregated into the internal structure of the brain and spinal cord (together called the central nervous system, or CNS) and the routes of the nerves that connect to the rest of the body (known as the peripheral nervous system, or PNS). The delineation of distinct structures and regions of the nervous system has been critical in investigating how it works. For example, much of what neuroscientists have learned comes from observing how damage or ""lesions"" to specific brain areas affects behavior or other neural functions.For information about the composition of animal nervous systems, see nervous system. For information about the typical structure of the human nervous system, see human brain or peripheral nervous system. This article discusses information pertinent to the study of neuroanatomy.