Structure of DNA
... strand in the 5-3 direction, starting at the primers, attaching the appropriate nucleotide (A-T, C-G) ...
... strand in the 5-3 direction, starting at the primers, attaching the appropriate nucleotide (A-T, C-G) ...
The Genetic Code
... is encoded in its composition. DNA is a double-stranded aperiodic polymer of a base with a deoxyribose (a sugar) backbone. The base + sugar molecule is called nucleotide. There are four DNA bases, divided in two groups: purines and pyrimidines. The purines are Adenine (A) and Guanine (G) and the pyr ...
... is encoded in its composition. DNA is a double-stranded aperiodic polymer of a base with a deoxyribose (a sugar) backbone. The base + sugar molecule is called nucleotide. There are four DNA bases, divided in two groups: purines and pyrimidines. The purines are Adenine (A) and Guanine (G) and the pyr ...
Gel Electrophoresis
... DNA fragment ( a gene) from one organism and combining it with the DNA of another organism to study how the gene works. The desired result is to have the new organisms ...
... DNA fragment ( a gene) from one organism and combining it with the DNA of another organism to study how the gene works. The desired result is to have the new organisms ...
Section 2 Molecules of Life
... reactions they control. Without enzymes, reactions would go too slowly to support life processes. ...
... reactions they control. Without enzymes, reactions would go too slowly to support life processes. ...
Document
... Codons (Triplet code)-mRNA Each codon corresponds to an aa 20 amino acids 64 triplet codes (codons) 61 code for aa-3 are stop codons Wobble: Flexible base pairing in the 3rd position 3’ end ...
... Codons (Triplet code)-mRNA Each codon corresponds to an aa 20 amino acids 64 triplet codes (codons) 61 code for aa-3 are stop codons Wobble: Flexible base pairing in the 3rd position 3’ end ...
How Does DNA Determine the Traits of a SNORK? A Introduction: In
... In this simulation, you will examine the DNA sequence of an imaginary organism known as the Snork. Snorks were discovered on the planet Dee Enae in a distant solar system. Snorks only have one chromosome with 6 genes on it. Your job is to analyze the genes of its DNA and determine what traits the or ...
... In this simulation, you will examine the DNA sequence of an imaginary organism known as the Snork. Snorks were discovered on the planet Dee Enae in a distant solar system. Snorks only have one chromosome with 6 genes on it. Your job is to analyze the genes of its DNA and determine what traits the or ...
a simple integrated diagnostic platform for dna testing of chlamydia
... The foundation of the presented work rests upon three key concepts: 1) solid-phase nucleic acid isolation; 2) colorimetric loop-mediated isothermal amplification; 3) surface patterning. Solid-phase DNA extraction is a widely used technique in molecular biology. While the underlying mechanisms of act ...
... The foundation of the presented work rests upon three key concepts: 1) solid-phase nucleic acid isolation; 2) colorimetric loop-mediated isothermal amplification; 3) surface patterning. Solid-phase DNA extraction is a widely used technique in molecular biology. While the underlying mechanisms of act ...
Molecular Genetics Close Notes Booklet
... Steps in DNA Transcription 1. The two strands of a DNA molecule, sense and antisense, separate along the length of a gene 2. The antisense strand forms the template for transcription; the sense strand is transcribed 3. RNA polymerase binds at a site called the promoter region: this determines where ...
... Steps in DNA Transcription 1. The two strands of a DNA molecule, sense and antisense, separate along the length of a gene 2. The antisense strand forms the template for transcription; the sense strand is transcribed 3. RNA polymerase binds at a site called the promoter region: this determines where ...
Unit 1 – Biochemisty
... I can describe and identify (visually) the structure of carbohydrates, proteins, lipids, and nucleic acids. ...
... I can describe and identify (visually) the structure of carbohydrates, proteins, lipids, and nucleic acids. ...
Acc_Bio_Semester1_Final_Review_Key_12
... bacteria to the R bacteria to cause disease, and that this must be the genetic material—TRANSFORMATION • Transformation – change in the genotype (genetic makeup of an organism) caused when cells take up foreign genetic material • The cause of transformation was not known at the time • Griffith's Exp ...
... bacteria to the R bacteria to cause disease, and that this must be the genetic material—TRANSFORMATION • Transformation – change in the genotype (genetic makeup of an organism) caused when cells take up foreign genetic material • The cause of transformation was not known at the time • Griffith's Exp ...
Do-It-Yourself Strawberry DNA
... isolation is one of the most basic and essential techniques in the study of DNA. The extraction of DNA from cells and its purification are of primary importance to the field of biotechnology and forensics. Extraction and purification of DNA are the first steps in the analysis and manipulation of DNA ...
... isolation is one of the most basic and essential techniques in the study of DNA. The extraction of DNA from cells and its purification are of primary importance to the field of biotechnology and forensics. Extraction and purification of DNA are the first steps in the analysis and manipulation of DNA ...
Protein Nomenclature
... • Amino acid with free α-amino group is the amino-terminal or N-terminal residue • Amino acid with free α-carboxyl group is the carboxyl-terminal or C-terminal residue • Three letter code – Met-Gly-Glu-Thr-Arg-His • Single letter code – M-G-E-T-R-H ...
... • Amino acid with free α-amino group is the amino-terminal or N-terminal residue • Amino acid with free α-carboxyl group is the carboxyl-terminal or C-terminal residue • Three letter code – Met-Gly-Glu-Thr-Arg-His • Single letter code – M-G-E-T-R-H ...
Macromolecules
... 2- Nitrogen containing base (made of C, H and N) 3- A phosphate group ( P ) • The P groups make the links that unite the sugars (hence a “sugarphosphate backbone” ...
... 2- Nitrogen containing base (made of C, H and N) 3- A phosphate group ( P ) • The P groups make the links that unite the sugars (hence a “sugarphosphate backbone” ...
S1 Text: Supporting Methods. Stress Treatment by Tm and DTT To
... cDNA was tailed in a TdT-tailing reaction as described in the 5′ RACE System Kit (Invitrogen, USA). A nested PCR of the dC-tailed cDNA was then done with KOD Xtreme Hot Start DNA Polymerase ...
... cDNA was tailed in a TdT-tailing reaction as described in the 5′ RACE System Kit (Invitrogen, USA). A nested PCR of the dC-tailed cDNA was then done with KOD Xtreme Hot Start DNA Polymerase ...
Ch4Carbonand5Macromolecules
... • Amino acids are linked together by condensation to form polypeptides. • There are 20 different amino acids in polypeptides synthesized on ribosomes. • Amino acids can be linked together in any sequence giving a huge range of possible polypeptides. • The amino acid sequence of polypeptides is coded ...
... • Amino acids are linked together by condensation to form polypeptides. • There are 20 different amino acids in polypeptides synthesized on ribosomes. • Amino acids can be linked together in any sequence giving a huge range of possible polypeptides. • The amino acid sequence of polypeptides is coded ...
Note 1
... • It is actually a double chain, each chain is called a strand. • A strand consists of repetition of the same nucleotide unit. This unit is formed by a sugar molecule attached to a phosphate residue and a base. ...
... • It is actually a double chain, each chain is called a strand. • A strand consists of repetition of the same nucleotide unit. This unit is formed by a sugar molecule attached to a phosphate residue and a base. ...
Slide 1 - Indiana University–Purdue University Indianapolis
... mutations, somatic mutations arise in the DNA of individual cells; the genetic errors are passed only to direct descendants of those cells. Mutations are often the result of errors that crop up during cell division, when the cell is making a copy of itself and dividing into two. Acquired mutations c ...
... mutations, somatic mutations arise in the DNA of individual cells; the genetic errors are passed only to direct descendants of those cells. Mutations are often the result of errors that crop up during cell division, when the cell is making a copy of itself and dividing into two. Acquired mutations c ...
Sir Alec Jeffreys minisatellites
... Examples - DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR’s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG ...
... Examples - DNA fingerprints. Tandemly repeated but often in dispersed clusters. Also called VNTR’s (variable number tandem repeats). Human λ33.1 minisatellite (62 bp) AAGGGTGGGCAGGAAGTGGAGTGTGTGCCTG CTTCCCTTCCCTGTCTTGTCCTGGAAACTCA Human λ33.5 minisatellite (17 bp) YGGGCAGGAGGGGGAGG ...
HCS604.03 Exercise 1 Dr. Jones Spring 2005 Recombinant DNA
... ligation. The enzyme T4 DNA Ligase, which originates from the T4 bacteriophage, catalyzes the joining of two strands of DNA between the 5´-phosphate and the 3´hydroxyl groups of adjacent nucleotides in either a compatible cohesive-ended (“sticky” or blunt-ended configuration. The enzyme has also bee ...
... ligation. The enzyme T4 DNA Ligase, which originates from the T4 bacteriophage, catalyzes the joining of two strands of DNA between the 5´-phosphate and the 3´hydroxyl groups of adjacent nucleotides in either a compatible cohesive-ended (“sticky” or blunt-ended configuration. The enzyme has also bee ...
Exam 2 Initial Key v2 Bio200 Win17
... Explanation: This protein has lost some (but not all) function in opening DNA. Stolen proteins might be useful, but the first two answers each have additional clauses that make them incorrect. More hydrogen bonds would make helicase more necessary, not less. Bacteria Q will replicate more slowly and ...
... Explanation: This protein has lost some (but not all) function in opening DNA. Stolen proteins might be useful, but the first two answers each have additional clauses that make them incorrect. More hydrogen bonds would make helicase more necessary, not less. Bacteria Q will replicate more slowly and ...
AP 15-16 Test Review When Thomas Hunt Morgan crossed his red
... Sex determination in mammals is due to the SRY region of the Y chromosome. An abnormality of this region could allow which of the following to have a male phenotype? What is the reason that linked genes are inherited together? In humans, male–pattern baldness is controlled by an autosomal gene that ...
... Sex determination in mammals is due to the SRY region of the Y chromosome. An abnormality of this region could allow which of the following to have a male phenotype? What is the reason that linked genes are inherited together? In humans, male–pattern baldness is controlled by an autosomal gene that ...
Chemical Level of Organization
... Nucleic Acid: are acidic substances found in nucleus of cells. 2 basic types: DNA = Deoxyribose N.A. and RNA = ribose N.A. Nucleic acids are polymers of units called Nucleotides. Each nucleotide is formed of: a) a pentose sugar Ribose or Deoxyribose b) a Phosphate c) one of 4 N-bases, both have 3 co ...
... Nucleic Acid: are acidic substances found in nucleus of cells. 2 basic types: DNA = Deoxyribose N.A. and RNA = ribose N.A. Nucleic acids are polymers of units called Nucleotides. Each nucleotide is formed of: a) a pentose sugar Ribose or Deoxyribose b) a Phosphate c) one of 4 N-bases, both have 3 co ...
LOYOLA COLLEGE (AUTONOMOUS), CHENNAI – 600 034
... 4. What would be the decarboxylated product of pyruvate in glycolysis? Mention the structure. 5. Define glycosuria. 6. What are ketone bodies? When and how are they formed in the body? 7. Calculate the energitics for palmitic acid oxidation. 8. List the possible enzymes that are involved in DNA repl ...
... 4. What would be the decarboxylated product of pyruvate in glycolysis? Mention the structure. 5. Define glycosuria. 6. What are ketone bodies? When and how are they formed in the body? 7. Calculate the energitics for palmitic acid oxidation. 8. List the possible enzymes that are involved in DNA repl ...
Nucleic acid analogue
Nucleic acid analogues are compounds which are analogous (structurally similar) to naturally occurring RNA and DNA, used in medicine and in molecular biology research.Nucleic acids are chains of nucleotides, which are composed of three parts: a phosphate backbone, a pucker-shaped pentose sugar, either ribose or deoxyribose, and one of four nucleobases.An analogue may have any of these altered. Typically the analogue nucleobases confer, among other things, different base pairing and base stacking properties. Examples include universal bases, which can pair with all four canonical bases, and phosphate-sugar backbone analogues such as PNA, which affect the properties of the chain (PNA can even form a triple helix).Nucleic acid analogues are also called Xeno Nucleic Acid and represent one of the main pillars of xenobiology, the design of new-to-nature forms of life based on alternative biochemistries.Artificial nucleic acids include peptide nucleic acid (PNA), Morpholino and locked nucleic acid (LNA), as well as glycol nucleic acid (GNA) and threose nucleic acid (TNA). Each of these is distinguished from naturally occurring DNA or RNA by changes to the backbone of the molecule.In May 2014, researchers announced that they had successfully introduced two new artificial nucleotides into bacterial DNA, and by including individual artificial nucleotides in the culture media, were able to passage the bacteria 24 times; they did not create mRNA or proteins able to use the artificial nucleotides. The artificial nucleotides featured 2 fused aromatic rings.