• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Online Data Supplements
Online Data Supplements

... CAC AGG TTC CT-3'. Polymerase chain reaction (PCR) was carried out using a standard Taq DNA polymerase kit (Takara Taq; Takara, Otsu, Japan). The amplification condition of 96C denaturation for 1 minute, 60C annealing for 1 minute, and 72C extension for 1 minute was used for 30 cycles in a therma ...
DNA barcoding as a diagnostic tool DNA barcoding is a generic
DNA barcoding as a diagnostic tool DNA barcoding is a generic

... DNA barcoding as a diagnostic tool DNA barcoding is a generic diagnostic method that uses sequence data of a short standardised genetic marker in an organism's DNA to aid species identification. The chosen marker region should reflect the target species group taxonomy and at the same time provide hi ...
DNA cloning intro - Sundarban Hazi Desarat College
DNA cloning intro - Sundarban Hazi Desarat College

... The DNA is ligated in only one direction, and there is only a low background of non-recombinant plasmids. If only one restriction enzyme is used to cut the vector and insert, then efficiency of ligation is lower, DNA can be inserted in two directions and tandem copies of inserts may be found. To avo ...
pH and enzymes in cheese making File
pH and enzymes in cheese making File

... fits the enzyme shape this is called the active site of the enzyme ...
Determination of the DNA and Amino Acid Sequences of the Lactate
Determination of the DNA and Amino Acid Sequences of the Lactate

... Two oligonucleotide primers used to amplify P. falciparum genomic DNA, 5'ATGGCTCCA AAAGCAAAAATCG3' (Eco RI site) and 5'GAGAATGAAGGCATTAGCTTAA 3' (Pst I site), were complementary to the forward-reverse strands of P. falciparum strains of K1 and PF FCBR LDHs. The PCR was carried out in the presence of ...
Comparison of DNA isolation methods and storage conditions for
Comparison of DNA isolation methods and storage conditions for

... These results indicate that high-quality DNA can be isolated from fly samples stored under a variety of conditions. In addition, successful PCR is possible when the amount of template DNA used for amplification varies widely, here, fifteen-fold. This demonstrates that quantitation of DNA is not nece ...
typing methods - Micro-Rao
typing methods - Micro-Rao

... It is sometimes important to analyse multiple isolates within a given species to determine whether they represent a single strain or multiple strains. If a species of bacteria is isolated and cultivated in the laboratory it is known as a strain. A single isolate with distinctive characteristic[s] ma ...
Enzymes
Enzymes

Lecture 27
Lecture 27

FACTORS AFFECTING ENZYME ACTION
FACTORS AFFECTING ENZYME ACTION

PDF
PDF

... approach described in this report, a tingle transformant, harbouring pSA3, when grown nonselectively will incorporate the plasmid into its genomc. This is particularly relevant to Lactobacil. /us spp. which can often only be transformed at vepj low frequencies, thereby precluding the use of suicide ...
Lecture 4: Lecture Notes + Textbook
Lecture 4: Lecture Notes + Textbook

... replicated through an intermediate circular double-stranded replicative form (RF) containing (+) and (-) strands only the (+) strand is packaged into new virus particles about 1000 progeny M13 are produced per generation M13 does not kill its bacterial host, thereby allowing large quantities of M13 ...
enzymes - charlestonbiology
enzymes - charlestonbiology

Unit 7 packet pt 5
Unit 7 packet pt 5

... 12. What base is missing on RNA, & what other base replaces it? ...
• Warm-up What are the four macromolecules and their function?
• Warm-up What are the four macromolecules and their function?

Molecular Biology
Molecular Biology

... http://www.bio.umass.edu/biochem/mydna/modules/charge.html ...
Animal Physiology an..
Animal Physiology an..

Enzymes - OpenStax CNX
Enzymes - OpenStax CNX

... the reaction of their substrates is by creating an optimal environment within the active site for the reaction to occur. Certain chemical reactions might proceed best in a slightly acidic or non-polar environment. The chemical properties that emerge from the particular arrangement of amino acid resi ...
Enzymes - OpenStax CNX
Enzymes - OpenStax CNX

... the reaction of their substrates is by creating an optimal environment within the active site for the reaction to occur. Certain chemical reactions might proceed best in a slightly acidic or non-polar environment. The chemical properties that emerge from the particular arrangement of amino acid resi ...
HL DNA_Jeopardy 2016
HL DNA_Jeopardy 2016

... And identify two things that would be not produced in low light intensity during the Light Dependent reaction that would affect the Calvin ...
Nucleic acid engineering
Nucleic acid engineering

... Organization and composition of prokaryotic and eukaryotic ribosomes ...
Chemical Reactions and Enzymes
Chemical Reactions and Enzymes

... A.They would happen too slowly to support cellular processes B.They would happen too rapidly to support cellular processes C.They would happen at the same rate as they do with enzymes D.They would happen normally, only they use different reactants ...
Final Examination
Final Examination

... B)  For polynucleotide strands containing the same number of nucleotides, the A‐DNA strand  will be shorter from end‐to‐end than the corresponding B‐DNA.   C)  A‐DNA forms under more dehydrating conditions than B‐DNA.   D)  The planes of the nitrogenous bases are not perpendicular to the helix axis  ...
Lecture 11
Lecture 11

Classification of Enzymes - Lectures For UG-5
Classification of Enzymes - Lectures For UG-5

< 1 ... 42 43 44 45 46 47 48 49 50 ... 101 >

Restriction enzyme

A restriction enzyme or restriction endonuclease is an enzyme that cuts DNA at or near specific recognition nucleotide sequences known as restriction sites. Restriction enzymes are commonly classified into three types, which differ in their structure and whether they cut their DNA substrate at their recognition site, or if the recognition and cleavage sites are separate from one another. To cut DNA, all restriction enzymes make two incisions, once through each sugar-phosphate backbone (i.e. each strand) of the DNA double helix.These enzymes are found in bacteria and archaea and provide a defense mechanism against invading viruses. Inside a prokaryote, the restriction enzymes selectively cut up foreign DNA in a process called restriction; while host DNA is protected by a modification enzyme (a methyltransferase) that modifies the prokaryotic DNA and blocks cleavage. Together, these two processes form the restriction modification system.Over 3000 restriction enzymes have been studied in detail, and more than 600 of these are available commercially. These enzymes are routinely used for DNA modification in laboratories, and are a vital tool in molecular cloning.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report