• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
PPT - Altogen Biosystems
PPT - Altogen Biosystems

... among a host of 100+ cell line specific In Vitro Transfection Kits. The HCAEC Cell Transfection Reagent is a nanoparticle-based liposome mediated formulation, and it has been developed to provide high transfection efficiency with HCAEC. This cell line is a good host for studying the circulatory syst ...
Genetic Transformation of Poinsettia (Euphórbia
Genetic Transformation of Poinsettia (Euphórbia

... Agrobacterium-mediated transformation is the most common way of transforming plants, and is based on a natural gene transfer system found in Agrobacterium tftumefaciens (Bevan 1984). In nature, A. tumefaciens will infect dicotyledonous plants to produce crown-gall disease by transferring genes codin ...
Introduction - Stellenbosch University
Introduction - Stellenbosch University

... https://www.ncbi.nlm.nih.gov/books/NBK179288/ • use esearch to find hemoglobin proteins • use pipe (|) to efetch to retrieve the proteins in the FASTA format • use head to display six lines of the output ...
In the near future, EU thresholds for adventitious
In the near future, EU thresholds for adventitious

... the seed pool tests. This did not occur to a problematic level in this study because only lower numbers than expected of positive seed pools were observed. However, we also suspect that under-mixing of the 0.9% GM seed analytical sample had occurred. If more vigorous mixing had been used it is possi ...
A Novel PCR Detection Method for Major Fish Pathogenic Bacteria
A Novel PCR Detection Method for Major Fish Pathogenic Bacteria

11. Appendix A – PCR Reagent Concentration and Master Mix Tools
11. Appendix A – PCR Reagent Concentration and Master Mix Tools

genetics - Liceocopernico.it
genetics - Liceocopernico.it

... Johann (Gregor) Mendel laid the foundations of modem genetics with the publication of his pioneering work on peas in 1866, but his work was not appreciated during his lifetime. The science of genetics began in 1900 with the rediscovery of his original paper. In the next ninety years, genetics grew f ...
Recombination and loss of complementation
Recombination and loss of complementation

... Meiotic diplospory (described in Figs 1 and 2): a restitutional meiosis; the reductional division is skipped; recombination does occur. The so-called Taraxacum-type and Ixeris-type belong to this group. Mitotic diplospory: meiosis is replaced by mitosis; recombination does not occur. The so-called A ...
Evolutionary history of the genus Capra
Evolutionary history of the genus Capra

... Y-chromosome is a useful molecule for phylogenetic studies. This sex chromosome is paternally inherited and, with the exception of the pseudoautosomal region, it does not undergo homologous recombination at meiosis. Y-chromosome and mitochondrial DNA give independent and complementary information. S ...
Misidentification of a genomovar of Burkholderia cepacia by recA
Misidentification of a genomovar of Burkholderia cepacia by recA

Regulation of Gene Expression
Regulation of Gene Expression

... • These regulatory DNA binding proteins are called ...
Parallel Genetic and Phenotypic Evolution of DNA Superhelicity in
Parallel Genetic and Phenotypic Evolution of DNA Superhelicity in

... Losos et al. 1998; Huey et al. 2000). Parallel changes sometimes extend even to the genome, as has been described for some viral and bacterial pathogens (Crandall et al. 1999; Reid et al. 2000). The parallel evolution of DNA superhelicity in the long-term experiment with E. coli provides therefore h ...
biofundamentals - virtual laboratories
biofundamentals - virtual laboratories

... adapted to particular life styles (ecological niches) through a combination of random (stochastic) and non-random events. These evolutionary mechanisms (which we will discuss in some detail) include the origin of mutations, that is, changes that alter the genetic material (double-stranded deoxyribon ...
MA112 Expresso® Rhamnose SUMO Cloning and
MA112 Expresso® Rhamnose SUMO Cloning and

... is designed for expression in E. coli, fusion clones constructed using this system can also be transferred into eukaryotic expression vectors for expression of SUMO-tagged proteins in mammalian or insect cells. The rhaP BAD promoter is a versatile tool for protein expression. In the absence of rhamn ...
PCR Clean-up Kit / 96-well PCR Clean
PCR Clean-up Kit / 96-well PCR Clean

Cross-talk between cell-cycle control and the environment
Cross-talk between cell-cycle control and the environment

... environmental signals like DNA damage. A ubiquitous stress for any organism is DNA stress that can either be caused by exogenous sources or internal processes like chromatid separation or DNA strands separation during replication. The posttranslational regulation of Cdk1-type kinases through inhibit ...
Supplementary Table 1: WormBase IDs and given
Supplementary Table 1: WormBase IDs and given

... polymerase PrimeSTAR™ (Takara Mirus Bio, Madison, WI) with primer pairs 9060 (GCGGATCCTGAACAGCATGGCAACCAACTG) and 7154 (TGTACTTTTCCCCTCTTGTGAAC), 7153 (CATTTTATGCAGAGTTCGAGTCAC) and 7152 (GAAGAGTGGCGGTAAAATTCGG), and 7151 (TCTTCTAACTCTCGGGCCATTTG) and 7150 (TAACATCCAAAAGCAGTAACATCC). The 2.2 kb frag ...
No Slide Title
No Slide Title

... Regulating transcription Telling RNA pol to copy a DNA sequence Transcription factors bind promoters & control initiation of transcription 1/signal gene senses 1 binding site/signal gene senses ...
video slide - Dublin City Schools Home
video slide - Dublin City Schools Home

... A Closer Look: Obtaining the Gene of Interest • How can a researcher obtain DNA that encodes a particular gene of interest? • The “shotgun” approach is one way to synthesize a gene of interest. – Millions of recombinant plasmids containing different segments of foreign DNA are produced. – This coll ...
Approaches to Repeat Finding
Approaches to Repeat Finding

... Cornell Genomics Forum, 2005-03-18 ...
Comparative gene mapping in Arabidopsis lyrata chromosomes 6
Comparative gene mapping in Arabidopsis lyrata chromosomes 6

... We have increased the density of genetic markers on the Arabidopsis lyrata chromosomes AL6 and AL7 corresponding to the A. thaliana chromosome IV, in order to determine chromosome rearrangements between these two species, and to compare recombination fractions across the same intervals. We confirm th ...
Regulation of Bacterial Conjugation in Microaerobiosis by
Regulation of Bacterial Conjugation in Microaerobiosis by

... involve the RNA chaperone Hfq (Will and Frost 2006), the GroEL heat-shock chaperone (Zahrl et al. 2007), and the extracytoplasmic stress CpxAR system (Gubbins et al. 2002; Zahrl et al. 2006; Lau-Wong et al. 2008). Some host-encoded regulators may control conjugal transfer in most (perhaps all) F-lik ...
Biotechnology Timeline
Biotechnology Timeline

... which makes unlimited copies of genes and gene fragments, is conceived. Method was published in 1988. Kary Mullis, who was born in Lenoir, N.C., wins the 1993 Nobel Prize in Chemistry for the discovery. He became interested in science as a child when he received a chemistry set for Christmas. ...
10.1 - My Haiku
10.1 - My Haiku

... …replicates during S-phase of interphase… ...
No Slide Title
No Slide Title

... • Adenovirus engineered to have no E1b gene will only grow in cells without p53. Thus specifically infect and destroy tumor cells • Crystal structure of p21 with cyclin-cdk solved. The way p21 binds to the kinase may be copied by designer chemicals which will be cdk inhibitors ...
< 1 ... 8 9 10 11 12 13 14 15 16 ... 766 >

Cre-Lox recombination



In the field of genetics, Cre-Lox recombination is known as a site-specific recombinase technology, and is widely used to carry out deletions, insertions, translocations and inversions at specific sites in the DNA of cells. It allows the DNA modification to be targeted to a specific cell type or be triggered by a specific external stimulus. It is implemented both in eukaryotic and prokaryotic systems.The system consists of a single enzyme, Cre recombinase, that recombines a pair of short target sequences called the Lox sequences. This system can be implemented without inserting any extra supporting proteins or sequences. The Cre enzyme and the original Lox site called the LoxP sequence are derived from bacteriophage P1.Placing Lox sequences appropriately allows genes to be activated, repressed, or exchanged for other genes. At a DNA level many types of manipulations can be carried out. The activity of the Cre enzyme can be controlled so that it is expressed in a particular cell type or triggered by an external stimulus like a chemical signal or a heat shock. These targeted DNA changes are useful in cell lineage tracing and when mutants are lethal if expressed globally.The Cre-Lox system is very similar in action and in usage to the FLP-FRT recombination system.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report