• Study Resource
  • Explore Categories
    • Arts & Humanities
    • Business
    • Engineering & Technology
    • Foreign Language
    • History
    • Math
    • Science
    • Social Science

    Top subcategories

    • Advanced Math
    • Algebra
    • Basic Math
    • Calculus
    • Geometry
    • Linear Algebra
    • Pre-Algebra
    • Pre-Calculus
    • Statistics And Probability
    • Trigonometry
    • other →

    Top subcategories

    • Astronomy
    • Astrophysics
    • Biology
    • Chemistry
    • Earth Science
    • Environmental Science
    • Health Science
    • Physics
    • other →

    Top subcategories

    • Anthropology
    • Law
    • Political Science
    • Psychology
    • Sociology
    • other →

    Top subcategories

    • Accounting
    • Economics
    • Finance
    • Management
    • other →

    Top subcategories

    • Aerospace Engineering
    • Bioengineering
    • Chemical Engineering
    • Civil Engineering
    • Computer Science
    • Electrical Engineering
    • Industrial Engineering
    • Mechanical Engineering
    • Web Design
    • other →

    Top subcategories

    • Architecture
    • Communications
    • English
    • Gender Studies
    • Music
    • Performing Arts
    • Philosophy
    • Religious Studies
    • Writing
    • other →

    Top subcategories

    • Ancient History
    • European History
    • US History
    • World History
    • other →

    Top subcategories

    • Croatian
    • Czech
    • Finnish
    • Greek
    • Hindi
    • Japanese
    • Korean
    • Persian
    • Swedish
    • Turkish
    • other →
 
Profile Documents Logout
Upload
Contrasting Effects of ENU Induced Embryonic Lethal Mutations of
Contrasting Effects of ENU Induced Embryonic Lethal Mutations of

... (U44942) and includes the ATG start codon and 730 bases of the first intron. We have identified six exons common to all transcripts, and all five of the internal exons are flanked by recognizable splice sites (see AJ012812–AJ012816). PCR amplification from genomic DNA verifies that all introns are a ...
Add Health Biomarker - Carolina Population Center
Add Health Biomarker - Carolina Population Center

... The urine specimen would be tested for two curable STIs—chlamydia and gonorrhea. The urine samples would also be tested for other STIs but, because those tests have not yet been approved by the FDA as reliable using urine specimens, they would only be used for exploratory purposes and their results ...
A-10484A SNPs. Mutations and DNA Sequence
A-10484A SNPs. Mutations and DNA Sequence

... We carried out single-plex and multiplex SNP reactions using a panel of 10 SNPs. PCR products were obtained for each individual SNP as separate reactions. Primers were designed so that none of the products exceeded 1000 bps in size. During design they were also masked for repeats using the human rep ...
The genome-scale interplay amongst xenogene silencing
The genome-scale interplay amongst xenogene silencing

... A variety of parameters orchestrate the gene expression state of a cell. For example, several global transcription factors and chromatin structuring proteins––together with a constellation of local transcription regulators––ensure maintenance of gene expression homeostasis. In exponentially growing ...
rational selection of pcr-based platforms for pharmacogenomic testing
rational selection of pcr-based platforms for pharmacogenomic testing

... Traditional techniques for SNP genotyping detection by Single-Strand Conformational Polymorphism (SSCP) and Heteroduplex analysis have now been largely replaced by high-throughput methods including “in silico” discovery platforms. These latter methods generate much more data and are easier to automa ...
Microbial Detection and Elimination
Microbial Detection and Elimination

... hyorhinis, M. fermentans and M. arginini, and Acheloplasma laidlawii. These species are responsible for most mycoplasma contaminations in cell culture. At the concentrations recommended for use, no cytotoxic effects have been found, and the treatment can be performed within 12 days. ...
METHODS FOR DETERMINING BIOGENICITY IN ARCHEAN AND
METHODS FOR DETERMINING BIOGENICITY IN ARCHEAN AND

... Most previous studies of ancient fossils have relied primarily on petrographic sections studied by optical microscopy. The use of petrographic sections ensures that the possible microfossils are actually included within the rock. Surface techniques, particularly scanning electron microscopy (SEM), h ...
DNA interference: DNA-induced gene silencing in the
DNA interference: DNA-induced gene silencing in the

... recognizes and cleaves the target mRNA [3]. It is now known that RNAi operates in a broad range of organisms from fungi to vertebrates [4,5]. On the other hand, DNA interference (DNAi) has also been reported in a few species of plants, ciliates and archaeans. In tobacco and Adiantum, introduction of ...
Full-Text PDF
Full-Text PDF

... 22, 25, 28, 30, 35, 37, 40 and 45 °C and pH 4.5, 5, 5.5, 6.0, 6.5, 6.8, 7.2, 7.5 and 8.0. Nitrogen sources were tested by using liquid LMM medium in which KNO3 (0.1 g·L−1) was replaced by 0.1 g·L−1 of NH4Cl, methylamine or glycine. The growth of strains was also tested in triplicate with nitrogen-fr ...
Normal Microbial Flora of the Human Body
Normal Microbial Flora of the Human Body

... The skin and mucous membranes always harbor a variety of microorganisms that can be arranged into two groups: (1) The resident flora consists of relatively fixed types of microorganisms regularly found in a given area at a given age; if disturbed, it promptly reestablishes itself. (2) The transient ...
Molecular identification of tick-borne pathogens in
Molecular identification of tick-borne pathogens in

... F2: TAAACCAA TTTGTTGGT R2: TCTGCCCAGGGTTTAAGTCGG ...
Molecular detection of pathogenic leptospiral serovars by PCR
Molecular detection of pathogenic leptospiral serovars by PCR

... used for PCR, and our study was conducted for the first time on this gene in Iran. In the present study, it was found that the lipL21 gene was present in pathogenic leptospiral serovars whereas absent in saprophytic Leptospira biflexa. In another study conducted by Cullen and colleagues showed that ...
Submitting an RNA-Seq job at PATRIC
Submitting an RNA-Seq job at PATRIC

... quantifying transcript abundance, testing for differential gene expression and determining operon structures[1]. • Tuxedo is part of TopHat2[2], which allows for variable-length indels with respect to the reference genome and also aligns reads across fusion breaks, which can occur after genomic ...
Using a Single-Nucleotide Polymorphism to Predict
Using a Single-Nucleotide Polymorphism to Predict

... samples are then boiled to rupture the cell membranes and extract the DNA. As the cells lyse they also release enzymes that degrade nucleic acids (DNA and RNA), but many of these enzymes require metal ions as cofactors (Mg++). The Chelex® resin in the sample tubes binds all the free metal ions prese ...
Homologous and Nonhomologous Rearrangements: Interactions
Homologous and Nonhomologous Rearrangements: Interactions

... a population of N artificial haploid organisms with flexible genomes. Although a description of the model has already been published (see Knibbe et al. (2008) and its supp. mat.), we thereafter provide an overview of the most important principles that are necessary to have a good understanding of th ...
DNA Sequence Variation in the Human Y Chromosome: Functions
DNA Sequence Variation in the Human Y Chromosome: Functions

... specific (heteromorphic) sequences. We identified two such heteromorphic (male specific) sequences, though not involved in sex determination but showed cross hybridization with a few mammalian species [2, 6]. This indicates that some of the repeat sequences present on the human Y chromosome may have ...
The Nucleotide Sequence Determination of Catalases of Three
The Nucleotide Sequence Determination of Catalases of Three

... although the primary sequence of its ORF is similar to that of CTA1 at least in the homology score. Recently, the entire genomic sequence of C. glabrata was released on the website (URL: http://cbi.labri.fr/Genolevures/elt/CAGL). According to this information, nucleotide sequence of the catalase is ...
Bacteria - General - Austin Community College
Bacteria - General - Austin Community College

... Butter is produced by inoculating pasteurized cream or milk with a lactic starter culture which includes Streptococcus cremoris, S. diacetylactis and S. lactis. and allowing the fermentation to proceed until the required amount of acidity is obtained. The acidified cream is churned until the thick b ...
Full-Text PDF
Full-Text PDF

... non-exhaustive table indicating natural habitat, life-styles and pathogenicity for human beings is proposed for most OBPs described in this review in Table 1. 2. Environment is a ‘Nursery’ for Emerging OBPs Mutualist bacteria, also named commensal bacteria, members of the human microbiota, are good ...
Antisense derivatives of U7 small nuclear RNA as
Antisense derivatives of U7 small nuclear RNA as

... other easily transfectable cell types), we directly introduce the pSP64-derived U7 Sm OPT plasmid by this route. The splicing reporter can either be a stable component of the cell genome or it can be co-transfected along with the modified U7 plasmid. For cells in culture that are refractory to DNA t ...
A Genetic, Deletion, Physical, and Human Homology Map of the
A Genetic, Deletion, Physical, and Human Homology Map of the

... absent from the lofj6g1 deletion are interspersed in the integrated transcript map with other genes that we have shown are present on the deletion chromosome (Table 1). As the contiguity of genes in the deletion was confirmed by the clone contig map, we conclude that although the radiation hybrid tr ...
Updated ISSR and agarose gel protocol
Updated ISSR and agarose gel protocol

... 1. Make gel solution (1.2% agarose solution) in a 250 mL flask. Mix together 1.08 g agarose and 90 mLs of 1X TBE buffer (in 5 gal. tub by sink in room with gel rigs) 2. Heat to boiling in microwave. I recommend reducing the microwave power to 50% to limit the loss of your gel from boilover. Watch th ...
CHAPTER 6
CHAPTER 6

... • Polymers linked 3' to 5' by phosphodiester bridges. • Ribonucleic acid and deoxyribonucleic acid. • Know the shorthand notations. • Sequence is always read 5' to 3'. • In terms of genetic information, this corresponds to "N to C" in proteins. • The base sequence of a nucleic acid is its distinctiv ...
PDF
PDF

... for 5 min at room temperature. The cells were lysed by the addition of 1% SDS' and digested with proteinase K (50 pg/ml) a t 60 "C for 2 h. The DNA was precipitated with 1 volume of ice-chilled isopropyl alcohol in the presence of 0.3 M sodium acetate, spooled out, washed with 70% ethanol, resuspend ...
Endogenous Retroviral Elements in Human DNA1
Endogenous Retroviral Elements in Human DNA1

... a retroviral tRNApro primer-binding site (23) yielded various retroviral sequences of 5 to 9 kilobases. Nucleotide sequencing of DNA sections upstream of the putative primer binding site showed all characteristic features of C-type retroviral LTRs. We have found human DNA to contain a number of endo ...
< 1 ... 71 72 73 74 75 76 77 78 79 ... 359 >

Metagenomics



Metagenomics is the study of genetic material recovered directly from environmental samples. The broad field may also be referred to as environmental genomics, ecogenomics or community genomics. While traditional microbiology and microbial genome sequencing and genomics rely upon cultivated clonal cultures, early environmental gene sequencing cloned specific genes (often the 16S rRNA gene) to produce a profile of diversity in a natural sample. Such work revealed that the vast majority of microbial biodiversity had been missed by cultivation-based methods. Recent studies use either ""shotgun"" or PCR directed sequencing to get largely unbiased samples of all genes from all the members of the sampled communities. Because of its ability to reveal the previously hidden diversity of microscopic life, metagenomics offers a powerful lens for viewing the microbial world that has the potential to revolutionize understanding of the entire living world. As the price of DNA sequencing continues to fall, metagenomics now allows microbial ecology to be investigated at a much greater scale and detail than before.
  • studyres.com © 2025
  • DMCA
  • Privacy
  • Terms
  • Report