• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Programação detalhada
Programação detalhada

... blastocyst that are in direct contact with maternal blood, and therefore play an essential role in protecting the fetus from attack from the maternal immune system. Trophoblast cells are relatively unique in that they do not express major histocompatibility complex (MHC) class II antigens, either co ...
Expression Analysis of Toll-Like Receptor2 in Bubaline
Expression Analysis of Toll-Like Receptor2 in Bubaline

... 5’TCAACAACTTATTTCTGGAAA3’(Reverse) were designed from cattle TLR2 sequence (Genbank Acession No.EU005236) to amplify a 981bps TLR2 buffalo gene fragment. The amplification was carried out in 50μl final volume containing 1.5mM MgCl2, 50mM Tris-HCl (pH 9.0 at 25°C), 15mM (NH4)2SO4 and 0.1% TritonX; 0. ...
PDF 3389 KB - UC Davis Biomedical Engineering
PDF 3389 KB - UC Davis Biomedical Engineering

... despite this high sensitivity, GPCRs that specifically interact with anaphylatoxins (C5a, C3a and C4a) appear to remain impervious to encounters with the precursor complement proteins (C5, C3 and C4) from which the anaphylatoxins are cleaved (see also Box 1). Phagocytosis, however, is mediated by se ...
Tolerance, Danger, and the Extended Family
Tolerance, Danger, and the Extended Family

... against anything foreign and is tolerant of anything that is self. For example, so difficult to accept was the evidence that normal individuals contain natural antibodies to self-antigens like DNAand keratin that I cameup with all sorts of excuses for them: for example, that these antibodies are not ...
Rethinking the role of immunity: lessons from Hydra
Rethinking the role of immunity: lessons from Hydra

... molecular complexes, for example, the inflammasome comprised of NLRP1 or NLRP3 monomers, apoptosis-associated speck-like protein containing a CARD (ASC) [52], and caspase 1 [53,54]. Surveying the Hydra genome has allowed the identification of a number of potential NLRinteracting proteins. One of the ...
A crucial role for B cells in neuroinvasive scrapie
A crucial role for B cells in neuroinvasive scrapie

... receptors for interferon-a/b7 and interferon-g8. For controls, we inoculated inbred mice of strains C57BL/6 and 129Sv, which are the genetic backgrounds of all other mouse strains used. To investigate the role of T cells, we used mice with targeted disruption of the genes encoding CD4 (ref. 9), CD8 ...
by Acceleration of Lymphocyte Homing the Number of Circulating
by Acceleration of Lymphocyte Homing the Number of Circulating

Nature Neuroscience - Weizmann Institute of Science
Nature Neuroscience - Weizmann Institute of Science

New molecular biology of T-cell lymphomas - HAL
New molecular biology of T-cell lymphomas - HAL

Toll-like receptors as therapeutic targets in cystic fibrosis.
Toll-like receptors as therapeutic targets in cystic fibrosis.

... CpG (uCpG) dinucleotides motifs activate TLR9 [33]. These occur frequently in bacterial but not mammalian DNA. Flagellin is a protein subunit of bacterial flagellae expressed by Gram-negative bacteria. It can induce TLR5-dependent signalling [34]. Airway epithelial cells utilise TLR5 in their respon ...
Acute and chronic inflammation
Acute and chronic inflammation

Immunology of asthma and chronic obstructive pulmonary disease
Immunology of asthma and chronic obstructive pulmonary disease

... characteristic structural changes, with collagen deposition under the epithelium that is sometimes described as basement-membrane thickening and is found in all patients with asthma, and thickening of the airway smooth-muscle cell layer as a result of hyperplasia and hypertrophy, which is more commo ...
Immunology Program Graduates
Immunology Program Graduates

... Thesis Advisor: Dr. Per Basse Induction of antitumor responses via adoptively transferred, cytokine-gene transduced A-NK cells Jared Knickelbein, Ph.D., 2008 Thesis Advisor: Dr. Robert Hendricks Noncytotoxic lytic granule-mediated maintenance of HSV-1 neuronal latency ...
Effects of Systemic versus Local Administration of Corticosteroids on
Effects of Systemic versus Local Administration of Corticosteroids on

Th17 responses to Mycobacterium tuberculosis are compromised in
Th17 responses to Mycobacterium tuberculosis are compromised in

... infected TLR2-/- animals, 54 days post-infection. In line with the histological analysis, at late ...
Slide
Slide

... antibody-secreting plasma cells. The secreted antibody (Ab) binds to the antigen and facilitates its clearance from the body. The cell-mediated responses involve various subpopulations of T cells that recognize antigen presented on self-cells. Helper T cells respond to antigen by producing cytokines ...
Exploring S-Shaped Growth
Exploring S-Shaped Growth

Association between Tuberculin Skin Test Reactivity, the Memory
Association between Tuberculin Skin Test Reactivity, the Memory

... of inflammation, the immune dysregulation that better characterizes the increased susceptibility of HIV-infected people to TB. In the present study, we compared, in HIV-1–infected and – uninfected persons from a South African community with a very high incidence of TB, the immunophenotypes of cells ...
Trained immunity: a new avenue for tuberculosis vaccine development
Trained immunity: a new avenue for tuberculosis vaccine development

... studies have shown that children with low-diversity flora are at higher risk of dysregulated immune function [39, 40]. In fact, the microbiome plays a pivotal role in the normal development of the immune system, as studies of germ-free mice have shown that several immunological structures such as se ...
The avian lung-associated immune system: a review
The avian lung-associated immune system: a review

... successful control of pathogen invasion and pathogen replication at the bronchus-associated mucosal surface and in the lung tissue. This implicates that vaccination strategies should induce effector mechanisms which help to prevent pathogen invasion in the first place. One way of achieving this goal ...
Review
Review

... capacity to suppress Teff proliferation. Otherwise, activated TRegs were recently reported to suppress B-cell proliferation in vitro by inducing apoptosis of these cells via a granzyme-B-mediated cytotoxic mechanism in a perforin-dependent way [52]. This suggests involvement of granzyme-B in a cell ...
free article - University of Kansas Medical Center
free article - University of Kansas Medical Center

... A large body of evidence supports the hypothesis that RRMS is an autoimmune disease mediated by autoreactive T cells capable of recognizing antigens normally compartmentalized in the brain. This self-recognition event may first occur in peripheral lymphatic tissue in response to brain antigens leaki ...
Adaptive Immune Responses in the Intestinal Mucosa of
Adaptive Immune Responses in the Intestinal Mucosa of

... adaptive local immune responses in the mucosa of MC patients is however far from elucidated. The present study investigates phenotypic and functional characteristics of the adaptive local immune responses in the colonic mucosa of these patients. Our immunohistochemistry and flow cytometry studies (P ...
THE MANY FACES OF MONOCLONAL GAMMOPATHIES
THE MANY FACES OF MONOCLONAL GAMMOPATHIES

Nanoparticle surface charge impacts distribution, uptake and lymph
Nanoparticle surface charge impacts distribution, uptake and lymph

... pulmonary delivery has the most potential. In this article, the authors investigated the interaction of nanoparticles with various types of lung antigen presenting cells in an attempt to understand the cellular mechanisms. The findings would further help the future design of much improved vaccines f ...
< 1 ... 76 77 78 79 80 81 82 83 84 ... 523 >

Cancer immunotherapy



Cancer immunotherapy (immuno-oncology) is the use of the immune system to treat cancer. Immunotherapies fall into three main groups: cellular, antibody and cytokine. They exploit the fact that cancer cells often have subtly different molecules on their surface that can be detected by the immune system. These molecules, known as cancer antigens, are most commonly proteins, but also include molecules such as carbohydrates. Immunotherapy is used to provoke the immune system into attacking the tumor cells by using these antigens as targets.Antibody therapies are the most successful immunotherapy, treating a wide range of cancers. Antibodies are proteins produced by the immune system that bind to a target antigen on the cell surface. In normal physiology the immune system uses them to fight pathogens. Each antibody is specific to one or a few proteins. Those that bind to cancer antigens are used to treat cancer. Cell surface receptors are common targets for antibody therapies and include the CD20, CD274, and CD279. Once bound to a cancer antigen, antibodies can induce antibody-dependent cell-mediated cytotoxicity, activate the complement system, or prevent a receptor from interacting with its ligand, all of which can lead to cell death. Multiple antibodies are approved to treat cancer, including Alemtuzumab, Ipilimumab, Nivolumab, Ofatumumab, and Rituximab.Cellular therapies, also known as cancer vaccines, usually involve the removal of immune cells from the blood or from a tumor. Immune cells specific for the tumor are activated, cultured and returned to the patient where the immune cells attack the cancer. Cell types that can be used in this way are natural killer cells, lymphokine-activated killer cells, cytotoxic T cells and dendritic cells. The only cell-based therapy approved in the US is Dendreon's Provenge, for the treatment of prostate cancer.Interleukin-2 and interferon-α are examples of cytokines, proteins that regulate and coordinate the behaviour of the immune system. They have the ability to enhance anti-tumor activity and thus can be used as cancer treatments. Interferon-α is used in the treatment of hairy-cell leukaemia, AIDS-related Kaposi's sarcoma, follicular lymphoma, chronic myeloid leukaemia and malignant melanoma. Interleukin-2 is used in the treatment of malignant melanoma and renal cell carcinoma.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report